Oral vaccination using Artemia coated with recombinant Saccharomyces cerevisiae expressing cyprinid herpesvirus-3 envelope antigen induces protective immunity in common carp (Cyprinus carpio var. Jian) larvae

Journal Pre-proof Oral vaccination using Artemia coated with recombinant Saccharomyces cerevisiae expressing cyprinid herpesvirus-3 envelope antigen induces protective immunity in common carp (Cyprinus carpio var. Jian) larvae

Yanping Ma, Zhenxing Liu, Le Hao, Jing Wu, Baotian Qin, Zhiling Liang, Jiangyao Ma, Hao Ke, Hongwei Yang, Yugu Li, Junming Cao PII:

S0034-5288(19)31142-7

DOI:

https://doi.org/10.1016/j.rvsc.2020.03.013

Reference:

YRVSC 3998

To appear in:

Research in Veterinary Science

Received date:

4 November 2019

Revised date:

3 March 2020

Accepted date:

6 March 2020

Please cite this article as: Y. Ma, Z. Liu, L. Hao, et al., Oral vaccination using Artemia coated with recombinant Saccharomyces cerevisiae expressing cyprinid herpesvirus-3 envelope antigen induces protective immunity in common carp (Cyprinus carpio var. Jian) larvae, Research in Veterinary Science (2019), https://doi.org/10.1016/j.rvsc.2020.03.013

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof

Oral vaccination using Artemia coated with recombinant Saccharomyces cerevisiae expressing Cyprinid herpesvirus-3 envelope antigen induces protective immunity in Common Carp (Cyprinus carpio var. Jian) larvae 1

Yanping Ma , Zhenxing Liu

1,*

1

2

2

[email protected], Le Hao , Jing Wu , Baotian Qin , Zhiling

Liang1 , Jiangyao Ma1 , Hao Ke1 , Hongwei Yang4 , Yugu Li2 , Junming Cao3,** [email protected] Institute of Animal Health, Guangdong Academy of Agricultural Sciences; Key Laboratory of

f

1

oo

Livestock Disease Prevention of Guangdong Province; Scientific Observation and Experiment Station of Veterinary Drugs and Diagnostic Techniques of Guangdong Province, Ministry of

pr

Agriculture and Rural Affairs, PRC, Guangzhou, 510640, China.

College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China.

3

Guangdong Ocean University, Zhanjiang 524088, China.

4

College of Animal Science and Technology, Zhongkai University of Agriculture and Engineering,

Pr

e-

2

*

Corresponding authors.

rn

Abstract

al

Guangzhou 510225, China.

Jo u

Cyprinid herpesvirus 3 (CyHV-3) is the etiological agent of koi herpersvirus disease (KHVD), which causes serious economic losses in global common carp and ornamental koi carp production of larvae as well as adult type fish. To control KHVD, vaccines against CyHV-3 utilizing different immunization routes have been developed, among them, oral vaccination is the most desirable method to prevent fish diseases occurring at the early larval stage. Here, we developed an oral subunit vaccine through the Saccharomyces cerevisiae cell surface display of CyHV-3 envelope protein pORF65, then, the recombinant yeast fed to Artemia which served as bio-encapsulation vector by subsequently feeding the common carp (Cyprinus carpio var. Jian) larvae. The fluorescent observation showed that the Artemia and S. cerevisiae could deliver intact antigen to the hindgut of carp larvae suggesting the possibility of the vector for oral immunization. On this basis, after three immunizations at a week interval, the oral vaccine induced high level of specific anti-pORF65 antibody. Meanwhile, a significant difference of immune-related genes expression

Journal Pre-proof occurred including cxca, IL-1β, IFN-a1, lysozyme, IgM and CD8α between vaccined group and blank control group. In addition, 30 % of relative percent survival of carp larvae after immunization was obtained post the animal infection assay, offered an certain immune protection. Our results indicated that the oral pORF65 subunit vaccine bioencapsulated in Artemia induced the activation of immune response and high level of antibodies, which could be served as an oral vaccine candidate for the prevention of CyHV-3 infection.

Keywords Cyprinid herpesvirus 3, Saccharomyces cerevisiae surface display, pORF65 subunit vaccine,

oo

f

Artemia, Oral vaccination.

1. Introduction

pr

There is a long history of common carp cultivation in China as food fish and ornamental fish. Now

e-

they are coming up against serious threaten from a variety of infectious diseases, such as koi herpesvirus disease (KHVD), which caused skin graze, excessive secretion of mucus, apoptotic

Pr

degeneration of multiple organs of koi and carp. The disease is highly contagious and extremely virulent with mortality rate up to 80 %–100 % (Michel et al., 2010; Miwa et al., 2015; Zheng et al.,

al

2017; Su and Su, 2018; Adamek et al., 2019). KHVD was caused by cyprinid herpesvirus 3

rn

(CyHV-3) also named as KHV, which is considered to be the archetypal fish alloherpesvirus and was first isolated in the USA in the 1990s (Hedrick et al., 2000; Boutier et al., 2015). To date,

Jo u

CyHV-3 has spread worldwide, causes severe economic losses to the carp culture and become one of the most factors influencing the sustainable development of carp breeding industry (Ma et al., 2015; Negenborn et al., 2015; Zheng et al., 2017). Several strategies have been employed to control the spread of the KHVD (Ronen et al., 2003; Boutier et al., 2015), among these, vaccination serves as a very effective control strategy for prevention of virus diseases. To date, only one commercial live attenuated immersion vaccine was approved for the vaccination of koi and common carp in Israel (KV3, KoVax Ltd, Israel) (Boutier et al., 2015). In addition, several gene-deleted CyHV-3 had been constructed and could induce protection against virus infection (Schröder et al., 2019), however, the risk of reversion to virulence could not yet be neglected. In contrast to live virus vaccines, DNA vaccines against CyHV-3 based on ORF25, 65, 81 proteins have been developed, although the attempt to immunize carp with oral gavage has been tried, the intramuscular injection was preferred in utilization of

Journal Pre-proof DNA vaccine, which was labour consuming, stress responses of fish (Zhou et al., 2014a; Zhou et al., 2014b; Embregts et al., 2019a; Li et al., 2019). Subunit vaccine would provide one alternative owing to its safety profile, especially, live vector displayed - subunit vaccine has been developed, which provides the possibility of oral immune (Cui et al., 2015; Zhao et al., 2017; Zhang et al., 2018; Embregts et al., 2019b), and it is not restricted by a minimum fish size in contrast to injection based vaccination. Among these, a Saccharomyces cerevisiae surface display system is utilized as excellent protein expression system for subunit vaccine construction (Zhao et al., 2017; Embregts et al., 2019b ).

