- Email: [email protected]
Overexpression of long noncoding RNA H19 indicates a poor prognosis for cholangiocarcinoma and promotes cell migration and invasion by affecting epithelial-mesenchymal transition
Biomedicine & Pharmacotherapy 92 (2017) 17–23
Available online at
ScienceDirect www.sciencedirect.com
Original article
Overexpression of long noncoding RNA H19 indicates a poor prognosis for cholangiocarcinoma and promotes cell migration and invasion by affecting epithelial-mesenchymal transition Yi Xua,b,1, Zhidong Wanga,1, Xingming Jianga , Yunfu Cuia,* a b
Department of Hepatopancreatobiliary Surgery, Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang Province, 150086, China The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Harbin, Heilongjiang Province, 150086, China
A R T I C L E I N F O
Article history: Received 11 March 2017 Received in revised form 10 May 2017 Accepted 10 May 2017 Keywords: Cholangiocarcinoma Long noncoding RNA H19 Prognosis EMT
A B S T R A C T
Cholangiocarcinoma (CCA) is a deadly disease that poorly responds to chemotherapy and radiotherapy and whose incidence has increased worldwide. Furthermore, long noncoding RNAs (lncRNAs) play important roles in multiple biological processes, including tumorigenesis. Specifically, H19, the first discovered lncRNA, has been reported to be overexpressed in diverse human carcinomas, but the overall biological role and clinical significance of H19 in CCA remains unknown. In the present study, expression levels of H19 were investigated in CCA tissues and cell lines and were correlated with clinicopathological features. Moreover, we explored the functional roles of H19 depletion in QBC939 and RBE cells, including cell proliferation, apoptosis, migration, invasion and epithelial-to-mesenchymal transition (EMT). The results indicated that H19 was upregulated in CCA tissue samples and cell lines, and this upregulation was associated with tumor size, TNM stage, postoperative recurrence and overall survival in 56 patients with CCA. Moreover, knockdown of H19 followed by RNA silencing restrained cell proliferation and promoted apoptosis. In addition, H19 suppression impaired migration and invasion potential by reversing EMT. Overall, our findings may help to develop diagnostic biomarkers and therapeutics that target H19 for the treatment of CCA. © 2017 Elsevier Masson SAS. All rights reserved.
1. Introduction Cholangiocarcinoma (CCA), the most common biliary tract cancer and the second most common primary hepatobiliary malignancy, originates from the ductal epithelium of bile duct and is a fatal disease characterized by a poor prognosis due to insensitivity to conventional chemotherapy or radiotherapy [1]. Potentially radical surgery, along with liver transplantation, remains the only established therapy to cure CCA. However, patients are often no longer eligible for surgery due to distant metastases or other comorbidities, and the 5-year survival rate after surgery remains very poor [2]. Thus, studies of the mechanisms of CCA pathogenesis and effective diagnostic and prognostic biomarkers are urgently needed [3]. Long noncoding RNAs (lncRNAs), imperative non-coding RNAs, consist of at least 200 nucleotides and are characterized by a lack of
* Corresponding author. E-mail address: [email protected] (Y. Cui). Contributed equally: Yi Xu, Zhidong Wang.
1
http://dx.doi.org/10.1016/j.biopha.2017.05.061 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
protein-coding potential [4]. LncRNAs exert a large number of molecular functions, including the modulation of alternative splicing, chromatin remodeling and RNA metabolism [5–7]. Emerging evidence has strongly indicated that aberrant lncRNA expression is a feature of human carcinomas. For example, upregulation of HOTAIR, a lncRNA, promotes glioblastoma cell cycle progression via an EZH2-dependent pathway [8]. The lncRNA gene H19 is localized at 11p15.5 in humans and encodes a noncoding RNA that is 2.3 kb in size. It is a highly conserved, maternally expressed imprinted gene and plays an imperative role in mammalian development [9–11]. Moreover, the H19 gene is highly expressed during embryonic development and in human cardiac and skeletal muscle after birth [12]. Furthermore, recent studies have shown that H19 is overexpressed and closely associated with cell proliferation and metastasis in a variety of cancers, such as bladder cancer [13], colorectal cancer [14], gastric cancer [15], esophageal cancer [16] and so on. Although H19 has been shown to play key roles in multiple cancers, the underlying mechanism of H19 in CCA remains to be elucidated. Thus, in the present study, we measured the expression of H19 in CCA clinical samples and correlated this expression with
18
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
clinicopathologic parameters. Moreover, we examined cell proliferation, apoptosis, migration, invasion and epithelial-to-mesenchymal transition (EMT) after H19 depletion in CCA cell lines. 2. Materials and methods 2.1. Clinical samples CCA tissues and corresponding adjacent non-tumor tissues were obtained from 56 patients who underwent surgical procedures at the Second Affiliated Hospital of Harbin Medical University from 2010 to 2012. Each patient provided written informed consent, and the study was approved by the Ethical Review Committee of Harbin Medical University. The obtained fresh tissue samples were stored in liquid nitrogen until RNA extraction was performed. We also collected the clinicopathologic information for patients and shown in Table 1. 2.2. Cell lines and culture RBE and HCCC-9810 cells were purchased from the Type Culture of Chinese Academy of Sciences (Shanghai, China). Five CCA cell lines (QBC939, Huh-28, HuCCT1, KMBC and CCLP-1) and one normal control cell line (HIBEC) were preserved in our laboratory. All cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) (Invitrogen Life Technologies, Carlsbad, CA, USA) in a humidified 37 C incubator with 5% CO2 and passaged for less than six months. 2.3. RNA preparation and qRT-PCR Total RNA was extracted from samples or cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was then synthesized using a reverse transcriptase kit (Roche, Germany) in accordance with the manufacturer's recommendations. Real time PCR was performed with FastStart Universal SYBR Green Master (Roche, Germany) on a BIO-RAD C1000 Thermal Cycler, and GAPDH was used as an internal control. The following PCR primers were used: H19: F: 50 - ATCGGTGCCTCAGCGTTCGG –30 , R: 50 CTGTCCTCGCCGTCACACCG 30 [17]; GAPDH: F: 50 - GGGAGCCAAAAGGGTCAT 30 , R: 50 - GAGTCCTTCCACGATACCAA 30 [18]. 2.4. siRNAs and transfection
Table 1 Association between H19 expression and clinicopathological features of CCA. Clinicopathological
No. of patients (n)
features
H19 expression High (n)
Low (n)
p-value
Gender Male Female
25 31
15 16
10 15
0.5955
Age <60 60
30 26
19 12
11 14
0.2818
Tumor site Intrahepatic Perihilar Distal
11 23 22
5 14 12
6 9 10
0.6959
Tumor size <3 3
33 23
14 17
19 6
0.029*
Lymph node invasion Present Absent
32 24
21 10
11 14
0.1046
Vascular invasion Positive Negative
16 40
11 20
5 20
0.2449
TNM stage I-II III-IV
15 41
4 27
11 14
0.0145*
Differentiation grade Well/moderately Poorly/undifferentiated
19 37
10 21
9 16
0.7843
Postoperative recurrence Present 41 Absent 15
28 3
13 12
0.002**
Serum CEA level >5 ng/ml 5 ng/ml
35 21
20 11
15 10
0.7859
Serum CA19-9 level >37 U/ml 37 U/ml
35 21
22 9
13 12
0.1733
HBV infection Positive Negative
23 33
11 20
12 13
0.4175
According to the expression of H19 in CCA cell lines, we selected RBE and QBC939 cells for the knockdown study. Briefly, cells were seeded in culture dishes and grown to half confluence before being transfected with siRNAs targeting H19 or negative control siRNA (GenePharma, Shanghai, China) for 48 h using Lipofectamine 3000 (Invitrogen, USA). An inverted fluorescence microscope (Leica, Germany) was used to detect fluorescently labeled siRNAs and examine the transfection efficiency, and the knockdown efficiencies of H19 were analyzed by qRT-PCR. The following siRNA sequences were used: si-H19-1: 50 - GCAGGACAUGACAUGGUCCdTdT – 30 [14]; si-H19-2: 50 – CCAACAUCAAAGACACCAUdTdT – 30 [19]; si-H19-3: 50 – UAAGUCAUUUGCACUGGUUdTdT – 30 [20].
