Overexpression and purification of the hepatitis B e antigen precursor

Journal of Virological Methods 103 (2002) 67 – 74 www.elsevier.com/locate/jviromet

Overexpression and purification of the hepatitis B e antigen precursor Se´bastien Laine´ a, Samia Salhi b, Jean-Michel Rossignol a,* a

Laboratoire de Ge´ne´tique des Virus, UPR 9053 -CNRS, A6enue de la Terrasse, 91198 Gif sur Y6ette, France b Unite´ de Biochimie Cellulaire, FRE 2219 -CNRS, Uni6ersite´ Pierre et Marie Curie, 9 quai St Bernard, 75252 Paris Cedex 05, France Received 6 September 2001; received in revised form 10 January 2002; accepted 11 January 2002

Abstract Circumstantial evidence suggests that the secreted hepatitis B virus (HBV) e antigen (HBeAg) and/or its 22 kDa precursor (P22) have an essential role in the establishment of persistent infection. In order to identify cellular proteins that could interact with P22, large amounts of this protein are required to perform pull-down assays. A plasmid was constructed encoding a recombinant P22 with a Histidine-tag at its N-terminal extremity (P22r). The initial attempts to overexpress P22r in a conventional Escherichia coli strain failed, most likely due to the presence of rare AGA/AGG codon clusters in the 3% part of the gene. To overcome this difficulty, P22r was overexpressed in the Epicurian coli BL21 -codonplus™ (DE3 )-RIL strain, which possesses extra copies of the ArgU gene that encodes the tRNAAGA/AGG. In this strain, P22r was overexpressed successfully and then purified in milligram quantities by metal affinity chromatography on Ni2 + -chelated His-Bind resin. The purified recombinant protein P22r was able to interact with a cellular protein (P32), which had previously been shown to co-immunoprecipitate with native P22, indicating that at least some of the P22r molecules were folded correctly. © 2002 Elsevier Science B.V. All rights reserved. Keywords: HBV; P22; HBeAg; Precore protein; Overexpression; E. coli epicurian

1. Introduction The multiplication cycle of the hepatitis B virus (HBV) is now well understood (Ganem, 1996). However, the function of the HBV e antigen (HBeAg), a protein found in the serum of patients suffering from acute hepatitis (Hollinger, 1996), remains enigmatic. It derives from a 25 kDa precursor (the precore protein), which is directed * Corresponding author. Tel./fax: +33-1-69-823847. E-mail address: [email protected] (J.-M. Rossignol).

to the secretory pathway by a 19 amino acid-long signal sequence that is cleaved during translocation into the lumen of the endoplasmic reticulum (Junker et al., 1987; Garcia et al., 1988). The resulting protein (P22) has a molecular mass of 22 kDa and is processed further in a post-endoplasmic reticulum compartment by removal of a 34 amino acid-long arginine-rich domain located at its C-terminus, leading to the mature and secreted HBeAg (Wang et al., 1991). Although HBeAg is not required for HBV infection (Tong et al., 1990), circumstantial evidence

0166-0934/02/$ - see front matter © 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 0 2 ) 0 0 0 1 9 - 8

68

S. Laine´ et al. / Journal of Virological Methods 103 (2002) 67–74

(Ou, 1997 for review) suggests that P22 and/or HBeAg could play an important role in establishing persistent infection. To gain new insights into the biological function of P22, the characterisation of cellular proteins that interact with this protein is required and the availability of large amounts of purified P22 is thus necessary to undertake this study. To avoid a possible maturation of P22 by a cellular protease, it was decided to overexpress P22 in bacteria rather than in the baculovirus system. The first attempts to overexpress P22 in Escherichia coli all failed, as full-length P22 was not detectable by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) after Coomassie staining. One explanation for this could be that, in the last 34 amino acids, P22 contains nine arginine residues encoded by AGA or AGG, codons that are used rarely in E. coli (Wada et al., 1992). Indeed AGA and AGG codons are known to affect negatively the translation rate of recombinant proteins in E. coli (Spanjaard et al., 1990; Kane, 1995). To overcome this problem, a new E. coli strain that possesses extra copies of ArgU, LeuY and IleW genes was used. Thus, amounts of tRNAAGA/AGA, tRNACTA and tRNAATA in the Epicurian coli BL21 -codonplus™ (DE3 )-RIL are higher than in E. coli. In this paper, the successful overexpression of the His-tagged P22 protein (P22r) in the Epicurian bacteria and its purification by a single chromatography step are described. It is also demonstrated that at least some molecules of P22r are folded correctly as it interacts with a 32 kDa cellular protein (P32), the interaction between P22r and P32 being dependent on the spatial conformation of P22 (Salhi et al., 2001).