oo

f

Oral administration is a more promising immunization route for fish at all life stages including the larval stage, since it is safe, low stress for fish and easy to use. To protect the antigen from

pr

gastrointestinal digestion and effectively deliver antigen to the hindgut of fish, various oral

e-

immunization strategies have been developed (Su and Su, 2018; Embregts et al., 2019a; Embregts et al., 2019b; Mutoloki et al., 2015), among these, the bio-encapsulation using live Artemia

Pr

appears to be one of the most promising, the advantage of this oral vaccination method is that the antigen is contained in a natural starter feed (Artemia) for fish larvae, ensuring the uptake of

al

antigen (Lin et al., 2007; Chen et al., 2011; Embregts et al., 2019b).

rn

In this paper, an oral subunit vaccine based on the S. cerevisiae cell surface display of CyHV-3 envelope protein pORF65 had been developed. Then, it was delivered to the hindgut by being

Jo u

encapsulated in Artemia to fulfill the oral immunization. The protection of the antigen against digestion, delivery of antigen to the hindgut, activation of immune response and the protection against CyHV-3 infection induced by oral immunization were evaluated.

2. Materials and methods 2.1. Virus, strains and animals The Cyprinid herpesvirus-3 (CyHV-3) virus used as a challenge pathogen in this study was isolated from koi in Guangdong. The virus was previously cultured in a Jian carp brain cell line (CCB-J) established from Jian carp brain cells in our laboratory previously, then the virus was collected from the supernatant of the infected cell culture with 90 % cytopathic effect (CPE) after 15th passage infection, and stored at -80 °C until use. The TCID50 of the virus was tested before each use according to the previous report (Wang et al., 2018).

Journal Pre-proof The recombinant S. cerevisiae strain (pYD1-pORF65-EGFP/EBY100) was constructed in this study, which was induced by the YNB liquid medium containing 2 % galactose (Dingguo, China) for 72 h at 20 °C, the induced strain was centrifuged at 5, 000 g for 5 min and washed three times using sterile PBS, and stored at 4 °C until use. The concentration was tested before each use. Common carp larvae (Cyprinus carpio var. Jian) were provided by the fish breeding company (Tongwei, China) and acclimatized at least two days at 23 °C in a recirculating UV-treated water system before experiments. Animal experiments were performed in accordance with the animal ethics committees of institute of animal health, Guangdong academy of agricultural sciences.

oo

f

2.2. Production of recombinant Saccharomyces cerevisiae

S. cerevisiae strain EBY100 and plasmid pYD1 were provided by Invitrogen company (Invitrogen,

pr

USA). The plasmid has a strong GAL1 promoter for regulated expression of the AGA2 gene fusion

e-

with the interested gene allowing secretion and display to the yeast cell wall. The B cell epitope of CyHV-3 pORF65 protein was predicted in our previous study (Ma et al.,

Pr

2018). Then the B cell epitope fragment and the enhanced green fluorescence protein gene with optimized codon usage for S. cerevisiae was synthesized in a biotech company (Genewiz, China).

al

The constructs were cloned in the pYD1 between the BamHI and XhoI and between XbaI and

rn

BstBI successively and sub-cloned into E. coli. The resulting expression plasmid pYD1-pORF65-EGFP was transferred to EBY100, the positive recombinant yeast was confirmed

Jo u

by PCR. A single positive recombinant EBY100 was cultured in 5 ml YNB medium with 2 % glucose at 30 °C for 48 h, 1: 10 diluted culture was inoculated into 50 ml YNB medium with 2 % glucose and cultured at 30 °C until OD600 value of the culture was 2.4, then the culture was centrifuged at 5, 000 g for 5 min, washed three times and added 150 ml YNB medium with 2 % galactose and induced expression at 20 °C. The clone expressing the highest amount of recombinant protein was identified using fluorescence image analysis, flow cytometry analysis and western-blotting analysis probed with anti-pORF65 mouse serum. For large-scale production of recombinant protein, a lab-scale fermentation with 2 L working volume was carried out in YNB medium with 2 % galactose at 20 °C. 2.3. Anti-pORF65 mouse serum preparation To prepare the pORF65 protein antibody, The purified prokaryotic expressed pORF65 protein was prepared in our laboratory previously and protein was quantified with the BCA protein assay kit

Journal Pre-proof (Dingguo, China) (Ma et al., 2018). The 50 μg purified pORF65 protein was emulsified with same volume of freund’ s complete adjuvant, then the emulsified purified pORF65 protein was immunized into BALB/c mice through multipoint subcutaneous injection. After 10 days, the additional 50 μg purified pORF65 protein was emulsified with same volume of freund’ s incomplete adjuvant, then the emulsified purified pORF65 protein was immunized into the same BALB/c mice 3 times every 10 days. The serum titer was measured using ELISA, the serum was collected and stored at -80 °C until use.

2.4. Biological envelope with Artemia

oo

f

Artemia nauplii were hatched from cysts according to the supplier ’ s instructions (Yuleyuan, China). The nauplii were suspended in fresh aerated filtered PBS buffer with the suitable

pr

conditions (salinity > 2.5 %, pH > 8.0, dissolved oxygen > 6.0) to a density of 500 Artemia/ml, then a concentrated solution of EBY100 expressing pORF65 protein of CyHV-3 and EGFP protein

e-

(pYD1-pORF65-EGFP/EBY100) were added to a final concentration of 3 × 106 yeast/ml,

Pr

meanwhile, Artemia delivered EBY100 expressing only EGFP protein (pYD1-EGFP/EBY100, constructed by our laboratory previously) and only EBY100 at the same concentration as the

al

negative vaccine control groups for the CyHV-3 pORF65 vaccine. The live Artemia containing

rn

recombinant yeast were used for oral vaccination or were frozen at -20 °C for later use. In order to evaluate the quality of the Artemia delivery, the fluorescence intensity of 10 Artemia

Jo u

containing EBY100 expressing EGFP protein and the same number of Artemia containing EBY100 was counted using fluorescence microscopy and analyzed using image J software. The result was reported as mean fluorescence value and the assay was performed in triplicate and repeated at least three times.