For the colony formation assay, approximately 500 transfected QBC939 or RBE cells were seeded in each well of a 6-well plate and cultured in RPMI-1640 containing 10% FBS for 2 weeks. Colonies were fixed with paraformaldehyde and then stained with 0.1% crystal violet (Beyotime, Beijing, China) for 15 min before being photographed to count the number of visible colonies.
2.5. CCK-8 assay
2.7. Flow cytometric analysis
CCK-8 solution (Dojindo, Tokyo, Japan) was used to evaluate cell viability. After seeding 1500 transfected cells/well into 96-well plates, the proliferation of QBC939 and RBE cells were assessed at five time points (0, 24, 48, 72, and 96 h) by incubating them with 10 ml of CCK-8 solution for 2 h at 37 C. A microplate reader (Tecan, Switzerland) was used to quantify the absorbance of each well at 450 nm.
QBC939 or RBE cells transfected with si-NC or an effective siRNA specifically targeting H19 were collected and washed twice with cold PBS. The washed cells were re-suspended in the provided binding buffer before being stained with 5 ml of Annexin V-FITC and 5 ml of propidium iodide (PI) (BD Pharmingen, San Diego, CA, USA). The fluorescence signals of cells were then measured by flow cytometry (FACScan; BD Biosciences).
TNM stage, Tumor-Node-Metastasis stage; CEA, carcino embryonie antigen; CA19– 9, carbohydrate antigen 19–9; HBV, Hepatitis B virus.
2.6. Clonogenic assay
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
2.8. Caspases analysis The expression levels of caspase-3 and caspase-9 were measured with a Caspase-3 Activity Kit and Caspase-9 Activity Kit (Solarbio, Beijing, China), respectively, to examine si-H19induced apoptosis. In Brief, after 48 h of siRNA treatment, cell proteins were isolated and incubated with prepared reaction buffer and Ac-DEVD-Pna (2 mM) in 96-well plates at 37 C for 4 h. Subsequently, a microplate reader was used to quantify the absorbance of each well at 405 nm, and the relative activities of caspase-3 and caspase-9 were compared between the si-H19 groups and the paired si-NC groups. 2.9. Wound healing assay RBE and QBC939 cells transfected with si-H19 and their corresponding control cells were separately planted in 6-well plates and cultured until reaching 70%–80% confluence. Artificial wounds were then created using a sterile 200-ml pipette tip. Images of migration distance were captured under a light microscope after 0 and 36 h. 2.10. Transwell assay The migration and invasion assay were performed using Transwell chambers with 8-mm polycarbonate nucleopore filters (Corning, NY, USA). For the migration assay, the upper chamber was filled with 5 104 cells in 200 ml serum-free medium, Whereas 600 ml medium containing 10% FBS was added to the lower compartment. Next, the transwell chambers were incubated for 24 h, and the cells on the upper filter were then eliminated. The cells that had migrated through the filter were fixed with paraformaldehyde and stained with crystal violet. To analyze the degree of invasion, the upper chamber of Transwell unit was coated with 40 ml Matrigel (BD Biosciences, San Jose, CA, USA) before cultured at 37 C for 4 h to form a reconstructed basement membrane. The methods used were identical to those of the migration assay. 2.11. Western blot analysis and antibodies Cultured and transfected cells were washed twice with cold PBS and lysed with RIPA (Beyotime, Beijing, China) containing 1% PMSF (Beyotime, Beijing, China). Proteins were quantified by BCA method, and equal amounts of total proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (GE Healthcare, Piscataway, NJ, USA). The membrane was incubated with antibodies against E-cadherin (1:10000, ab40772, Abcam, USA), N-cadherin (1:5000, ab76011, Abcam,
19
USA), Vimentin (1:2000, ab92547, Abcam, USA), PCNA (1:2000, ab92552, Abcam, USA), Bax (1:2000, ab32503, Abcam, USA), Bcl-2 (1:2000, ab182858, Abcam, USA), or GAPDH (1:10000, ab181602, Abcam, USA). After probing the blots with secondary antibody (Cell Signaling Technology, Danvers, USA) for 2 h, the signals were detected using an enhanced chemiluminescence kit (Beyotime, Beijing, China). 2.12. Statistical analysis At least three experiments were carried out independently, and statistical analyses were conducted using the GraphPad Prism 5.01 software (GraphPad, CA, USA). Data are presented as the mean standard deviation (SD), and the significance of differences was analyzed using Student’s t-test, the log-rank test and Fisher’s exact test. p < 0.05 value was considered to indicate a significant difference. 3. Results 3.1. H19 expression was upregulated in CCA tissues and cell lines Real-time PCR was carried out to quantify the expression of H19 in CCA tissues and cell lines. In a large panel of 56 paired primary CCA tissue samples, H19 was significantly increased in CCA tissues compared with that in the adjacent normal tissues (Fig. 1A). Furthermore, QBC939 and RBE cells expressed the highest levels of H19 among the seven CCA cell lines and were selected as representative CCA cell lines for the subsequent studies (Fig. 1B). 3.2. Overexpression of H19 correlates with tumor size, TNM stage, postoperative recurrence and poor prognosis in CCA To investigate the clinical relevance of abnormal H19 expression in patients with CCA, the associations between H19 and clinicopathological features were explored. qRT-PCR analysis showed that transcript level of H19 in CCA tissues was 6.502 fold change of that in non-cancerous tissues. The expression levels of H19 in all samples were then classified into low (less than the average value) or high (over the average value) expressions. By data statistics and analysis, tumor size (p = 0.029), TNM stage (p = 0.0145) and postoperative recurrence (p = 0.002) were closely associated with H19 overexpression (Table 1). Moreover, we used a Kaplan-Meier survival analysis and the log-rank test to evaluate the effect of H19 expression and overall survival (OS) of patients with CCA. The results clearly showed that the 5-years OS rates were 0% for the high H19 expression and 28% for the low H19 expression groups. Moreover, the median survival time was 29 months for the high H19 expression group and 42 months for the low H19 expression (Fig. 1C, log-rank p = 0.0007). These results suggested
Fig. 1. Relative H19 expression in CCA and its clinical significance. A. Relative expression of H19 in 56 pairs of CCA tissues and corresponding non-tumor tissues by qRT-PCR. B. The expression levels of H19 in CCA cell lines and HIBEC were determined by qRT-PCR. C. Kaplan-Meier survival curves showed that upregulation of H19 decreased overall survival in patients with CCA. *p < 0.05, **p < 0.01, ***p < 0.001.
20
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
that upregulation of H19 strongly correlates with the clinical progression of human CCA. 3.3. Manipulation of H19 levels in QBC939 and RBE cells To manipulate H19 expression in the two selected CCA cells, three siRNAs targeting H19 and a negative control (si-NC) were designed for transfection. Fluorescence microscopy was used to observe fluorescent cells and calculate transfection efficiency. The results showed that the transfection efficiency exceeded 70% in QBC939 and RBE cells when using lipofectamine 3000 and siRNA (Fig. 2A). After 48 h of incubation, qRT-PCR showed that the H19 expression levels were effectively silenced in the two selected cell lines (Fig. 2B). Among the three designed siRNAs, si-H19-1 was the most effective siRNA and used in subsequent assays. 3.4. Silencing of H19 inhibited cell proliferation The overexpression of H19 observed in both CCA tissues and cell lines prompted us to study the biological significance of H19 in tumorigenesis. To evaluate the functional role of H19 in CCA, we
carried out a CCK-8 assay to examine changes in cell growth, which showed that the depletion of H19 inhibited the proliferation of QBC939 and RBE cells (Fig. 2C). In accordance with these data, colony formation ability was distinctly impaired in si-H19-1 group compared with that in the respective controls, as shown by a clonogenic assay (Fig. 2D). Furthermore, PCNA was downregulated after silencing of H19 proved by Western blot results (Fig. 2E). 3.5. Knockdown of H19 promoted CCA cell apoptosis To evaluate the effect of H19 function on other aspects of CCA, such as apoptosis, a flow cytometry analysis was conducted. As shown in Fig. 3A, the majority of QBC939 and RBE cells transfected with si-NC were negative for Annexin-V and PI, whereas the proportions of early and late apoptotic cells were significantly increased in the corresponding si-H19-1 groups. Furthermore, the relative activities of caspase-3 and caspase-9 were increased in the si-H19-1 groups compared with those in the si-NC groups (Fig. 3B). Western blot analysis indicated that knockdown of H19 restrained the expression of Bcl-2 and increased Bax expression (Fig. 3C).