2. Materials and methods

2.1. Construction of plasmid pHP22 The DNA sequence corresponding to P22 was amplified from plasmid pHPC by the polymerase chain reaction (PCR). Plasmid pHPC (formerly named pMLP-PC) has been described previously (Jean-Jean et al., 1989a). Primers (P22N1: CG-

GAATTCCATATGTCCAAGCTGTGCCTTGGGTGGC and P22C1: CGGAATTCTTATGAGTCCAAGGAATACTAAC) were derived from the published HBV C-gene sequence (Galibert et al., 1982). The PCR mixes were heated at 92 °C for 5 min, then the DNA polymerase Goldstar (Eurogentec) was added. The PCR was carried out in a thermal cycler, for 30 cycles, each consisting of 1 min at 92 °C, 1 min at 60 °C and 1 min at 72 °C. At the end, an extra cycle of 1 min at 92 °C and 10 min at 72 °C was performed. The amplified product was digested by appropriate enzymes and then inserted between the NdeI and EcoRI sites of pET28a (Novagen). The resulting plasmid (pHP22) was sequenced by the Sanger method.

2.2. Expression of P22r in Epicurian coli BL21 -codonplus™ (DE3) -RIL Plasmid pHP22 was used to transform Epicurian coli BL21 -codonplus™ (DE3 )-RIL competent cells (Stratagene). Bacteria were grown at 37 °C in 100 ml of Luria Broth (LB) medium supplemented with 10 mg/ml kanamycin and 40 mg/ml chloramphenicol, until an absorbance A600 = 0.6 was reached. At this time, isopropyl-b-Dthiogalactopyranoside (IPTG) (Roche) was added to the culture to a final concentration of 1 mM. Two hours after induction, bacteria were centrifuged at 5000× g for 15 min and resuspended in 10 ml of 50 mM Tris–HCl pH 8.0 containing 2 mM EDTA, 10 mg/ml lysozyme and 0.1% Triton X-100. The lysate was incubated for 15 min at 37 °C, then briefly sonicated and centrifuged at 12,000× g for 15 min. A 100 ml aliquot of the supernatant was used to study the soluble proteins while the pellet (insoluble proteins) was resuspended in 500 ml of Laemmli buffer (Laemmli, 1970). Proteins were then separated by 12.5% SDS-PAGE and detected by Coomassie blue staining.

2.3. Purification of P22r Epicurian coli BL21 -codonplus™ (DE3 )-RIL cells were transformed with pHP22 and grown as described in Section 2.2. Following IPTG induc-

S. Laine´ et al. / Journal of Virological Methods 103 (2002) 67–74

tion, the pellet from a 500 ml culture ( 1.5 g of bacteria) was resuspended in 50 ml of the BugBuster Protein Extraction reagent (Novagen), which contains a mixture of non-ionic detergents and is thus capable of cell wall perforation. Bacteria were lysed following the manufacturer’s instructions and nucleic acids were digested by a genetically engineered non-specific endonuclease (Benzonase from Novagen). The resulting extract has a low viscosity and contains both soluble and insoluble proteins. Inclusion bodies were collected by centrifugation at 16,000×g for 20 min at 4 °C and after complete dispersion of the pellet in the BugBuster reagent, lysozyme was added to a final concentration of 200 mg/ml. After 5 min incubation at room temperature, the suspension was centrifuged at 16,000×g for 15 min at 4 °C to collect the inclusion bodies, which were then resuspended in 50 ml of BugBuster reagent diluted 1:10. The inclusion bodies were then collected by centrifugation for 15 min at 16,000× g and resuspended in 10 ml of loading buffer (50 mM Na2HPO4/ NaH2PO4, pH 7.7, 300 mM NaCl, 8 M urea). The remaining insoluble debris was then eliminated by centrifugation for 30 min at 10,000×g. The resulting supernatant was loaded, at a flow rate of 100 ml/min, onto a Sepharose CL-4B column (Amersham Pharmacia Biotech) precharged with Ni2 + -chelated His-Bind resin (Qiagen). The column was washed with the wash buffer (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl, 8 M urea, 20 mM imidazole) until the A280 returned to the baseline (usually about 20 ml of buffer). Proteins were then eluted with the elution buffer (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl, 8 M urea, 500 mM imidazole). Urea was removed from the purified protein fractions by dialysis for 16 h at 4 °C against buffer 1 (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl, 3 M urea, 5 mM dithiothreitol) followed by dialysis against buffer 2 (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl, 5 mM dithiothreitol) for 16 h at 4 °C. The purified protein was stored at −20 °C in buffer 2 containing 10% (w/v) glycerol.