2.5. Oral administration of Artemia-EGFP to common carp Hatched Artemia feeding pYD1-EGFP/EBY100 was washed three times with sterile PBS buffer 3

and resuspended in PBS buffer at a concentration of 2 × 10 / ml. Common carp of 18 days old (n = 50 / group) received 100 μl Artemia suspension (200 Artemia / carp) by oral gavage, whereas the control group received 100 μl Artemia suspension containing EBY100. At 3 h, 12 h after treatment, the intestines of 3 fish was removed, cleaned and the lumen was rinsed three times with PBS to remove non - internalized Artemia. Then the intestine segments were snap-frozen in liquid nitrogen, 5 μm cryosections were air-dried, fixed in 4 % paraformaldehyde in PBS for 1 h, rinsed

Journal Pre-proof three times with PBS and stained with DAPI kit (Geneview, Germany). Uptake of Artemia - EGFP was visualized using fluorescence microscope (Bio-Rad, USA). At 6 h, 24 h after treatment, the complete intestines of 3 fish from the Artemia - EGFP group and 3 fish from the control group were dissected, washed three times with HBSS buffer to remove non-internalized Artemia, and the midgut and hindgut were digested separately using 200 U collagenase I according to the instruction of the producer (Invitrogen, USA). The Green fluorescence in gut cells was detected using a BD Bection Dickinson FACSCanto II Flow Cytometer (BD, China). Data analysis was performed using FlowJo software. The assays were performed in triplicate and repeated at least

oo

f

three times.

2.6. Immunization procedures

pr

Common carp larvae of 18 days old were randomly divided into 12 groups (50 fish every group)

e-

in 5 L tanks for each group. All tanks were supplied with flow-through tap water and heater and air stone to maintain desired water temperature and dissolved oxygen (DO) levels. Fish were

Pr

maintained on a 12: 12 h light / dark period at water temperature of 25 °C. Animals were immunized orally with either pYD1-pORF65-EGFP/EBY100, pYD1-EGFP/EBY100, EBY100

al

coated in Artemia in three replicates. All bioencapsulated Artemia orally fed fish fully twice a day

rn

for one week. On average, 200 Artemia were consumed by individual common carp larvae at each inoculation. After primary immunization, the fish were immunized two other same immunizations

Jo u

with intervals of one week feeding blank Artemia. The other three groups immunized with blank Artemia twice a day until the end of the trial (42 d) as negative controls. To aviod loss of recombinant protein in water feeding, fresh intact bioencapsulated Artemia was used in each inoculation.

2.7. Assessment of anti-CyHV-3 pORF65 antibody of common carp larvae After immunization, three vaccinated fish at 2 weeks (after first immunization), 4 weeks (after second immunization), 6 weeks (after third immunization) respectively in each group were anesthetized with eugenol and used for humoral antibody determination. Adding 500 μl PBS, the whole each fish was homogenized with a scientz-48 high throughput tissue grinder (Scientz, China). The homogenate was centrifuged at 12, 000 g for 30 min, and the supernatant was collected, measured total protein content using BCA protein assays (Dingguo, China) and stored at -80 °C until use.

Journal Pre-proof Purified recombinant CyHV-3 pORF65 protein prepared in our laboratory previously was used as the coating antigen (10 μg / well) in 0.05 M bicarbonate buffer (pH 9.6) at 4 °C overnight on the ninety-six-well microtiter plates, wells were then blocked with 5 % skim milk-PBS at 37 °C for 2 h, washed five times using PBST buffer and 1 μg humoral protein in fish tissue supernatant was used directly as the primary antibody. Then an antibody, 1: 3000 diluted mouse anti-carp IgM and a secondary antibody, 1: 8000 diluted HRP-goat anti-mouse IgG were added into each well and incubated at 37 °C for 1 h in turn. TMB Color Development Kit (Dingguo, China) were added to each well (100 μl), color development stopped by adding 2 M H2 SO4 and absorbance was

oo

f

determined at 450 nm using a microplate reader (Thermo, USA). Antibody reactivity was reported as OD values. The assay was performed in triplicate and repeated at least three times.

pr

2.8. Assessment of immune - related genes and cytokines expression by real - time PCR assay

e-

After final immunization, three common carp were randomly selected from each immunized group at 42 d and anesthetized with eugenol, then covering them with ice, the total RNA of the

Pr

liver, spleen was extracted using the mRNA Mini Kit (Omega, USA), according to manufacturer’ s instructions. And RNA concentration was determined by NanoDropLITE spectrophotometer

al

(Thermo, USA). Then, 1 μg total RNA was used as template to synthesize complementary DNA

rn

(cDNA) using the HiScript® II Q RT SuperMix for qPCR kit (+gDNA wiper) (Vazyme, China) according to manufacturer ’ s instructions and immediately stored at -20 °C until use. Purified

Jo u

cDNA and gene-specific primer pairs were used for real-time PCR assays using SYBR green reagents (Vazyme, China) (Table 1). The immune related genes containing interferon a1 (IFN-a1), myxovirus resistance protein 1 (mx1), lysozyme (LYZ), immunoglobulin M (IgM), IgT, cluster of differentiation 4 (CD4), CD8α, T cell receptor γ (TCRγ), interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), chemokine a (cxca), and cxcb were evaluated immune-stimulant effects of Artemia coated EBY100-expressed subunit vaccines, using the house-keeping gene encoding 40S ribosomal protein as the control. qPCR was performed with the ChamQ

TM

®

SYBR qPCR Master

Mix (Vazyme, China), according to the manufacturer ’ s instructions. Target gene expressions were calculated with the △△CT method. The assay was performed in triplicate and repeated at least three times. 2.9. Animal infections Forty-two days after immunization, 18 fish were challenged with 20 μl of a 100 TCID50 CyHV-3

Journal Pre-proof infected cell suspernatant (HZ419, highly virulent, originally isolated in 2012 in south China) through inoculating CyHV-3 onto the gills in all test groups according to our previous report (Liu et al., 2014), 6 fish in each group were not exposed to virus as blank negative animal infections. Mortality rates were recorded daily for 42 days, then, the dead fish were collected for the KHVD diagnosis by PCR method in combination with clinical necropsy signs. The PCR was performed acorrding to manual of diagnostic tests for aquatic animals (2019) (OIE, https://www.oie.int/en/standard-setting/aquatic-manual/access-online/) (Table 1). The protection effect was evaluated as the relative percent survival (RPS). RPS = (percent mortality in control

oo

f

group - percent mortality in the treatment group) / percent mortality in control group × 100 %. 2.10. Statistical analysis

pr

SPSS software (SPSS Inc., USA) was used to perform the statistical analysis. All the data were

e-

calculated by one-way ANOVA program, except for survival rate analysis, calculated using crosstabs chi-square test. Data are presented as a mean ± standard deviation. P-values < 0.05 were

Pr

considered to be statistically significant. P-values < 0.01 were considered to be highly significant.