Fig. 2. Transfection and knockdown efficiency of H19-specific siRNA and H19 depletion retarded cell proliferation and colony formation in CCA cell lines. A. QBC939 and RBE cells under light and fluorescence microscope after transfection. B. Expression of H19 in QBC939 and RBE cells was significantly decreased by three si-RNAs targeting H19 compared with si-NC. C. CCK-8 assay showed that silenced H19 inhibited cell proliferation of QBC939 and RBE cells. D. Clonogenic assay showed that silenced H19 significantly decreased the colony formation ability of QBC939 and RBE cells. E. Western blot analysis showed that knockdown of H19 restrained the expression of PCNA. *p < 0.05, **p < 0.01.
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
21
Fig. 3. Silencing of H19 promoted apoptosis in CCA cell lines. A. Flow cytometry for apoptosis analysis showed that silenced H19 dramatically promoted apoptosis of QBC939 and RBE cells compared to negative control siRNA. B. The relative expression levels of caspase-3 and caspase-9 in QBC939 and RBE were activated by si-H19-1. C. Western blot analysis showed that knockdown of H19 restrained the expression of Bcl-2 and increased Bax expression. *p < 0.05, **p < 0.01.
3.6. Aberrant H19 expression inhibited CCA cell metastasis in vitro We further investigated the potential impact of H19 on the migration and invasion of CCA cells with wound healing and Transwell assays. Notably, H19 silencing reduced wound closure area compared with that of control cells (Fig. 4A). In line with our expectations, a Transwell assay demonstrated that H19 downregulation significantly decreased migration and invasion compared with that of si-NC group (Fig. 4B and C). These results indicated that H19 depletion inhibited QBC939 and RBE cell metastasis in vitro. 3.7. Inhibited H19 expression reversed EMT in CCA cells To investigate the molecular mechanisms by which H19 regulates to the phenotypes of CCA cells, we explored the potential targets of H19 involved in tumor migration and invasion. Because EMT has been identified to correlate with metastatic potential, we measured the expression of EMT markers, such as E-cadherin, Ncadherin and Vimentin, by Western blotting, which showed that silenced H19 dramatically upregulated E-cadherin expression, whereas N-cadherin and Vimentin levels were both decreased (Fig. 4D). These data implied that silencing of H19 expression reversed EMT in CCA cells and inhibited metastasis in vitro by affecting EMT. 4. Discussion The incidence of CCA has increased in recent years worldwide, and Asian countries, where the incidence of this disease is much higher, are of particular importance in this trend [21]. Moreover, CCA remains one of the most fatal diseases in human despite great efforts to reverse this situation. Therefore, identifying effective biomarkers for early diagnosis and investigating therapeutic targets the treatment of CCA is imperative. Recent studies showed that lncRNAs play key roles in multiple cancers [22–24]. In the present study, we focused on the lncRNA H19, which was the first
lncRNA discovered [25]. A multitude studies indicated that H19 may play critical roles in carcinogenesis and contribute to tumor progression and aggression [13–16]. However, H19 is reportedly downregulated in non-small cell lung cancer (NSCLC) and acts as a tumor suppressor [17]. The molecular mechanisms of action of H19 seem to be highly diverse and act at miscellaneous levels. Interestingly, H19 acts as exactly opposite roles depending on its circumstances. For example, H19 acts as a tumor-promoting role by regulating miR-675 in gastric cancer cells, indicating a correlation between H19 and miRNAs in cancer cells [26]. Besides, H19 is actively linked to E2F transcription factor 1 to promote cell proliferation of pancreatic ductal adenocarcinoma cells [27]. However, for NSCLC, silenced H19 enhanced the migration and invasion capacity of A549 cells via promoting MACC1, and subsequently activating EGFR and their downstream b-catenin and ERK1/2 signaling pathways [17]. These studies demonstrated that tissue-specific expression is ubiquitous [28] and H19 exhibit tissue-specific expression patterns. In agreement with most of current studies, the results of our study indicated that expression of H19 was higher in both CCA tissues and cell lines than adjacent tissues and HIBEC, respectively. According to Han et al.’s study, H19 indicates a poor prognosis in colorectal cancer and promotes tumor growth [14]. Additionally, a recent study indicated that overexpression of H19 contributes to poor prognosis in patients with gastric cancer [15]. In our study, high H19 expression was closely associated with tumor size, TNM stage and postoperative recurrence. These data suggested that H19 is involved in the tumorigenesis and progression of CCA. Moreover, our data clearly showed that H19 expression inversely correlated with the overall survival time of patients after surgery. Therefore, H19 may serve as a potential prognostic indicator for CCA. After confirming the clinical value of H19, it is necessary to further investigate whether H19 execute imperative functions as an oncogene or simple “transcriptional noise”. To this end, downregulating H19 with siRNA arrested cell growth partly by regulating PCNA expression in QBC939 and RBE cells. In addition, the outcomes of flow cytometry analysis illuminated the anti-
22
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
Fig. 4. Knock-down of H19 suppressed migration and invasion potential of CCA cells by affecting EMT. A. Wound healing assay showed that silenced H19 inhibited migration ability of QBC939 and RBE cells. B. Transwell migration assay showed that silenced H19 inhibited migration capacity of QBC939 and RBE cells. C. Transwell invasion assay showed that silenced H19 inhibited invasion potential of QBC939 and RBE cells. D. Knockdown of H19 reversed EMT in QBC939 and RBE cells. *p < 0.05, **p < 0.01.