69

ditions in 10 mm dishes were transfected with 30 mg of plasmid pHPC, using the calcium phosphate co-precipitation procedure (Graham and Van der Eb, 1973). Forty-eight hours after transfection, cells were grown for 1 h in 10 ml of methionine-free cysteine-free Eagle’s minimal essential medium (ICN) followed by 3 h in 6 ml of Eagle’s minimal essential medium containing 400 mCi of [35S]-methionine/[35S]-cysteine (Promix, Amersham Pharmacia Biotech). The cells were then harvested, centrifuged for 10 min at 1600×g and lysed in phosphate buffer saline (PBS)–NP40 buffer (137 mM NaCl, 2 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4, 2% NP40). The cell extract was centrifuged for 15 min at 12,000× g to separate the cytoplasm from the nucleus and the membrane debris. An aliquot corresponding to 5× 107 cpm of cytoplasmic extract was immunoprecipitated with an anti-HBc (Dako) antiserum and analyzed as previously described (Carlier et al., 1994).

3. Results

3.1. Construction of plasmid pHP22 encoding the His-tagged P22 protein (P22r) The pET28a vector was used for the construction of plasmid pHP22. This vector possesses an IPTG-inducible T7 promoter, a kanamycin resistance gene, a sequence coding for both a His-tag (six histidine residues) and a thrombin cleavage site. The P22 coding sequence was cloned as described in Section 2. As shown previously, the C-terminal region of P22 is important for the interaction with cellular proteins (Messageot et al., 1998; Salhi et al., 2001), the P22 DNA was inserted downstream of the His-tag coding sequence. Thus, the recombinant protein (P22r) contained 20 additional amino acid residues at its N-terminus including a cluster of six histidine residues and a thrombin cleavage site that could be used to remove the His-tag (Fig. 1).

3.2. O6erexpression of P22r 2.4. Cell labeling and immunoprecipitation Simian COS-7 cells grown under standard con-

As a first step, the IPTG induction time giving the best overexpression of P22r was determined.

70

S. Laine´ et al. / Journal of Virological Methods 103 (2002) 67–74

Fig. 1. Nucleotide sequence of the 5% part of pHP22 and amino-acid sequence of the N-terminal part of P22r. T7 promoter and Lac operator are represented by arrows as the Ribosome entry site (rbs) and the His-tag. The thrombine cleavage site is underlined. The NdeI restriction site is upperlined and the amino acids from P22r are in bold.

To this end, Epicurian coli BL21 -codonplus™ (DE3 )-RIL cells were transformed with plasmid pHP22 and an IPTG induction time-course was carried out (not shown). The best overexpression of pHP22 was obtained 2 h after the addition of IPTG and consequently this induction time was used in all subsequent experiments. After IPTG induction, the cells were treated to separate the insoluble and soluble proteins, as described in Section 2. The corresponding samples were analyzed on SDS-PAGE (Fig. 2). Two polypeptides in the range of the expected molecular mass of P22r (24.5 kDa) were observed both in the insoluble and soluble fractions of transformed bacteria (Fig. 2, lanes 3 and 4). However, the smaller band (24 kDa) was also present in the insoluble and soluble fractions of non-transformed bacteria (Fig. 2, lanes 1 and 2) and therefore cannot correspond to P22r. On the other hand, the 24.5 kDa species was observed only in the pHP22 transformed bacteria and most likely corresponded to P22r. This assumption was confirmed by a Western blot analysis of insoluble proteins from pHP22 transformed bacteria, using an antiHBc antibody, which is used routinely to immunoprecipitate P22 (data not shown). As P22r was found predominantly in the insoluble proteins (Fig. 2, compare lanes 3 and 4), inclusion bodies from pHP22 transformed Epicurian coli BL21 codonplus™ (DE3 )-RIL were used in further purification experiments. Different buffers were

tested in order to solubilize P22r. In our experience, the use of a buffer containing at least 8 M urea was required to solubilize the majority of the P22r.