3. Results

al

Significance was depicted as, not significant (NS), * P < 0.05, ** P < 0.01.

rn

3.1. Construction and expression of recombinant Saccharomyces cerevisiae

Jo u

The recombinant plasmid (pYD1-ORF65-EGFP) was constructed successfully and confirmed by PCR (Supplementary fig. 1) and sequence analysis, and the plasmid was transformed into EBY100. Western-blotting analysis probed with anti-pORF65 mouse serum showed that the expression product obtained 71.0 kDa fusion expressed protein fragment, which was in line with expected recombinant protein size (Fig.1A). Cell green fluorescence observation analysis showed that the recombinant protein (pORF65-EGFP fusion gene) was expressed on the cell wall of EBY100 (Fig.1B). And flow cytometry analysis showed that recombinant protein (pORF65-EGFP fusion gene) was expressed on the cell wall of EBY100 having the maximum expression at 72 h and the expression ratio was 26.6 % (Fig. 1C).

3.2. Biological envelope with Artemia In order to study the vaccine of larvae of fish, the use of Artemia for vaccine delivery the antigen orally is convenient and necessary. For this, we fed Artemia with EBY100-EGFP, noticed green

Journal Pre-proof fluorescence in the digestive tract of Artemia 12 h after being fed with EBY100-EGFP and analyzed the value of green fluorescence through Image J software. As shown in Fig. 2, the value of EBY100-EGFP-Artemia was significantly higher than EBY100-Artemia (P < 0.05). The result showed that Artemia can be a good delivery carrier for yeast displayed subunit vaccine. In addition, to study the uptake of EBY100-EGFP-Artemia to the intestine of carp after oral delivery and to evaluate the stability and suitability of antigen delivery by Artemia to gut of carp, we made the frozen section of the Artemia-fed carp intestine, 12 h after feeding with the EBY100-EGFP-Artemia, as shown in Fig. 3, we detected EGFP fluorescence in the epithelium

oo

f

and lamina propria of intestine of carp. 3 h after feeding with the EBY100-EGFP-Artemia, we +

detected intact EGFP yeast particle in lumen of carp. However, no EGFP fluorescence occurred

pr

in carp received Artemia suspension containing EBY100 in control group. The results suggested

e-

that the Artemia can deliver the intact yeast to the intestine and protected the external antigen from digestion and reached the absorption sites of the intestine of carp. In parallel to the above

Pr

experiment, the rate of EGFP + cells in Artemia-fed carp intestine was confirmed by flow +

cytometry, as shown in Fig. 4, we detected EGFP cells in midgut and hindgut of carp, a slight

al

difference in external antigen uptake and localization of EGFP protein between the two segments

rn

of the carp intestine, with the midgut displaying higher EGFP fluorescence at both time points at 6 h and 24 h. And there were higher EGFP fluorescence at 6 h post-treatment than at 24 h

Jo u

post-treatment, indicating the EGFP uptake at 6 h post-treatment was already occurred and processed until 24 h. However, no EGFP + cells were detected in carp received Artemia suspension containing EBY100 in control group. These results indicated that Artemia was able to serve as excellent bio-encapsulation carrier and be a very promising way to facilitate delivery intact antigen to the intestine of fish larvae.

3.3. Specific antibody induced by oral vaccination Two week (after first immunization), four week (after second immunization), six week (after third immunization) post-vaccination, the tissue homogenate supernatants were collected, specific anti-CyHV-3 pORF65 antibody level was detected through ELISA test. There was a significant increase of mean absorbance in vaccinated group (pYD1-65-EGFP/EBY100/Artemia) at four week and six week compared with the control groups (pYD1-EGFP/EBY100/Artemia, EBY100/Artemia, blank Artemia) (P < 0.05), however, there was no significant difference of

Journal Pre-proof mean absorbance between control groups (pYD1-EGFP/EBY100/Artemia, EBY100/Artemia, blank Artemia). The result indicated that oral vaccination could induce a specific immune reaction (Fig. 5).

3.4. Gene expression analysis in spleen and liver tissues after oral vaccination To determine whether the modulatory effects of pYD1-pORF65-EGFP/EBY100/Artemia vector evaluated immune-related gene expression profiles varied in post-immunized carp larvae compared with the control fish, we analyzed expression level of immune-related genes including IL-1β, TNF-α, cxca, cxcb, IFN-a1, mx1, LYZ, IgT, IgM, CD4, CD8α, TCRγ in spleen and liver

oo

f

tissues post-immunization. The result revealed that exposure of carp larvae to pYD1-pORF65-EGFP/EBY100/Artemia vaccine had greater expression in cxca, IL-1β, LYZ,

pr

IFN-a1, IgM and CD8α genes than that of carp larvae in blank Artemia group. Comparing the

e-

levels in immunized carp larvae and non-immunized carp larvae showed that cxca, LYZ and IgM genes had significant different expression between pYD1-pORF65-EGFP/EBY100/Artemia group

Pr

and blank Artemia group in spleen and liver tissue, among them, expression of IgM gene in liver tissue of pYD1-pORF65-EGFP/EBY100/Artemia group had highly significantly greater than that

al

of blank Artemia group. IFN-a1, IL-1β, CD8α genes had significantly greater expression in spleen

rn

tissue of pYD1-pORF65-EGFP/EBY100/Artemia group than that of blank Artemia group. (Significant P < 0.05, highly significant P < 0.01) (Fig. 6).

Jo u

3.5. Protection studies

Common carp in all the vaccination groups (n = 18 / every group) were challenged with 20 μl 100 TCID50 of CyHV-3 virus through inoculating CyHV-3 onto the gills after the immunization. The dead fish was examined. Almost all dead carp larvae developed the typical clinical signs including ocular fundus hemorrhage, skin lesion, gill necrosis, kidney enlargement. And the death in blank Artemia control group occurred after 10 days post challenge, however, death of carp larvae in pYD1-pORF65-EGFP/EBY100/Artemia-immunized group occurred until 23 days. Then, the CyHV-3 virus was identified from the brain, liver and spleen of dead fish in all groups through PCR assay (Supplementary fig. 2). Meanwhile, all fish without exposure to virus had no death in entire virus infection observation period (data not shown). It can be concluded that CyHV-3 infection was the main cause of carp death in the present study. And as shown in Fig. 7, mean cumulative survival rate was calculated after 42 d of infection, 61 % of

Journal Pre-proof pYD1-pORF65-EGFP/EBY100/Artemia-immunized carp was protected from CyHV-3 challenge, and 30 % of RPS in pYD1-pORF65-EGFP/EBY100/Artemia-immunized carp was obtained. The pYD1-pORF65-EGFP/EBY100/Artemia significantly increased the survival rates compared with the blank Artemia through crosstabs chi-square test (P < 0.05), and there was no significant survival difference after infections between control groups (pYD1-EGFP/EBY100/Artemia, EBY100/Artemia, blank Artemia), the immunization with pYD1-EGFP/EBY100/Artemia and EBY100/Artemia obviously delayed death progress compared with blank Artemia. The results suggested that immunization formulation with S. cerevisiae-expressed recombinat pORF65

oo

f

protein coated in Artemia provided an certain protection and delayed death progress for common carp larvae.