apoptotic role of H19. These results suggested that H19 functions as an oncogene in CCA, whereas siRNA-H19 protects against cancer progression. Moreover, we explored the expression of apoptosisrelated factors, Bax, Bcl-2, caspase-3 and caspase-9. Interestingly, the expression of Bax, caspase-3 and caspase-9 were increased in si-H19-1 groups, whereas Bcl-2 was downregulated after knockdown of H19. Our results are consistent with previous studies on pancreatic ductal adenocarcinoma [27]. Additionally, Transwell assays were conducted to detect changes in the metastatic potential, which showed that siRNA targeting H19 significantly
reduced the migration and invasion of CCA cells. Numerous studies have established that EMT correlates with tumor invasiveness, metastasis and prognosis [29,30] and decreases in E-cadherin and Claudins and concomitant increases in N-cadherin, Vimentin and Fibronectin expression. Recent studies indicated that E/N-cadherin switches significantly affects the invasiveness of extrahepatic CCA [31]. Moreover, functional associations between lncRNAs and key effectors of EMT, such as lncRNA-ROR and BANCR, have been identified [32,33]. Therefore, we performed a Western blot assay, which showed that si-H19-1 reversed EMT in CCA cells. These
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
findings demonstrated that knockdown of H19 regulated the metastasis of CCA cells by affecting the expression of EMT-related genes. In conclusion, we demonstrated that H19 was dramatically overexpressed in CCA tissues and cell lines, and this overexpression was closely associated with CCA progression and poor prognosis. Additionally, the siRNA-mediated knockdown of H19 inhibited cell proliferation and promoted apoptosis, and H19 suppression inhibited migration and invasion capacity partly by regulating the expression of EMT-related genes. Collectively, our findings implicate a diagnostic and prognostic biomarker for CCA that may serve as a target for gene therapy. Author contributions Conceived and designed the experiments: Yunfu Cui, Zhidong Wang; Performed the experiments: Yi Xu, Zhidong Wang, Xingming Jiang; Wrote the manuscript: Yi Xu; Analyzed the data: Zhidong Wang; Revised the manuscript: Yunfu Cui. All authors read and approved the final manuscript. Conflict of interests The authors declare that they have no conflict of interests. Acknowledgments This study was funded by National Natural Science Foundation of China [Grant No.81602088 and 81170426], Health and Family Planning Commission Research Project of Heilongjiang Province [Grant No.2016-049], Heilongjiang Postdoctoral Science Foundation [Grant No.LBH-Z16096], Postgraduate innovative research project of Harbin Medical University [Grant No.YJSCX201621HYD], Innovative Science Foundation of Harbin Medical University [Grant No.2016LCZX09] and Natural Science Foundation of Heilongjiang Province [Grant No. H201396]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References [1] S.R. Alberts, G.J. Gores, G.P. Kim, et al., Treatment options for hepatobiliary and pancreatic cancer, Mayo Clin. Proc. 82 (2007) 628–637. [2] N. Razumilava, G.J. Gores, Cholangiocarcinoma, Lancet 383 (2014) 2168–2179. [3] B. Blechacz, G.J. Gores, Cholangiocarcinoma: advances in pathogenesis, diagnosis, and treatment, Hepatology 48 (2008) 308–321. [4] A. Zhang, J. Zhang, A. Kaipainen, et al., Long non-coding RNA: a newly deciphered code in prostate cancer, Cancer Lett. 375 (2016) 323–330. [5] T. Gutschner, S. Diederichs, The hallmarks of cancer: a long non-coding RNA point of view, RNA Biol. 9 (2012) 703–719. [6] R.A. Gupta, N. Shah, K.C. Wang, et al., Long noncoding RNA HOTAIR reprograms chromatin state to promote cancer metastasis, Nature 464 (2010) 1071–1076. [7] Y. Kotake, T. Nakagawa, K. Kitagawa, et al., Long noncoding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15 (INK4B) tumor suppressor gene, Oncogene 30 (2011) 1956–1962. [8] K. Zhang, X. Sun, X. Zhou, et al., Long non-coding RNA HOTAIR promotes glioblastoma cell cycle progression in an EZH2 dependent manner, Oncotarget 6 (2015) 537–546.
23
[9] L.H. Reid, C. Davies, P.R. Cooper, et al., A 1-Mb physical map and PAC contig of the imprinted domain in 11p15.5 that contains TAPA1 and the BWSCR1/WT2 region, Genomics 43 (1997) 366–375. [10] C. Steinhoff, M. Paulsen, S. Kielbasa, et al., Expression profile and transcription factor binding site exploration of imprinted genes in human and mouse, BMC Genomics 10 (2009) 144. [11] S. Engemann, M. Strodicke, M. Paulsen, et al., Sequence and functional comparison in the Beckwith-Wiedemann region: implications for a novel imprinting centre and extended imprinting, Hum. Mol. Genet. 9 (2000) 2691–2706. [12] J.L. Thorvaldsen, K.L. Duran, M.S. Bartolomei, Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2, Genes Dev. 12 (1998) 3693–3702. [13] S. Li, Z. Yu, S.S. Chen, et al., The YAP1 oncogene contributes to bladder cancer cell proliferation and migration by regulating the H19 long noncoding RNA, Urol. Oncol. 33 (427) (2015) e1–10. [14] D. Han, X. Gao, M. Wang, et al., Long noncoding RNA H19 indicates a poor prognosis of colorectal cancer and promotes tumor growth by recruiting and binding to eIF4A3, Oncotarget 7 (2016) 22159–22173. [15] E.B. Zhang, L.D.D. Han, et al., c-Myc-induced, long, noncoding H19 affects cell proliferation and predicts a poor prognosis in patients with gastric cancer, Med. Oncol. 31 (2014) 914. [16] C. Huang, L. Cao, L. Qiu, et al., Upregulation of H19 promotes invasion and induces epithelial-to-mesenchymal transition in esophageal cancer, Oncol. Lett. 10 (2015) 291–296. [17] L. Wang, Y. Sun, J. Yi, et al., Targeting H19 by lentivirus- mediated RNA interference increases A549 cell migration and invasion, Exp. Lung Res. 42 (2016) 346–353. [18] M.D. Huang, W.M. Chen, F.Z. Qi, et al., Long non-coding RNA TUG1 is upregulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2, Mol. Cancer 14 (2015) 165. [19] W.L. Gao, M. Liu, Y. Yang, et al., The imprinted H19 gene regulates human placental trophoblast cell proliferation via encoding miR-675 that targets Nodal Modulator 1 (NOMO1), RNA Biol. 9 (2012) 1002–1010. [20] S.H. Wang, F. Ma, Z.H. Tang, et al., Long non-coding RNA H19 regulates FOXM1 expression by competitively binding endogenous miR-342-3p in gallbladder cancer, J. Exp. Clin. Cancer Res. 35 (2016) 160. [21] S.A. Khan, B.R. Davidson, R.D. Goldin, et al., Taylor-Robinson SD and Thillainayagam AV. Guidelines for the diagnosis and treatment of cholangiocarcinoma: an update, Gut 61 (2012) 1657–1669. [22] Z.G. Li, D.J. Wei, C. Yang, et al., Overexpression of long noncoding RNA, NEAT1 promotes cell proliferation, invasion and migration in endometrial endometrioid adenocarcinoma, Biomed. Pharmacother. 84 (2016) 244–251. [23] F. Ma, S.H. Wang, Q. Cai, et al., Overexpression of LncRNA AFAP1-AS1 predicts poor prognosis and promotes cells proliferation and invasion in gallbladder cancer, Biomed. Pharmacother. 84 (2016) 1249–1255. [24] C.X. Huang, Z.L. Yu, H. Yang, et al., Increased MALAT1 expression predicts poor prognosis in esophageal cancer patients, Biomed. Pharmacother. 83 (2016) 8–13. [25] C.I. Brannan, E.C. Dees, R.S. Ingram, et al., The product of the H19 gene may function as an RNA, Mol. Cell Biol. 10 (1990) 28–36. [26] G. Liu, T. Xiang, Q.F. Wu, et al., Long noncoding RNA H19-derived miR-675 enhances proliferation and invasion via RUNX1 in gastric cancer cells, Oncol. Res. 23 (2016) 99–107. [27] L. Ma, X. Tian, F. Wang, et al., The long noncoding RNA H19 promotes cell proliferation via E2F-1 in pancreatic ductal adenocarcinoma, Cancer Biol. Ther. 17 (2016) 1051–1061. [28] M.N. Cabili, C. Trapnell, L. Goff, et al., Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses, Genes Dev. 25 (2011) 1915–1927. [29] S. Guo, X. Xu, Y. Tang, et al., miR-15a inhibits cell proliferation and epithelial to mesenchymal transition in pancreatic ductal adenocarcinoma by downregulating Bmi-1 expression, Cancer Lett. 344 (2014) 40–46. [30] S. Yamada, B.C. Fuchs, T. Fujii, et al., Epithelial-to-mesenchymal transition predicts prognosis of pancreatic cancer, Surgery 154 (2013) 946–954. [31] K. Araki, T. Shimura, H. Suzuki, et al., E/N- cadherin switch mediates cancer progression via TGF-beta-induced epithelial-to-mesenchymal transition in extrahepatic cholangiocarcinoma, Br. J. Cancer 105 (2011) 1885–1893. [32] P. Hou, Y. Zhao, Z. Li, et al., LincRNA-ROR induces epithelial-to-mesenchymal transition and contributes to breast cancer tumorigenesis and metastasis, Cell. Death. Dis. 5 (2014) e1287. [33] M. Sun, X.H. Liu, K.M. Wang, et al., Downregulation of BRAF activated noncoding RNA is associated with poor prognosis for non-small cell lung cancer and promotes metastasis by affecting epithelial-mesenchymal transition, Mol. Cancer 13 (2014) 68.