Fig. 2. Overexpression of P22r in Epicurian coli BL21 -codonplus™ (DE3 )-RIL. Non-transformed cells ( −) and pHP22 transformed cells ( + ) were treated with 1 mM IPTG for 2 h. Insoluble (I) (lanes 2 and 4) and soluble (S) (lanes 1 and 3) proteins were separated as described in Section 2 and analyzed on 12.5% SDS-PAGE stained with Coomassie Blue. On the right are indicated migration of P22r and on the left, the molecular mass standards in kDa.

S. Laine´ et al. / Journal of Virological Methods 103 (2002) 67–74

71

Fig. 3. Chromatogram of the P22r purification. Each step of purification is presented. The loading step was applied with 0 mM imidazole and the unbounded proteins were collected (peak 1). The washing step was realized with 20 mM imidazole and non-specifically bounded proteins were collected (peak 2). The elution was done with 500 mM imidazole and the eluted proteins were collected (peak 3). The measurement of the absorbance in mAU was indicated on the left. On the right, is indicated the concentration of imidazole used in mM. Elution volume was indicated in ml.

3.3. Purification of P22r Purified inclusion bodies were loaded at flow rate of 100 ml/min onto Sepharose CL-4B charged with Ni2 + chelated His-Bind resin. The result of a typical chromatogram is shown in Fig. 3. Three peaks of absorbance at 280 nm were detected and the corresponding fractions were pooled. Peak 1 corresponded to proteins that were not retained on the column (flow-through fractions) and peak 2 to proteins bound non-specifically (wash fractions). Specifically retained proteins (eluted fractions) were most likely present in peak 3. An SDS-PAGE analysis of an aliquot of these different fractions was performed to confirm this assumption. As expected, the elution fraction (Fig. 4, lane E) contained a substantial amount of highly purified P22r. Based on the 280 nm ab-

sorbance, the total recovery of P22r was determined to be 3 mg/l culture of bacteria, while P22r purity was estimated on SDS-PAGE to be over 95%. However, a significant amount of P22r was not retained on the column (Fig. 5, lane FT) even if a 50 ml/min flow rate for the loading step was used instead of a 100 ml/min.

3.4. Interaction of P22r with a cellular protein The goal of this work was to obtain large amounts of correctly folded P22r to determine the cellular proteins interacting with P22 in the cell. To establish that the purified P22r was indeed folded correctly, its interaction was established with a cellular protein (P32) that was reported recently to interact specifically with P22 (Salhi et al., 2001). Thus, a cell extract containing 35S-la-

72

S. Laine´ et al. / Journal of Virological Methods 103 (2002) 67–74

beled P32 was prepared as described in Section 2 and mixed with about 50 mg of purified P22r. After addition of anti-HBc antibodies, which recognize P22, immunoprecipitated proteins were analyzed by SDS-PAGE followed by autoradiography. As shown in Fig. 5, lane 2, a 32 kDa protein was specifically observed when P22r was added (compare lanes 1 and 2). To confirm that the 32 kDa protein corresponded to P32, an extract from labeled cells expressing P22 was immunoprecipitated with anti-HBc antibodies. As shown in Fig. 5, lane 3, P32 was co-immunoprecipitated with P22 as expected and migrated to exactly the same place on the gel as the 32 kDa species (lane 2). This experiment showed that P32 co-immunoprecipitated in vitro, with the recombinant P22r. However, as we cannot compare the amounts of

Fig. 5. Co-immunoprecipitation of P32 with P22 or P22r. pHPC-transfected cells ( +) (lane 3) and non-transfected cells ( −) (lanes 1 and 2) were metabolically labeled for 3 h. After labeling, proteins from cell extracts were immunoprecipitated with anti-HBc antiserum in the presence ( + ) (lane 2) or absence ( −) (lane 1) of the recombinant protein P22r. The immunoprecipitated proteins were separated on 12.5% SDSPAGE and revealed by autoradiography. On the right are indicated migrations of the cellular P32 and viral P22 proteins. On the left are indicated migrations of molecular mass standards in kDa.

P22r and P22 present in the two assays, (lanes 2 and 3), we can conclude only that at least some P22r molecules are folded correctly and able to interact with P32.

4. Discussion

Fig. 4. Analysis of proteins from pHP22 transformed Epicurian coli BL21 -codonplus™ (DE3 )-RIL after affinity chromatography. Insoluble proteins from pHP22-transformed Epicurian coli BL21 -codonplus™ (DE3 )-RIL were loaded on a His-Bind resin. The proteins that were not retained on the column (flow through, FT), unspecifically bounded (wash, W) and specifically retained (eluate, E) were concentrated. Equal fractions were analyzed on 12.5% SDS-PAGE stained with Coomassie blue. On the right migration of P22r is indicated. Molecular mass standards in kDa are shown on the left.