pr

4. Discussion

e-

Vaccination has become essential to overcome disease outbreaks, although several different vaccines are studied, only a part of them can be applied in fish larvae (Lin et al., 2007; Chen et al.,

Pr

2011; Petit and Wiegertjes, 2016; Rojo-Cebreros et al., 2018; Embregts et al., 2019b), ideally, the immunization in fish larvae could increase protection level until adult fish and could help to avoid

al

important losses due to infections and improve fish welfare (Lin et al., 2007; Kai et al., 2008;

rn

Chen et al., 2011; Kai et al., 2014; Chien et al., 2018; Humberto et al., 2018). In this study, we could show delivery of CyHV-3 pORF65 envelope antigen to the intestine of carp

Jo u

larvae using Artemia fed with the cell wall-displayed recombinant S. cerevisiae, which was chosen for vaccine encapsulation induc ing a protective immune response may be due to several factors, (i) using the natural starter feed for fish larvae facilitated the uptake of vaccine by carp larvae (Tillner et al., 2015); (ii) S. cerevisiae cell wall and Artemia cuticle protected the antigen from gastrointestinal degradation and enabled delivery of sufficient antigen to the hindgut, and then, recognized by antigen presenting cells in the mucosal layer of the hindgut (Zhang et al., 2016; Embregts et al., 2019b; Kumar and Kumar, 2019); (iii) selected recombinant protein expressed in cell wall of S. cerevisiae was feasible to be captured by the carp body (Zhao et al., 2017; Wen et al., 2019); (iv) S. cerevisiae as good immunostimulant or an adjuvant in vaccine formulation using in aquaculture industry induced good immune response (Selvaraj et al., 2005; Lin et al., 2007; Chen et al., 2011; Zhao et al., 2017). Our present study demonstrated that S. cerevisiae not only served as an immunostimulant, which

Journal Pre-proof can induce innate immunity, but also stimulated the system immune response for enhancing the effectiveness of the oral vaccine as an adjuvant. Compared with blank Artemia, pYD1-EGFP/EBY100/Artemia and EBY100/Artemia groups induced greater expression of immune related genes involved in the immune system of carp larvae (IgM in liver and spleen tissue and lysozyme in liver tissue) and pro-inflammatory cytokine (IL-1β in spleen tissue). In this study, using EGFP protein as tracer molecule, we analyzed delivery and uptake process of the EBY100-EGFP-Artemia through frozen section observation and flow cytometric analysis. The result suggested Artemia and S. cerevisiae could deliver intact antigen to hindgut of carp larvae

oo

f

and the antigen could be ingested from epithelial layer to lamina propria in mucosal layer of intestine. Embregts reported that Pichia pastoris used as bio-vehicle delivered EGFP antigen to

pr

juvenile or adult carp and trout (Embregts et al., 2019b), to our knowledge, the present study is the

e-

first to describe the Artemia and S. cerevisiae used as good bio-encapsulation could successfully delivered the intact antigen to carp larvae against CyHV-3 infection.

Pr

On this above basis, we constructed recombinant S. cerevisiae (pYD1-ORF65-EGFP/EBY100) and fed Artemia, obtained the oral subunit vaccine vector

al

(pYD1-ORF65-EGFP/EBY100/Artemia). After three times of immunizations at one week interval,

rn

the ELISA results showed that the vaccine vector elicited a high specific humoral immune response against pORF65 protein. qRT-PCR results showed that the vaccine vector induced

Jo u

significantly greater expression of immune related genes including lysozyme (LYZ), IgM, CD8α, IFN-a1, cxca, IL-1β. Lysozyme is of the important innate immune factors often been used as indicators for the effects of intrinsic or extrinsic factors on the immune system as well as the disease resistance of fish (Ma et al., 2017; Safari et al., 2017). IgM and CD8α are the humoral immunity (Yamaguchi et al., 2013; Stosik et al., 2018) and cellular immunity indicator respectively. Antiviral activity indicator (IFN-a1), chemokine (cxca) and pro-inflammatory factor (IL-1β) are immune related cytokines indicators, which activate and stimulate chemotaxis of macrophage, NK cells and lymphocytes (Zou and Secombes, 2016; Embregts et al., 2017; Bhatt et al., 2018; Zhang et al., 2018; Pereiro et al., 2019). Altogether, these results support the notion that S. cerevisiae displayed CyHV-3 pORF65 encapsulated in Artemia can trigger both innate as well as CyHV-3 specific immune responses, regulate immune factors. And 30 % of RPS of the oral vaccine vector showed the certain protection for the carp larvae, which suggested the vaccine

Journal Pre-proof vector in this study could apply in carp larvae against CyHV-3 infection. The similar study was reported in grouper larvae against nervous necrosis virus (NNV) infection (Lin et al., 2007; Chen et al., 2011). Lin et al. used E. coli expressing vector encapsulated in Artemia, provided effectively protection (69.5 % of RPS after 17 days of inoculation) (Lin et al., 2007). Chen et al. used Vibrio anguillarum expression vector encapsulated in Artemia, enhanced efficacy in a shorter incubation period and could reduce the risk of NNV infection (51.3 % of RPS after 7days of inoculation) (Chen et al., 2011). The S. cerevisiae cell wall displayed expression host can be used to produce an CyHV-3 pORF65

oo

f

subunit vaccine in bio-encapsulation in Artemia technology to provide early protection for carp larvae against CyHV-3 infection. For immunization of carp larvae, the mode and effect of immune

pr

inoculation are very limited because of immature immune system possibly ( Humberto et al., 2018),

e-

therefore, the only drawback in our study is the lower antigen production of this expression system,

protection is in further research.

Pr

for this, increasing antigen production of the S. cerevisiae expression system to enhance immune

In this study, we first constructed an CyHV-3 pORF65 subunit vaccine in bio-encapsulation with

al

Artemia successfully for the immunization of common carp larvae. The results lay the foundation

rn

for research on the development of an oral vaccine to supplement the current fish larvae-type

Jo u

vaccine against CyHV-3 virus infection.

