- Email: [email protected]
Ovis aries Papillomavirus 3: A prototype of a novel genus in the family Papillomaviridae associated with ovine squamous cell carcinoma
Virology 407 (2010) 352–359
Contents lists available at ScienceDirect
Virology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y v i r o
Ovis aries Papillomavirus 3: A prototype of a novel genus in the family Papillomaviridae associated with ovine squamous cell carcinoma Alberto Alberti a,⁎, Salvatore Pirino a, Francesca Pintore a, Maria Filippa Addis a,b, Bernardo Chessa a, Carla Cacciotto a, Tiziana Cubeddu a, Antonio Anfossi a, Gavino Benenati a, Elisabetta Coradduzza a, Roberta Lecis a, Elisabetta Antuofermo a, Laura Carcangiu a, Marco Pittau a a b
Dipartimento di Patologia e Clinica Veterinaria, Università degli Studi di Sassari, via Vienna, 2, 07100 Sassari, Italy Porto Conte Ricerche Srl, S.P. 55 Porto Conte/Capo Caccia Km 8.400, Tramariglio, 07041, Alghero (SS), Italy
a r t i c l e
i n f o
Article history: Received 21 June 2010 Returned to author for revision 2 August 2010 Accepted 30 August 2010 Available online 21 September 2010 Keywords: Skin cancer Artiodactyl papillomavirus Sheep Rolling circle amplification In-situ Hybridization Biodiversity Phylogeny
a b s t r a c t Papillomaviruses play an important role in human cancer development, and have been isolated from a number of animal malignancies. However, the association of papillomaviruses with tumors has been poorly investigated in sheep. In this study, a novel ovine Papillomavirus, OaPV3, was cloned from sheep squamous cell carcinoma. Unlike the already known ovine papillomaviruses, belonging to the Delta genus, OaPV3 lacks the E5 open reading frame and maintains the conserved retinoblastoma motif in the E7 gene. OaPV3 infects exclusively epithelial cells, and was found in skin of healthy sheep of geographically separated flocks located in Sardinia (Italy). This new virus is transcriptionally active in tumors and shares low homology with all the other papillomaviruses, establishing a new genus. Taken together, the co-occurrence of OaPV3 and tumors, its cell and tissue tropism, and its gene repertoire, suggests a role for this virus in development of sheep squamous cell carcinoma. © 2010 Elsevier Inc. All rights reserved.
Introduction Papillomaviruses (PVs) are a diverse group of small, nonenveloped, double stranded DNA viruses that cause proliferations of the stratified squamous epithelium of the skin and of the mucosa in a wide variety of host species (Bernard et al., 2010; zur Hausen and de Villiers, 1994). A large number of different PV types have been genetically characterized and defined as genotypes, most of them being highly species-specific, and some being associated to defined degrees of pathogenicity (de Villiers et al., 2004; Van Ranst et al., 1992). More than 100 human genotypes (HPVs) are implicated in both benign (warts, papillomas or condylomas) and malignant lesions (zur Hausen, 2009). The Alpha genus contains predominantly mucosal HPVs, among which HPV16 and HPV18 are involved in the development of about two thirds of all cervical carcinomas worldwide. Moreover, several cutaneous HPVs of the Beta genus (types 5, 8, 9, 12, 14, 15, 17, 19–25) and of the Nu genus (type 41), have been frequently reported in association with squamous cell skin carcinomas of immunosuppressed but also of immunocompetent patients (zur Hausen, 2009), and in patients with the rare hereditary disease ⁎ Corresponding author. Dipartimento di Patologia e Clinica Veterinaria Dell'Università degli Studi di Sassari, Facoltà di Medicina Veterinaria, Via Vienna 2, 07100 Sassari, Italy. Fax: + 39 079 229451. E-mail address: [email protected] (A. Alberti). 0042-6822/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2010.08.034
epidermodysplasia verruciformis (Kim et al, 2010; Nuovo and Ishag, 2000). Similarly, several animal genotypes have been isolated from canine, feline, rodents, primate, and bovine squamous cell carcinomas, and from other malignancies (see Table S1) (Borzacchiello et al., 2003; Campo, 2002; Chambers et al., 2003; Munday et al., 2009; Nasir and Campo, 2008; Yuan et al., 2007). Squamous cell carcinoma (SCC) is the most common form of skin cancer in sheep (Ovis aries), and it has been reported in Australia (Hawkins et al, 1981; Swan et al, 1984; Tilbrook et al., 1992), South Africa (Tustin et al., 1982), France (Lagadic et al., 1982), Spain (Méndez et al., 1997), Saudi Arabia (Ramadan et al., 1991), and Brazil (Del Fava et al., 2001). Papillomavirus DNA was identified by means of “in situ” hybridization techniques in pre-cancerous ear lesions (Trenfield et al., 1990), and in sheep perineal tumors (Tilbrook et al., 