In this paper, the overexpression and purification of the recombinant precursor of HbeAg are described. The overexpression of P22r was achieved by the use of the Epicurian coli BL21 codonplus™ (DE3 )-RIL strain. To our knowledge, this is the first time that the HBV P22 protein has been overexpressed successfully in bacteria and obtained in milligram quantities. At the beginning of the study, it was speculated that our failure to overexpress P22 in E. coli was due to the presence in the C-terminal part of P22, of arginine codons that are used rarely in conventional E. coli strains. Although this hypothesis

S. Laine´ et al. / Journal of Virological Methods 103 (2002) 67–74

was not demonstrated fully in this paper, it is supported by two complementary results. Firstly, P22 could be overexpressed when the Epicurian strain, which contains extra copies of ArgU, LeuY and IleW genes, was used. Secondly, the overexpression of C-terminally truncated P22 (deleted of its arginine-rich domain) can been achieved in a conventional E. coli strain (not shown). Furthermore, the capsid protein (P21) of HBV, which has exactly the same C-terminal domain as P22 (JeanJean et al., 1989b), has been overexpressed in E. coli only as a C-terminally truncated protein (Bo¨ ttcher et al., 1997; Wynne et al., 1999; Wizemann and Von Brunn, 1999). However, overexpression of the full-length P21 using the Epicurian strain was achieved recently (data not shown). Taken together these results confirm that the presence of AGA/AGG codons is detrimental for the overexpression of P21 and P22. Thus, the use of this newly available bacterial strain avoided the ‘rare codon’ effect on protein expression and consequently significantly increased the yield of P22r expression. A similar observation has been reported for the expression of peanut allergens that have an AGG/AGA codon content of 8 – 10%. In the conventional BL21 (DE3 ) E. coli, these proteins are synthesized with a low yield, whereas they are overexpressed in milligram quantities in the Epicurian coli BL21 codonplus™ (DE3 )-RIL (Kleber-Janke and Becker, 2000). The second difficulty that was encountered was to resolubilize P22r. As mentioned above, a high concentration of urea was required for P22r. This is in apparent contradiction with the result reported recently by Wizemann and Von Brunn (1999). These authors have overexpressed the HBV capsid protein in E. coli, which shares the same amino acid sequence as P22 with the exception of the first 10 amino acids. Despite this strong similarity between the two proteins, Wizemann and Von Brunn (1999) were able to solubilize the HBV capsid protein with a 2 M urea solution. It is possible that this difference between the solubility of capsid protein and P22r was due to their different spatial conformation. This hypothesis is supported by the fact that the capsid protein does not interact with the cellular protein P32 (Salhi et al., 2001) in contrast to P22.

73

As P22r was histidine tagged at the N-terminal end, its purification on a Ni2 + -chelated His-Bind resin was relatively simple. As described, the purification protocol consists of a single chromatography step and was sufficient to prepare P22r with a high purity (\ 95%) in milligram quantities. However, the purified fraction contains 8 M urea that must be removed before any assay of interaction. Consequently, a substantial fraction of P22r (estimated to 30–40%) was precipitated during the dialysis. In addition, it was also shown that recombinant P22r, like native P22, is able to interact with the cellular protein P32. As P22 is known to be present in both the cytosol and the secretory pathway (Garcia et al., 1988; Ou et al., 1989; Guidotti et al., 1996) it may play an important role during HBV infection through interactions with specific cellular proteins in either one or both compartments. Thus, the availability of this recombinant P22 protein should be useful for the identification of these novel cellular targets).

Acknowledgements This work was supported by a grant from the Association pour la Recherche sur le Cancer. We thank Fabienne Messageot and Rhoderick H. Elder for their helpful comments. We are grateful to Marie-The´ re`se Bidoyen and Anne Thouard for their excellent technical assistance.

References Bo¨ ttcher, B., Wynne, S.A., Crowther, R.A., 1997. Determination of the fold of the core protein of hepatitis B virus by electron cryomiscroscopy. Nature 386, 88 – 91. Carlier, D., Jean-Jean, O., Rossignol, J.M., 1994. Characterization and biosynthesis of the Woodchuck hepatitis virus e antigen. J. Gen. Virol. 75, 171 – 175. Galibert, F., Chen, T.N., Mandart, E., 1982. Nucleotide sequence of a cloned Woodchuck hepatitis virus genome: comparison with the hepatitis B virus sequence. J. Virol. 41, 51 – 65. Ganem, D., 1996. Hepadnaviridae: the viruses and their replication. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Virology, 3rd ed. Lippincott-Raven, Philadelphia, pp. 2703 – 2737.