Acknowledgments

This work was supported in parts by Special Fishing Harbors Construction and Fishery Industry Development Project of Guangdong Province (A201701C04), Science and Technology Planning Project of Guangdong Province (2016A020210029), National Natural Science Foundation of China (31402347), Science and Technology Planning Project of Guangzhou City (201707010216), Natural Science Foundation of Guangdong Province (2018A030310193). The following are the supplementary data related to this article. Supplementary fig. 1 PCR pattern profiles of recombinant pYD1-pORF65-EGFP plasmid. Lane 1, the PCR result of 65F/65R primers amplified from pYD1-pORF65-EGFP plasmid; Lane 2, the PCR result of EGFP-F/EGFP-R primers amplified from pYD1-pORF65-EGFP plasmid. Supplementary fig. 2 PCR amplification results of CyHV-3 virus of brain, liver and spleen tissues

Journal Pre-proof of challenged dead fish. M: Takara DNA marker DL2, 000; Lane 1-12, the PCR amplification results of CyHV-3 virus of brain, liver and spleen tissues of the pYD1-pORF65-GFP/EBY100/Artemia groups; Lane 13-27, the PCR amplification results of CyHV-3 virus of brain, liver and spleen tissues of the pYD1-GFP/EBY100/Artemia groups; Lane 28-42, the PCR amplification results of CyHV-3 virus of brain, liver and spleen tissues of the EBY100/Artemia groups; Lane 43-66, the PCR amplification results of CyHV-3 virus of brain, liver and spleen tissues of the blank Artemia

oo

f

groups; +, postive control; -, negative control.

Reference

pr

Adamek, M., Matras, M., Dawson, A., Piackova, V., Gela, D., Kocour, M., et al., 2019. Type I

e-

interferon responses of common carp strains with different levels of resistance to koi herpesvirus disease during infection with CyHV-3 or SVCV. Fish. Shellfish. Immunol. 87, 809-819.

Pr

Bhatt, P., Kumaresan, V., Palanisamy, R., Ravichandran, G., Mala, K., Amin, S.M.N., et al., 2018. A mini review on immune role of chemokines and its receptors in snakehead murrel Channa

al

striatus. Fish. Shellfish. Immunol. 72, 670-678.

rn

Boutier, M., Ronsmans, M., Rakus, K., Jazowiecka-Rakus, J., Vancsok, C., Morvan, L., 2015.

Jo u

Cyprinid Herpesvirus 3: An Archetype of Fish Alloherpesviruses. Adv. Virus. Res. 93, 161-256a. Boutier, M., Ronsmans, M., Ouyang, P., Fournier, G., Reschner, A., Rakus, K., et al., 2015. Rational development of an attenuated recombinant cyprinid herpesvirus 3 vaccine using prokaryotic mutagenesis and in vivo bioluminescent imaging. PLoS. Pathog. 11, e1004690b. Chen, Y.M., Shih, C.H., Liu, H.C., Wu, C.L., Lin, C.C., Wang, H.C., et al., 2011. An oral nervous necrosis virus vaccine using vibrio anguillarum as an expression host provides early protection. Aquaculture, 321, 26-33. Chien, M.H., Wu, S.Y., Lin, C.H., 2018. Oral immunization with cell-free self-assembly virus-like particles against orange-spotted grouper nervous necrosis virus in grouper larvae, Epinephelus coioides. Vet. Immunol. Immunopathol. 197, 69-75. Cui, L.C., Guan, X.T., Liu, Z.M., Tian, C.Y., Xu, Y.G., 2015. Recombinant lactobacillus expressing G protein of spring viremia of carp virus (SVCV) combined with ORF81 protein of koi

Journal Pre-proof herpesvirus (KHV): A promising way to induce protective immunity against SVCV and KHV infection in cyprinid fish via oral vaccination. Vaccine. 33, 3092-3099. Embregts, C.W.E., Rigaudeau, D., Veselý, T., Pokorová, D., Lorenzen, N., Petit, J., et al., 2017. Intramuscular DNA vaccination of juvenile carp against spring viremia of carp virus induces full protection and establishes a virus-specific B and T cell response. Front. Immunol. 8, 1340. Embregts, C.W.E., Tadmor-Levi, R., Veselý, T., Pokorová, D., David, L., Wiegertjes, G.F., et al., 2019. Intra-muscular and oral vaccination using a Koi Herpesvirus ORF25 DNA vaccine does not confer protection in common carp (Cyprinus carpio L.). Fish. Shellfish. Immunol. 85, 90-98a.

oo

f

Embregts, C.W.E., Reyes-Lopez, F., Pall, A.C., Stratmann, A., Tort, L., Lorenzen, N., et al., 2019. Pichia pastoris yeast as a vehicle for oral vaccination of larval and adult teleosts. Fish. Shellfish.

pr

Immunol. 85, 52-60b.

e-

Hedrick, R.P., Gilad, O., Yun, S., Spangenberg, J.V., Marty, G.D., Nordhausen, R. W., 2000. A

Aquat. Anim. Health. 12(2000) 44-57.

Pr

herpesvirus associated with mass mortality of juvenile and adult koi, a strain of common carp. J.

Humberto, R.C.A., Leonardo, I.C., Martínez-Brown Juan, M., 2018. Immunostimulation and

al

trained immunity in marine fish larvae. Fish. Shellfish. Immunol. 80, 15-21.

rn

Kai, Y.H., Chi, S.C., 2008. Efficacies of inactivated vaccines against betanodavirus in grouper larvae (Epinephelus coioides) by bath immunization. Vaccine. 26, 1450-1457.

Jo u

Kai, Y.H., Wu, Y.C., Chi, S.C., 2014. Immune gene expressions in grouper larvae (Epinephelus coioides) induced by bath and oral vaccinations with inactivated betanodavirus. Fish. Shellfish. Immunol. 40, 563-569.

Kumar, R., Kumar, P., 2019. Yeast-based vaccines: New perspective in vaccine development and application. FEMS. Yeast. Res. 19, pii: foz007.01. Li, Y., Liu, Z.X., Ma, Y.P., Cao, J.M., Ma, J.Y., Hao, L., et al., 2019. Protection of Jian carp with immunization of CyHV-3 ORF65 DNA vaccine. South. China. Fish. Sci. 15, 122-126. Lin, C.C., Lin, H.Y., Chen, M.S., Yang, H.L., 2007. An oral nervous necrosis virus vaccine that induces protective immunity in larvae of grouper (Epinephelus coioides). Aquaculture. 268, 265-273. Liu, Z.X., Ke, H., Ma, Y.P., Hao, L., Feng, G.Q., Ma, J.Y., et al., 2014. Oral passive immunization of carp Cyprinus carpio with anti-CyHV-3 chicken egg yolk immunoglobulin (IgY). Fish. Pathol.