Available online at
ScienceDirect www.sciencedirect.com
Original article
Overexpression of long noncoding RNA H19 indicates a poor prognosis for cholangiocarcinoma and promotes cell migration and invasion by affecting epithelial-mesenchymal transition Yi Xua,b,1, Zhidong Wanga,1, Xingming Jianga , Yunfu Cuia,* a b
Department of Hepatopancreatobiliary Surgery, Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang Province, 150086, China The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Harbin, Heilongjiang Province, 150086, China
A R T I C L E I N F O
Article history: Received 11 March 2017 Received in revised form 10 May 2017 Accepted 10 May 2017 Keywords: Cholangiocarcinoma Long noncoding RNA H19 Prognosis EMT
A B S T R A C T
Cholangiocarcinoma (CCA) is a deadly disease that poorly responds to chemotherapy and radiotherapy and whose incidence has increased worldwide. Furthermore, long noncoding RNAs (lncRNAs) play important roles in multiple biological processes, including tumorigenesis. Specifically, H19, the first discovered lncRNA, has been reported to be overexpressed in diverse human carcinomas, but the overall biological role and clinical significance of H19 in CCA remains unknown. In the present study, expression levels of H19 were investigated in CCA tissues and cell lines and were correlated with clinicopathological features. Moreover, we explored the functional roles of H19 depletion in QBC939 and RBE cells, including cell proliferation, apoptosis, migration, invasion and epithelial-to-mesenchymal transition (EMT). The results indicated that H19 was upregulated in CCA tissue samples and cell lines, and this upregulation was associated with tumor size, TNM stage, postoperative recurrence and overall survival in 56 patients with CCA. Moreover, knockdown of H19 followed by RNA silencing restrained cell proliferation and promoted apoptosis. In addition, H19 suppression impaired migration and invasion potential by reversing EMT. Overall, our findings may help to develop diagnostic biomarkers and therapeutics that target H19 for the treatment of CCA. © 2017 Elsevier Masson SAS. All rights reserved.
1. Introduction Cholangiocarcinoma (CCA), the most common biliary tract cancer and the second most common primary hepatobiliary malignancy, originates from the ductal epithelium of bile duct and is a fatal disease characterized by a poor prognosis due to insensitivity to conventional chemotherapy or radiotherapy [1]. Potentially radical surgery, along with liver transplantation, remains the only established therapy to cure CCA. However, patients are often no longer eligible for surgery due to distant metastases or other comorbidities, and the 5-year survival rate after surgery remains very poor [2]. Thus, studies of the mechanisms of CCA pathogenesis and effective diagnostic and prognostic biomarkers are urgently needed [3]. Long noncoding RNAs (lncRNAs), imperative non-coding RNAs, consist of at least 200 nucleotides and are characterized by a lack of
* Corresponding author. E-mail address: [email protected] (Y. Cui). Contributed equally: Yi Xu, Zhidong Wang.
1
http://dx.doi.org/10.1016/j.biopha.2017.05.061 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
protein-coding potential [4]. LncRNAs exert a large number of molecular functions, including the modulation of alternative splicing, chromatin remodeling and RNA metabolism [5–7]. Emerging evidence has strongly indicated that aberrant lncRNA expression is a feature of human carcinomas. For example, upregulation of HOTAIR, a lncRNA, promotes glioblastoma cell cycle progression via an EZH2-dependent pathway [8]. The lncRNA gene H19 is localized at 11p15.5 in humans and encodes a noncoding RNA that is 2.3 kb in size. It is a highly conserved, maternally expressed imprinted gene and plays an imperative role in mammalian development [9–11]. Moreover, the H19 gene is highly expressed during embryonic development and in human cardiac and skeletal muscle after birth [12]. Furthermore, recent studies have shown that H19 is overexpressed and closely associated with cell proliferation and metastasis in a variety of cancers, such as bladder cancer [13], colorectal cancer [14], gastric cancer [15], esophageal cancer [16] and so on. Although H19 has been shown to play key roles in multiple cancers, the underlying mechanism of H19 in CCA remains to be elucidated. Thus, in the present study, we measured the expression of H19 in CCA clinical samples and correlated this expression with
18
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
clinicopathologic parameters. Moreover, we examined cell proliferation, apoptosis, migration, invasion and epithelial-to-mesenchymal transition (EMT) after H19 depletion in CCA cell lines. 2. Materials and methods 2.1. Clinical samples CCA tissues and corresponding adjacent non-tumor tissues were obtained from 56 patients who underwent surgical procedures at the Second Affiliated Hospital of Harbin Medical University from 2010 to 2012. Each patient provided written informed consent, and the study was approved by the Ethical Review Committee of Harbin Medical University. The obtained fresh tissue samples were stored in liquid nitrogen until RNA extraction was performed. We also collected the clinicopathologic information for patients and shown in Table 1. 2.2. Cell lines and culture RBE and HCCC-9810 cells were purchased from the Type Culture of Chinese Academy of Sciences (Shanghai, China). Five CCA cell lines (QBC939, Huh-28, HuCCT1, KMBC and CCLP-1) and one normal control cell line (HIBEC) were preserved in our laboratory. All cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) (Invitrogen Life Technologies, Carlsbad, CA, USA) in a humidified 37 C incubator with 5% CO2 and passaged for less than six months. 2.3. RNA preparation and qRT-PCR Total RNA was extracted from samples or cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was then synthesized using a reverse transcriptase kit (Roche, Germany) in accordance with the manufacturer's recommendations. Real time PCR was performed with FastStart Universal SYBR Green Master (Roche, Germany) on a BIO-RAD C1000 Thermal Cycler, and GAPDH was used as an internal control. The following PCR primers were used: H19: F: 50 - ATCGGTGCCTCAGCGTTCGG –30 , R: 50 CTGTCCTCGCCGTCACACCG 30 [17]; GAPDH: F: 50 - GGGAGCCAAAAGGGTCAT 30 , R: 50 - GAGTCCTTCCACGATACCAA 30 [18]. 2.4. siRNAs and transfection
Table 1 Association between H19 expression and clinicopathological features of CCA. Clinicopathological
No. of patients (n)
features
H19 expression High (n)
Low (n)
p-value
Gender Male Female
25 31
15 16
10 15
0.5955
Age <60 60
30 26
19 12
11 14
0.2818
Tumor site Intrahepatic Perihilar Distal
11 23 22
5 14 12
6 9 10
0.6959
Tumor size <3 3
33 23
14 17
19 6
0.029*
Lymph node invasion Present Absent
32 24
21 10
11 14
0.1046
Vascular invasion Positive Negative
16 40
11 20
5 20
0.2449
TNM stage I-II III-IV
15 41
4 27
11 14
0.0145*
Differentiation grade Well/moderately Poorly/undifferentiated
19 37
10 21
9 16
0.7843
Postoperative recurrence Present 41 Absent 15
28 3
13 12
0.002**
Serum CEA level >5 ng/ml 5 ng/ml
35 21
20 11
15 10
0.7859
Serum CA19-9 level >37 U/ml 37 U/ml
35 21
22 9
13 12
0.1733
HBV infection Positive Negative
23 33
11 20
12 13
0.4175
According to the expression of H19 in CCA cell lines, we selected RBE and QBC939 cells for the knockdown study. Briefly, cells were seeded in culture dishes and grown to half confluence before being transfected with siRNAs targeting H19 or negative control siRNA (GenePharma, Shanghai, China) for 48 h using Lipofectamine 3000 (Invitrogen, USA). An inverted fluorescence microscope (Leica, Germany) was used to detect fluorescently labeled siRNAs and examine the transfection efficiency, and the knockdown efficiencies of H19 were analyzed by qRT-PCR. The following siRNA sequences were used: si-H19-1: 50 - GCAGGACAUGACAUGGUCCdTdT – 30 [14]; si-H19-2: 50 – CCAACAUCAAAGACACCAUdTdT – 30 [19]; si-H19-3: 50 – UAAGUCAUUUGCACUGGUUdTdT – 30 [20].