74

S. Laine´ et al. / Journal of Virological Methods 103 (2002) 67–74

Garcia, P.D., Ou, J.H., Rutter, W.J., Walter, P., 1988. Targeting of the hepatitis B virus precore protein to the endoplasmic reticulum membrane: after signal peptide cleavage translocation can be aborted and the product released into the cytoplasm. J. Cell Biol. 106, 1093 –1104. Graham, F.L., Van der Eb, A.J., 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456 – 467. Guidotti, L.G., Matzke, B., Pasquinelli, C., Shoenberger, J.M., Rogler, C.E., Chisari, F.V., 1996. The hepatitis B virus (HBV) precore protein inhibits HBV replication in transgenic mice. J. Virol. 70, 7056 –7061. Hollinger, F.B., 1996. Hepatitis B virus. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Virology, 3rd ed. Lippincott-Raven, Philadelphia, pp. 2738 –2807. Jean-Jean, O., Levrero, M., Will, H., Perricaudet, M., Rossignol, J.M., 1989a. Expression mechanism of the hepatitis B virus (HBV) C gene and biosynthesis of HBeAg antigen. Virology 170, 99 – 106. Jean-Jean, O., Salhi, S., Carlier, D., Elie, C., De Recondo, A.-M., Rossignol, J.M., 1989b. Biosynthesis of hepatitis B virus e antigen: directed mutagenesis of the putative aspartyl protease site. J. Virol. 63, 5497 –5500. Junker, M., Galle, P., Schaller, H., 1987. Expression and replication of the hepatitis B virus genome under foreign promoter control. Nucl. Acid Res. 15, 10 117 –10 132. Kane, J.F., 1995. Effect of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Curr. Opin. Biotechnol. 6, 494 –500. Kleber-Janke, T., Becker, W.M., 2000. Use of modified BL21(DE3) Escherichia coli cells for high-level expression of recombinant peanut allergens affected by poor codon usage. Protein Expr. Purif. 19, 419 – 424. Laemmli, U.K., 1970. Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature 227, 680 – 685.

Messageot, F., Carlier, D., Rossignol, J.M., 1998. The C terminus of the Hepatitis B virus e antigen precursor is required for a tunicamycin-sensitive step that promotes efficient secretion of the antigen. J. Biol. Chem. 273, 18 594 – 18 598. Ou, J.H., Yeh, C.T., Yen, T.S.B., 1989. Transport of hepatitis B virus precore protein into the nucleus after cleavage of its signal peptide. J. Virol. 63, 5238 – 5243. Ou, J.-H., 1997. Molecular biology of hepatitis B virus e antigen. J. Gastroen. Hepatol. 12 (Suppl.), S178 – S187. Salhi, S., Messageot, F., Carlier, D., Jean-Jean, O., Rossignol, J.M., 2001. Identification of a cellular protein specifically interacting with the precursor of the hepatitis B e antigen. J. Viral. Hepat. 8, 169 – 173. Spanjaard, R.A., Chen, K., Walker, J.R., Van Duin, J., 1990. Frameshift suppression at tandem AGA and AGG codons by cloned tRNA genes: assigning a codon to argU tRNA and T4 tRNAARG. Nucl. Acid Res. 18, 5031 – 5036. Tong, S., Li, J., Vitvitski, L., Trepo, C., 1990. Active hepatitis B virus replication in the presence of anti-HBeAg is associated with viral variants containing an inactive pre-C region. Virology 176, 596 – 603. Wada, K., Wada, Y., Ishibashi, F., Gojobori, T., Ikemura, T., 1992. Codon usage tabulated from the genebank genetic sequence data. Nucl. Acid Res. 20, 2111 –2118. Wang, J., Lee, A.S., Ou, J.H., 1991. Proteolytic conversion of hepatitis B virus e antigen precursor to end product occurs in a postendoplasmic reticulum compartment. J. Virol. 65, 5080 – 5083. Wynne, S.A., Crowther, R.A., Leslie, A.G., 1999. The crystal structure of the human hepatitis B virus capsid. Mol. Cell 3, 771 – 780. Wizemann, H., Von Brunn, A., 1999. Purification of E. coliexpressed HIS-tagged hepatitis B core antigen by Ni2 + chelate affinity chromatography. J. Virol. Methods 77, 189 – 197.