Journal Pre-proof 49, 113-120. Ma, Y.P., Hao, L., Liang, Z.L., Ma, J.Y., Li, Y. Ke, H., et al., 2018. Establishment of Cyprinid herpesvirus 3 pORF65 antibody detection method on the indirect carp serum ELISA. South. China. Fish. Sci. 14, 113-119. Ma, Y.P., Ke, H., Liang, Z.L.,Ma, J.Y., Hao, L., Liu, Z.X., 2017. Protective efficacy of cationic-PLGA microspheres loaded with DNA vaccine encoding the sip gene of Streptococcus agalactiae in tilapia. Fish. Shellfish. Immunol. 66, 345-353. Ma, Y.P., Liu, Z.X., Hao, L., Ma, J.Y., Liang, Z.L., Li, Y.G., et al., 2015. Analysing codon usage

oo

f

bias of cyprinid herpesvirus 3 and adaptation of this virus to the hosts. J. Fish. Dis. 38, 665-673. Michel, B., Fournier, G., Lieffrig, F., Costes, B., Vanderplasschen, A., 2010. Cyprinid herpesvirus

pr

3. Emerg. Infect. Dis. 16, 1835-1843.

e-

Miwa, S., Kiryu, I., Yuasa, K., Ito, T., Kaneko, T., 2015. Pathogenesis of acute and chronic diseases caused by cyprinid herpesvirus-3. J. fish. Dis. 38, 695-712.

Pr

Mutoloki, S., Munang'andu, H.M., Evensen, Ø., 2015. Oral vaccination of fish-antigen preparations, uptake, and immune induction. Front. Immunol. 6, 519.

al

Negenborn, J., van der Marel, M.C., Ganter, M., Steinhagen, D., 2015. Cyprinid herpesvirus-3

rn

(CyHV-3) disturbs osmotic balance in carp (Cyprinus carpio L.) -- A potential cause of mortality. Vet. Microbiol. 177, 280-288.

Jo u

Pereiro, P., Figueras, A., Novoa, B., 2019. Insights into teleost interferon-gamma biology: An update. Fish. Shellfish. Immunol, 90, 150-164. Petit, J., Wiegertjes, G.F., 2016. Long-lived effects of administering β-glucans: indications for trained immunity in fish. Dev. Comp. Immunol. 64, 93-102. Rojo-Cebreros, A.H., Ibarra-Castro, L., Martínez-Brown, J.M., 2018. Immunostimulation and trained immunity in marine fish larvae. Fish. Shellfish. Immunol. 80, 15-21. Ronen, A., Perelberg, A., Abramowitz, J., Hutoran, M., Tinman, S., Bejerano, I., et al., 2003. Efficient vaccine against the virus causing a lethal disease in cultured Cyprinus carpio. Vaccine. 21, 4677-4684. Safari, R., Hoseinifar, S.H., Nejadmoghadam, S., Khalili, M., 2017. Apple cider vinegar boosted immunomodulatory and health promoting effects of Lactobacillus casei in common carp (Cyprinus carpio). Fish. Shellfish. Immunol. 67, 441-448.

Journal Pre-proof Schröder, L., Klafack, S., Bergmann, S.M., Lee, P.A., Franzke, K., Höper, D., et al., 2019. Characterization of gene deletion mutants of Cyprinid herpesvirus 3 (koi herpesvirus) lacking the immunogenic envelope glycoproteins pORF25, pORF65, pORF148 and pORF149. Virus. Res. 261, 21-30. Selvaraj, V., Sampath, K., Sekar, V., 2005. Administration of yeast glucan enhances survival and some non-specific and specific immune parameters in carp (Cyprinus carpio) infected with Aeromonas hydrophila. Fish. Shellfish. Immunol. 19, 293-306. Stosik, M.P., Tokarz-Deptula, B., Deptula, W., Specific humoral immunity in Osteichthyes. Cent.

oo

f

Eur. J. Immunol. 43(2018) 335-340.

Su, H., Su, J., 2018. Cyprinid viral diseases and vaccine development. Fish. Shellfish. Immunol.

pr

83, 84-95.

e-

Tillner R., Assheuer T., Rennert B., Trubiroha A., Clemmesen C., Wuertz S., 2015. Evaluation of an improved RNA/DNA quantification method in a common carp (Cyprinus carpio Linnaeus 1758)

Pr

larval feeding trial with Artemia, two nematodes (Panagrellus redivivus Linnaeus 1758, Panagrolaimus sp. Fuchs 1930) and dry feed. J. Appl. Ichthyol. 31, 8.

al

Wang, Y., Zeng, W., Wang, Q., Li, Y., Bergmann, S.M., Zheng, S., et al., 2018. Establishment and

rn

characterization of a new cell line from koi brain (Cyprinus carpio L.). J. Fish. Dis. 41, 357-364. Wen, F., Smith, M.R., Zhao, H., 2019. Construction and screening of an antigen-derived peptide

2024, 213-234.

Jo u

library sisplayed on yeast cell surface for CD4+ T cell epitope identification. Methods. Mol. Biol.

Yamaguchi, T., Katakura, F., Someya, K., Dijkstra, J.M., Moritomo, T., Nakanishi, T., 2013. Clonal growth of carp (Cyprinus carpio) T cells in vitro: long-term proliferation of Th2-like cells. Fish. Shellfish. Immunol. 34, 433-442. Zhang, C., Wang, Y., Ma, S., Li, L., Chen, L., Yan, L., et al., 2016. Human enterovirus 71 protein displayed on the surface of saccharomyces cerevisiae as an oral vaccine. Viral. Immunol. 29, 288-295. Zhang, D.X., Kang, Y.H., Chen, L., Siddiqui, S.A., Wang, C.F., Qian, A.D., et al., 2018. Oral immunization with recombinant Lactobacillus casei expressing OmpAI confers protection against Aeromonas veronii challenge in common carp, Cyprinus carpio. Fish. Shellfish. Immunol. 72, 552-563.

Journal Pre-proof Zhao, J.Z., Xu, L.M., Liu, M., Cao, Y.S., LaPatra, S.E., Yin, J.S., et al., 2017. Preliminary study of an oral vaccine against infectious hematopoietic necrosis virus using improved yeast surface display technology. Mol. Immunol. 85, 196-204. Zheng, S., Wang, Q., Bergmann, S.M., Li, Y., Zeng, W., Wang, Y., et al., 2017. Investigation of latent infections caused by cyprinid herpesvirus 3 in koi (Cyprinus carpio) in southern China. J. Vet. Diagn. Invest. 29, 366-369. Zhou, J.X., Wang, H., Li, X.W., Zhu, X., Lu, W.L., Zhang, D.M., 2014. Construction of KHV-CJ ORF25 DNA vaccine and immune challenge test. J. Fish. Dis. 37, 319-325a.

oo

f

Zhou, J., Xue, J., Wang, Q., Zhu, X., Li, X., Lv W., 2014. Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp. In. Vitro. Cell. Dev.

pr

Biolo. Anim. 50, 489-495b.

e-

Zou, J., Secombes, C.J., 2016. The function of fish cytokines. Biology(Basel). 5, pipl: E23.