For the colony formation assay, approximately 500 transfected QBC939 or RBE cells were seeded in each well of a 6-well plate and cultured in RPMI-1640 containing 10% FBS for 2 weeks. Colonies were fixed with paraformaldehyde and then stained with 0.1% crystal violet (Beyotime, Beijing, China) for 15 min before being photographed to count the number of visible colonies.
2.5. CCK-8 assay
2.7. Flow cytometric analysis
CCK-8 solution (Dojindo, Tokyo, Japan) was used to evaluate cell viability. After seeding 1500 transfected cells/well into 96-well plates, the proliferation of QBC939 and RBE cells were assessed at five time points (0, 24, 48, 72, and 96 h) by incubating them with 10 ml of CCK-8 solution for 2 h at 37 C. A microplate reader (Tecan, Switzerland) was used to quantify the absorbance of each well at 450 nm.
QBC939 or RBE cells transfected with si-NC or an effective siRNA specifically targeting H19 were collected and washed twice with cold PBS. The washed cells were re-suspended in the provided binding buffer before being stained with 5 ml of Annexin V-FITC and 5 ml of propidium iodide (PI) (BD Pharmingen, San Diego, CA, USA). The fluorescence signals of cells were then measured by flow cytometry (FACScan; BD Biosciences).
TNM stage, Tumor-Node-Metastasis stage; CEA, carcino embryonie antigen; CA19– 9, carbohydrate antigen 19–9; HBV, Hepatitis B virus.
2.6. Clonogenic assay
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
2.8. Caspases analysis The expression levels of caspase-3 and caspase-9 were measured with a Caspase-3 Activity Kit and Caspase-9 Activity Kit (Solarbio, Beijing, China), respectively, to examine si-H19induced apoptosis. In Brief, after 48 h of siRNA treatment, cell proteins were isolated and incubated with prepared reaction buffer and Ac-DEVD-Pna (2 mM) in 96-well plates at 37 C for 4 h. Subsequently, a microplate reader was used to quantify the absorbance of each well at 405 nm, and the relative activities of caspase-3 and caspase-9 were compared between the si-H19 groups and the paired si-NC groups. 2.9. Wound healing assay RBE and QBC939 cells transfected with si-H19 and their corresponding control cells were separately planted in 6-well plates and cultured until reaching 70%–80% confluence. Artificial wounds were then created using a sterile 200-ml pipette tip. Images of migration distance were captured under a light microscope after 0 and 36 h. 2.10. Transwell assay The migration and invasion assay were performed using Transwell chambers with 8-mm polycarbonate nucleopore filters (Corning, NY, USA). For the migration assay, the upper chamber was filled with 5 104 cells in 200 ml serum-free medium, Whereas 600 ml medium containing 10% FBS was added to the lower compartment. Next, the transwell chambers were incubated for 24 h, and the cells on the upper filter were then eliminated. The cells that had migrated through the filter were fixed with paraformaldehyde and stained with crystal violet. To analyze the degree of invasion, the upper chamber of Transwell unit was coated with 40 ml Matrigel (BD Biosciences, San Jose, CA, USA) before cultured at 37 C for 4 h to form a reconstructed basement membrane. The methods used were identical to those of the migration assay. 2.11. Western blot analysis and antibodies Cultured and transfected cells were washed twice with cold PBS and lysed with RIPA (Beyotime, Beijing, China) containing 1% PMSF (Beyotime, Beijing, China). Proteins were quantified by BCA method, and equal amounts of total proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (GE Healthcare, Piscataway, NJ, USA). The membrane was incubated with antibodies against E-cadherin (1:10000, ab40772, Abcam, USA), N-cadherin (1:5000, ab76011, Abcam,
19
USA), Vimentin (1:2000, ab92547, Abcam, USA), PCNA (1:2000, ab92552, Abcam, USA), Bax (1:2000, ab32503, Abcam, USA), Bcl-2 (1:2000, ab182858, Abcam, USA), or GAPDH (1:10000, ab181602, Abcam, USA). After probing the blots with secondary antibody (Cell Signaling Technology, Danvers, USA) for 2 h, the signals were detected using an enhanced chemiluminescence kit (Beyotime, Beijing, China). 2.12. Statistical analysis At least three experiments were carried out independently, and statistical analyses were conducted using the GraphPad Prism 5.01 software (GraphPad, CA, USA). Data are presented as the mean standard deviation (SD), and the significance of differences was analyzed using Student’s t-test, the log-rank test and Fisher’s exact test. p < 0.05 value was considered to indicate a significant difference. 3. Results 3.1. H19 expression was upregulated in CCA tissues and cell lines Real-time PCR was carried out to quantify the expression of H19 in CCA tissues and cell lines. In a large panel of 56 paired primary CCA tissue samples, H19 was significantly increased in CCA tissues compared with that in the adjacent normal tissues (Fig. 1A). Furthermore, QBC939 and RBE cells expressed the highest levels of H19 among the seven CCA cell lines and were selected as representative CCA cell lines for the subsequent studies (Fig. 1B). 3.2. Overexpression of H19 correlates with tumor size, TNM stage, postoperative recurrence and poor prognosis in CCA To investigate the clinical relevance of abnormal H19 expression in patients with CCA, the associations between H19 and clinicopathological features were explored. qRT-PCR analysis showed that transcript level of H19 in CCA tissues was 6.502 fold change of that in non-cancerous tissues. The expression levels of H19 in all samples were then classified into low (less than the average value) or high (over the average value) expressions. By data statistics and analysis, tumor size (p = 0.029), TNM stage (p = 0.0145) and postoperative recurrence (p = 0.002) were closely associated with H19 overexpression (Table 1). Moreover, we used a Kaplan-Meier survival analysis and the log-rank test to evaluate the effect of H19 expression and overall survival (OS) of patients with CCA. The results clearly showed that the 5-years OS rates were 0% for the high H19 expression and 28% for the low H19 expression groups. Moreover, the median survival time was 29 months for the high H19 expression group and 42 months for the low H19 expression (Fig. 1C, log-rank p = 0.0007). These results suggested
Fig. 1. Relative H19 expression in CCA and its clinical significance. A. Relative expression of H19 in 56 pairs of CCA tissues and corresponding non-tumor tissues by qRT-PCR. B. The expression levels of H19 in CCA cell lines and HIBEC were determined by qRT-PCR. C. Kaplan-Meier survival curves showed that upregulation of H19 decreased overall survival in patients with CCA. *p < 0.05, **p < 0.01, ***p < 0.001.
20
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
that upregulation of H19 strongly correlates with the clinical progression of human CCA. 3.3. Manipulation of H19 levels in QBC939 and RBE cells To manipulate H19 expression in the two selected CCA cells, three siRNAs targeting H19 and a negative control (si-NC) were designed for transfection. Fluorescence microscopy was used to observe fluorescent cells and calculate transfection efficiency. The results showed that the transfection efficiency exceeded 70% in QBC939 and RBE cells when using lipofectamine 3000 and siRNA (Fig. 2A). After 48 h of incubation, qRT-PCR showed that the H19 expression levels were effectively silenced in the two selected cell lines (Fig. 2B). Among the three designed siRNAs, si-H19-1 was the most effective siRNA and used in subsequent assays. 3.4. Silencing of H19 inhibited cell proliferation The overexpression of H19 observed in both CCA tissues and cell lines prompted us to study the biological significance of H19 in tumorigenesis. To evaluate the functional role of H19 in CCA, we
carried out a CCK-8 assay to examine changes in cell growth, which showed that the depletion of H19 inhibited the proliferation of QBC939 and RBE cells (Fig. 2C). In accordance with these data, colony formation ability was distinctly impaired in si-H19-1 group compared with that in the respective controls, as shown by a clonogenic assay (Fig. 2D). Furthermore, PCNA was downregulated after silencing of H19 proved by Western blot results (Fig. 2E). 3.5. Knockdown of H19 promoted CCA cell apoptosis To evaluate the effect of H19 function on other aspects of CCA, such as apoptosis, a flow cytometry analysis was conducted. As shown in Fig. 3A, the majority of QBC939 and RBE cells transfected with si-NC were negative for Annexin-V and PI, whereas the proportions of early and late apoptotic cells were significantly increased in the corresponding si-H19-1 groups. Furthermore, the relative activities of caspase-3 and caspase-9 were increased in the si-H19-1 groups compared with those in the si-NC groups (Fig. 3B). Western blot analysis indicated that knockdown of H19 restrained the expression of Bcl-2 and increased Bax expression (Fig. 3C).
Fig. 2. Transfection and knockdown efficiency of H19-specific siRNA and H19 depletion retarded cell proliferation and colony formation in CCA cell lines. A. QBC939 and RBE cells under light and fluorescence microscope after transfection. B. Expression of H19 in QBC939 and RBE cells was significantly decreased by three si-RNAs targeting H19 compared with si-NC. C. CCK-8 assay showed that silenced H19 inhibited cell proliferation of QBC939 and RBE cells. D. Clonogenic assay showed that silenced H19 significantly decreased the colony formation ability of QBC939 and RBE cells. E. Western blot analysis showed that knockdown of H19 restrained the expression of PCNA. *p < 0.05, **p < 0.01.
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
21
Fig. 3. Silencing of H19 promoted apoptosis in CCA cell lines. A. Flow cytometry for apoptosis analysis showed that silenced H19 dramatically promoted apoptosis of QBC939 and RBE cells compared to negative control siRNA. B. The relative expression levels of caspase-3 and caspase-9 in QBC939 and RBE were activated by si-H19-1. C. Western blot analysis showed that knockdown of H19 restrained the expression of Bcl-2 and increased Bax expression. *p < 0.05, **p < 0.01.
3.6. Aberrant H19 expression inhibited CCA cell metastasis in vitro We further investigated the potential impact of H19 on the migration and invasion of CCA cells with wound healing and Transwell assays. Notably, H19 silencing reduced wound closure area compared with that of control cells (Fig. 4A). In line with our expectations, a Transwell assay demonstrated that H19 downregulation significantly decreased migration and invasion compared with that of si-NC group (Fig. 4B and C). These results indicated that H19 depletion inhibited QBC939 and RBE cell metastasis in vitro. 3.7. Inhibited H19 expression reversed EMT in CCA cells To investigate the molecular mechanisms by which H19 regulates to the phenotypes of CCA cells, we explored the potential targets of H19 involved in tumor migration and invasion. Because EMT has been identified to correlate with metastatic potential, we measured the expression of EMT markers, such as E-cadherin, Ncadherin and Vimentin, by Western blotting, which showed that silenced H19 dramatically upregulated E-cadherin expression, whereas N-cadherin and Vimentin levels were both decreased (Fig. 4D). These data implied that silencing of H19 expression reversed EMT in CCA cells and inhibited metastasis in vitro by affecting EMT. 4. Discussion The incidence of CCA has increased in recent years worldwide, and Asian countries, where the incidence of this disease is much higher, are of particular importance in this trend [21]. Moreover, CCA remains one of the most fatal diseases in human despite great efforts to reverse this situation. Therefore, identifying effective biomarkers for early diagnosis and investigating therapeutic targets the treatment of CCA is imperative. Recent studies showed that lncRNAs play key roles in multiple cancers [22–24]. In the present study, we focused on the lncRNA H19, which was the first
lncRNA discovered [25]. A multitude studies indicated that H19 may play critical roles in carcinogenesis and contribute to tumor progression and aggression [13–16]. However, H19 is reportedly downregulated in non-small cell lung cancer (NSCLC) and acts as a tumor suppressor [17]. The molecular mechanisms of action of H19 seem to be highly diverse and act at miscellaneous levels. Interestingly, H19 acts as exactly opposite roles depending on its circumstances. For example, H19 acts as a tumor-promoting role by regulating miR-675 in gastric cancer cells, indicating a correlation between H19 and miRNAs in cancer cells [26]. Besides, H19 is actively linked to E2F transcription factor 1 to promote cell proliferation of pancreatic ductal adenocarcinoma cells [27]. However, for NSCLC, silenced H19 enhanced the migration and invasion capacity of A549 cells via promoting MACC1, and subsequently activating EGFR and their downstream b-catenin and ERK1/2 signaling pathways [17]. These studies demonstrated that tissue-specific expression is ubiquitous [28] and H19 exhibit tissue-specific expression patterns. In agreement with most of current studies, the results of our study indicated that expression of H19 was higher in both CCA tissues and cell lines than adjacent tissues and HIBEC, respectively. According to Han et al.’s study, H19 indicates a poor prognosis in colorectal cancer and promotes tumor growth [14]. Additionally, a recent study indicated that overexpression of H19 contributes to poor prognosis in patients with gastric cancer [15]. In our study, high H19 expression was closely associated with tumor size, TNM stage and postoperative recurrence. These data suggested that H19 is involved in the tumorigenesis and progression of CCA. Moreover, our data clearly showed that H19 expression inversely correlated with the overall survival time of patients after surgery. Therefore, H19 may serve as a potential prognostic indicator for CCA. After confirming the clinical value of H19, it is necessary to further investigate whether H19 execute imperative functions as an oncogene or simple “transcriptional noise”. To this end, downregulating H19 with siRNA arrested cell growth partly by regulating PCNA expression in QBC939 and RBE cells. In addition, the outcomes of flow cytometry analysis illuminated the anti-
22
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
Fig. 4. Knock-down of H19 suppressed migration and invasion potential of CCA cells by affecting EMT. A. Wound healing assay showed that silenced H19 inhibited migration ability of QBC939 and RBE cells. B. Transwell migration assay showed that silenced H19 inhibited migration capacity of QBC939 and RBE cells. C. Transwell invasion assay showed that silenced H19 inhibited invasion potential of QBC939 and RBE cells. D. Knockdown of H19 reversed EMT in QBC939 and RBE cells. *p < 0.05, **p < 0.01.