Pr

Fig. 1 The expression results of pYD1-pORF65-EGFP/EBY100 confirmed by cell green fluorescence observation, western-blot and flow cytometry analysis. A: western-blot analysis

al

result showed that recombiant pYD1-pORF65-EGFP/EBY100 product was probed with

rn

anti-pORF65 mouse serum, which obtained 71.0 kDa fusion-expressed protein; B: cell green fluorescence observation analysis result showed that pORF65 antigen was expressed on the cell

Jo u

wall of recombinant EBY100; C: flow cytometry analysis result showed that pYD1-pORF65-EGFP/EBY100 had the maximum expression at 72 h and the expression ratio was 26.6 %.

Fig. 2 The green fluorescence analysis in biological envelope with Artemia 12 h after larvae fish received Artemia-EGFP by oral gavage through Image J software. The Tukey’ s comparison of the control and the treatment groups is shown. * represent a significant difference from negative control (P < 0.05). Fig. 3 Uptake analysis of Artemia-EGFP in intestinal of Common carp Larvae through cryosections 3 h and 12 h after larvae fish received Artemia-EGFP by oral gavage. Cryosections of 5 μm were prepared after fish received of Artemia-EGFP by oral gavage. Control fish received blank Artemia. DAPI was used to visualize cell nuclei. Uptake of EGFP+ Artemia is visible by green fluorescence (EGFP).

Journal Pre-proof Fig. 4 Uptake analysis of Artemia-EGFP in intestinal of common carp Larvae through flow cytometric analysis 6 h and 24 h after larvae fish received Artemia-EGFP by oral gavage. Intestinal cells were prepared and digested after fish received of Artemia-EGFP by oral gavage. Control fish received blank Artemia. Data show a representative flow cytometry histograms of EGFP+ cells in midgut and hindgut tissue. Fig. 5 Specific antibody anti-pORF65 induced by oral vaccination. Each point represents mean values ± standard deviations (n = 9). The Tukey’ s comparison of the control and the treatment groups is shown. * represent a significant difference from negative control (P < 0.05).

oo

f

Fig. 6 Effect on Immunological factors expression of immunized common carp larvae. Data are presented as mean values ± standard deviations (n = 9). The Tukey’ s comparison of the control

pr

and the treatment groups is shown. * represent a significant difference from negative control (P <

e-

0.05), ** represent a highly significant difference from negative control (P < 0.01). Fig. 7 The cumulative survival rate after infection of high-virulent CyHV-3 virus in immunized

Pr

common carp larvae. Data are presented as mean values ± standard deviations (n = 3). The crosstabs chi-square test of the control and the treatment groups is shown.

al

Table. 1 Primers for this study

Oligonucleotide sequence

Reference or source

rn

Primer

65F 65R EGFP-F EGFP-R

Jo u

Primers for pYD1-pORF65-EGFP vector construction GCGGATCCTTCATGCCATCTGATGTTCAAG

This study

GCCTCGAGAGTAACAGTGTTAGAAGCTGAAGC

This study

GCTCTAGAGGTGGTGGTGGTTCAATGGTGAGC AAGGGCGAGGAGC GCTTCGAACTTGTACAGCTCGTCCATGCCG

This study This study

Primers for real-time PCR IgM-F

CACAAGGCGGGAAATGAAGA

[30]

IgM-R

GGAGGCACTATATCAACAGCA

[30]

IgT-F

AAAGTGAAGGATGAAAGTGT

[30]

IgT-R

TGGTAACAGTGGGCTTATT

[30]

mx1-F

ACAATTTGCGGTCTTTGAGA

[30]

Journal Pre-proof

mx1-R

CCCTGCCATTTCTCTTCG

[30]

TTATGTCGGTGCGGCCTTC

[19]

TNFα-R

AGGTCTTTCCGTTGTCGCTTT

[19]

IL1β-F

AAGGAGGCCAGTGGCTCTGT

[30]

IL1β-R

CCTGAAGAAGAGGAGGAGGCTGTCA

[30]

IFNa1-F

AACAGTCGGGTGTCGCAA G

[19]

IFNa1-R

TCAGCAAACATACTCCCCA G

[19]

40S-F

CCGTGGGTGACATCGTTACA

[30]

40S-R

TCAGGACATTGAACCTCACTGTCT

CXCa-F

CTGGGATTCCTGACCATTGGT

CXCa-R

GTTGGCTCTCTGTTTCAATGCA

CXCb1-F

GGGCAGGTGTTTTTGTGTTGA

[30]

CXCb1-R

AAGAGCGACTTGCGGGTATG

[30]

LYZ-F

GTGTCTGATGTGGCTGTGCT

[36]

LYZ-R

TTCCCCAGGTATCCCATGAT

[36]

CD8α-F

GATCCAGAACGACCGAAAAC

[37]

CD8α-R

TATGGTGGGGACATCGTCTT

[37]

CD4-R TCRγ-F TCRγ-R

oo

pr

e-

Pr

al

rn

Jo u

CD4-F

f

TNFα-F

[30] [30] [30]

GCTGTGATGGCTGGTGACTC

[37]

GACCGACCAGGGAATGTTAGA

[37]

TGGGCAAAAAAGAGCGAAAC

[37]

GAGTCGGGTGGACATGTTGG

[37]

Primers for PCR detection of CyHV-3 virus KHVSphI 5F

GACACCACATCTGCAAGGAG

OIE

KHVSphI 5R

GACACATGTTACAATGGTCGC

OIE

Journal Pre-proof Highlights 

An oral subunit vaccine through the Saccharomyces cerevisiae cell surface display of CyHV-3 envelope protein pORF65.



Recombinant yeast was fed to Artemia which served as bio-encapsulation vector to deliver the oral subunit vaccine.



Artemia and S. cerevisiae could deliver intact antigen to the hindgut of carp fry.



The oral vaccine induced high level of specific anti-pORF65 antibody.



Greater immune-related gene expression was observed including cxca, IL-1β,

oo

rn

al

Pr

e-

pr

The oral subunit vaccine increased the immune protection.

Jo u



f

IFN-a1, lysozyme, IgM and CD8α.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9