apoptotic role of H19. These results suggested that H19 functions as an oncogene in CCA, whereas siRNA-H19 protects against cancer progression. Moreover, we explored the expression of apoptosisrelated factors, Bax, Bcl-2, caspase-3 and caspase-9. Interestingly, the expression of Bax, caspase-3 and caspase-9 were increased in si-H19-1 groups, whereas Bcl-2 was downregulated after knockdown of H19. Our results are consistent with previous studies on pancreatic ductal adenocarcinoma [27]. Additionally, Transwell assays were conducted to detect changes in the metastatic potential, which showed that siRNA targeting H19 significantly
reduced the migration and invasion of CCA cells. Numerous studies have established that EMT correlates with tumor invasiveness, metastasis and prognosis [29,30] and decreases in E-cadherin and Claudins and concomitant increases in N-cadherin, Vimentin and Fibronectin expression. Recent studies indicated that E/N-cadherin switches significantly affects the invasiveness of extrahepatic CCA [31]. Moreover, functional associations between lncRNAs and key effectors of EMT, such as lncRNA-ROR and BANCR, have been identified [32,33]. Therefore, we performed a Western blot assay, which showed that si-H19-1 reversed EMT in CCA cells. These
Y. Xu et al. / Biomedicine & Pharmacotherapy 92 (2017) 17–23
findings demonstrated that knockdown of H19 regulated the metastasis of CCA cells by affecting the expression of EMT-related genes. In conclusion, we demonstrated that H19 was dramatically overexpressed in CCA tissues and cell lines, and this overexpression was closely associated with CCA progression and poor prognosis. Additionally, the siRNA-mediated knockdown of H19 inhibited cell proliferation and promoted apoptosis, and H19 suppression inhibited migration and invasion capacity partly by regulating the expression of EMT-related genes. Collectively, our findings implicate a diagnostic and prognostic biomarker for CCA that may serve as a target for gene therapy. Author contributions Conceived and designed the experiments: Yunfu Cui, Zhidong Wang; Performed the experiments: Yi Xu, Zhidong Wang, Xingming Jiang; Wrote the manuscript: Yi Xu; Analyzed the data: Zhidong Wang; Revised the manuscript: Yunfu Cui. All authors read and approved the final manuscript. Conflict of interests The authors declare that they have no conflict of interests. Acknowledgments This study was funded by National Natural Science Foundation of China [Grant No.81602088 and 81170426], Health and Family Planning Commission Research Project of Heilongjiang Province [Grant No.2016-049], Heilongjiang Postdoctoral Science Foundation [Grant No.LBH-Z16096], Postgraduate innovative research project of Harbin Medical University [Grant No.YJSCX201621HYD], Innovative Science Foundation of Harbin Medical University [Grant No.2016LCZX09] and Natural Science Foundation of Heilongjiang Province [Grant No. H201396]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References [1] S.R. Alberts, G.J. Gores, G.P. Kim, et al., Treatment options for hepatobiliary and pancreatic cancer, Mayo Clin. Proc. 82 (2007) 628–637. [2] N. Razumilava, G.J. Gores, Cholangiocarcinoma, Lancet 383 (2014) 2168–2179. [3] B. Blechacz, G.J. Gores, Cholangiocarcinoma: advances in pathogenesis, diagnosis, and treatment, Hepatology 48 (2008) 308–321. [4] A. Zhang, J. Zhang, A. Kaipainen, et al., Long non-coding RNA: a newly deciphered code in prostate cancer, Cancer Lett. 375 (2016) 323–330. [5] T. Gutschner, S. Diederichs, The hallmarks of cancer: a long non-coding RNA point of view, RNA Biol. 9 (2012) 703–719. [6] R.A. Gupta, N. Shah, K.C. Wang, et al., Long noncoding RNA HOTAIR reprograms chromatin state to promote cancer metastasis, Nature 464 (2010) 1071–1076. [7] Y. Kotake, T. Nakagawa, K. Kitagawa, et al., Long noncoding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15 (INK4B) tumor suppressor gene, Oncogene 30 (2011) 1956–1962. [8] K. Zhang, X. Sun, X. Zhou, et al., Long non-coding RNA HOTAIR promotes glioblastoma cell cycle progression in an EZH2 dependent manner, Oncotarget 6 (2015) 537–546.
23
[9] L.H. Reid, C. Davies, P.R. Cooper, et al., A 1-Mb physical map and PAC contig of the imprinted domain in 11p15.5 that contains TAPA1 and the BWSCR1/WT2 region, Genomics 43 (1997) 366–375. [10] C. Steinhoff, M. Paulsen, S. Kielbasa, et al., Expression profile and transcription factor binding site exploration of imprinted genes in human and mouse, BMC Genomics 10 (2009) 144. [11] S. Engemann, M. Strodicke, M. Paulsen, et al., Sequence and functional comparison in the Beckwith-Wiedemann region: implications for a novel imprinting centre and extended imprinting, Hum. Mol. Genet. 9 (2000) 2691–2706. [12] J.L. Thorvaldsen, K.L. Duran, M.S. Bartolomei, Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2, Genes Dev. 12 (1998) 3693–3702. [13] S. Li, Z. Yu, S.S. Chen, et al., The YAP1 oncogene contributes to bladder cancer cell proliferation and migration by regulating the H19 long noncoding RNA, Urol. Oncol. 33 (427) (2015) e1–10. [14] D. Han, X. Gao, M. Wang, et al., Long noncoding RNA H19 indicates a poor prognosis of colorectal cancer and promotes tumor growth by recruiting and binding to eIF4A3, Oncotarget 7 (2016) 22159–22173. [15] E.B. Zhang, L.D.D. Han, et al., c-Myc-induced, long, noncoding H19 affects cell proliferation and predicts a poor prognosis in patients with gastric cancer, Med. Oncol. 31 (2014) 914. [16] C. Huang, L. Cao, L. Qiu, et al., Upregulation of H19 promotes invasion and induces epithelial-to-mesenchymal transition in esophageal cancer, Oncol. Lett. 10 (2015) 291–296. [17] L. Wang, Y. Sun, J. Yi, et al., Targeting H19 by lentivirus- mediated RNA interference increases A549 cell migration and invasion, Exp. Lung Res. 42 (2016) 346–353. [18] M.D. Huang, W.M. Chen, F.Z. Qi, et al., Long non-coding RNA TUG1 is upregulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2, Mol. Cancer 14 (2015) 165. [19] W.L. Gao, M. Liu, Y. Yang, et al., The imprinted H19 gene regulates human placental trophoblast cell proliferation via encoding miR-675 that targets Nodal Modulator 1 (NOMO1), RNA Biol. 9 (2012) 1002–1010. [20] S.H. Wang, F. Ma, Z.H. Tang, et al., Long non-coding RNA H19 regulates FOXM1 expression by competitively binding endogenous miR-342-3p in gallbladder cancer, J. Exp. Clin. Cancer Res. 35 (2016) 160. [21] S.A. Khan, B.R. Davidson, R.D. Goldin, et al., Taylor-Robinson SD and Thillainayagam AV. Guidelines for the diagnosis and treatment of cholangiocarcinoma: an update, Gut 61 (2012) 1657–1669. [22] Z.G. Li, D.J. Wei, C. Yang, et al., Overexpression of long noncoding RNA, NEAT1 promotes cell proliferation, invasion and migration in endometrial endometrioid adenocarcinoma, Biomed. Pharmacother. 84 (2016) 244–251. [23] F. Ma, S.H. Wang, Q. Cai, et al., Overexpression of LncRNA AFAP1-AS1 predicts poor prognosis and promotes cells proliferation and invasion in gallbladder cancer, Biomed. Pharmacother. 84 (2016) 1249–1255. [24] C.X. Huang, Z.L. Yu, H. Yang, et al., Increased MALAT1 expression predicts poor prognosis in esophageal cancer patients, Biomed. Pharmacother. 83 (2016) 8–13. [25] C.I. Brannan, E.C. Dees, R.S. Ingram, et al., The product of the H19 gene may function as an RNA, Mol. Cell Biol. 10 (1990) 28–36. [26] G. Liu, T. Xiang, Q.F. Wu, et al., Long noncoding RNA H19-derived miR-675 enhances proliferation and invasion via RUNX1 in gastric cancer cells, Oncol. Res. 23 (2016) 99–107. [27] L. Ma, X. Tian, F. Wang, et al., The long noncoding RNA H19 promotes cell proliferation via E2F-1 in pancreatic ductal adenocarcinoma, Cancer Biol. Ther. 17 (2016) 1051–1061. [28] M.N. Cabili, C. Trapnell, L. Goff, et al., Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses, Genes Dev. 25 (2011) 1915–1927. [29] S. Guo, X. Xu, Y. Tang, et al., miR-15a inhibits cell proliferation and epithelial to mesenchymal transition in pancreatic ductal adenocarcinoma by downregulating Bmi-1 expression, Cancer Lett. 344 (2014) 40–46. [30] S. Yamada, B.C. Fuchs, T. Fujii, et al., Epithelial-to-mesenchymal transition predicts prognosis of pancreatic cancer, Surgery 154 (2013) 946–954. [31] K. Araki, T. Shimura, H. Suzuki, et al., E/N- cadherin switch mediates cancer progression via TGF-beta-induced epithelial-to-mesenchymal transition in extrahepatic cholangiocarcinoma, Br. J. Cancer 105 (2011) 1885–1893. [32] P. Hou, Y. Zhao, Z. Li, et al., LincRNA-ROR induces epithelial-to-mesenchymal transition and contributes to breast cancer tumorigenesis and metastasis, Cell. Death. Dis. 5 (2014) e1287. [33] M. Sun, X.H. Liu, K.M. Wang, et al., Downregulation of BRAF activated noncoding RNA is associated with poor prognosis for non-small cell lung cancer and promotes metastasis by affecting epithelial-mesenchymal transition, Mol. Cancer 13 (2014) 68.