1992). Additionally, papillomavirus particles were identified by electron microscopy in pre-tumoral and tumoral lesions of ewes (Vanselow and Spradbrow, 1983). However, the two papillomavirus genotypes OaPV1 and OaPV2 isolated so far in sheep seem to associate only to fibropapillomas and have never been observed in precancerous lesions and skin tumors. Based on these preliminary data, we hypothesized that unknown epidermotropic ovine papillomaviruses (OaPVs) may exist, and that they may be detected in cases of ovine SCC. Consequently, we extracted DNA from cases of well differentiated ovine SCCs, and amplified circular DNA by the recently described multiple-primed rolling-circle amplification (RCA) method, which has been shown to
A. Alberti et al. / Virology 407 (2010) 352–359
be useful for the cloning of entire papillomavirus genomes (Dean et al., 2001; Rector et al, 2004; Rector et al, 2005). Indeed, papillomavirus-like DNA was amplified from two ovine SCCs, cloned, and sequenced. Sequence determination and analysis resulted in the detection and primary description of a third OaPV (OaPV3). The new isolate meets the majority of criteria needed to declare detection of a novel genus among the papillomaviruses (Bernard et al., 2010; de Villiers et al., 2004). In situ hybridization combined to immunohistochemistry revealed that OaPV3 infects exclusively epithelial cells. Finally PCR and RT-PCR allowed establishing the presence of OaPV3 in geographically separated flocks and of OaPV3 early transcripts in tumors, respectively. Results RCA, cloning and sequencing of the OaPV3 genome DNA samples representative of 4 SCC biopsies were amplified using multiply primed rolling circle amplification (RCA). RCA generates linear, double-stranded tandem-repeated copies of circular template DNAs (Dean et al., 2001; Nelson et al., 2002). After denaturation of circular DNA templates, exonuclease-protected random hexamer primers anneal to the template DNA at multiple sites, and are extended by a phi 29 DNA polymerase. When this DNA polymerase reaches a downstream extended primer, strand displacement occurs. Newly synthesized strands can subsequently be available as targets for additional priming events, thus resulting in exponential isothermal amplification. The obtained double-stranded, high molecular-weight, tandem-repeated copies of the template DNA are then digested with a panel of restriction enzymes, and the presence of a papillomavirus genome is established by the appearance of a band (or multiple bands) consistent with the size of a papillomavirus genome (about 7–8 kb) in agarose electrophoresis. After digestion with a panel of restriction endonucleases, RCA products obtained from 2 of the 4 SCCs generated an invariant pattern consistent with the size of a papillomavirus genome (Fig. 1A). In particular, EcoRI and StuI produced a single band of about 7.5 Kb. Digestions with HindIII resulted in 3 DNA fragments of approximately 1, 2.1, and 4.2 kb, respectively. The use of NruI, MluI, and KpnI did not
353
result in the appearance of detectable DNA fragments. The restriction pattern associated with the 2 SCC samples was compared to that of the fully sequenced ovine papillomaviruses OaPV1 and OaPV2, obtained in silico with the same restriction endonucleases (Table S2). Based on RCA results, we hypothesized the presence of an unknown papillomavirus in the 2 SCC samples. According to the guidelines for Papillomavirus taxonomy (Bernard et al., 2010; de Villiers et al., 2004), this putative novel papillomavirus was named OaPV3. The 7.5 Kb SacI fragments obtained from the 2 RCA-amplified SCC DNA samples were successfully cloned into pUC19. When the two SCC clones were independently sequenced by primer walking, a 100% identity was observed, confirming that both SCC carcinomas contained the same virus. In order to establish that SacI was indeed a single cutter of the OaPV3 genome, and to confirm that the full genome of OaPV3 was properly cloned into pUC19, a 0.8-kb region surrounding the SacI site was amplified from SCC DNA and from a non-digested RCA product obtained from the same sample. Comparison of the nucleotide sequences obtained from the amplicons resulted in 100% identity, confirming that the complete OaPV3 genome was correctly cloned into pUC19 (data not shown). The complete OaPV3 genome sequence The complete nucleotide sequence of the Ovis aries papillomavirus type 3 genome (OaPV3, GenBank accession number FJ796965) counts 7344 bp, and has a GC content of 46.8%. The OaPV3 genome contains the classical PV major ORFs E6, E7, E1, E2, L2, L1. A putative E4 is also present as a result of a spliced message. Notably, OaPV3 lacks the E5 ORF, which is constantly present in the ovine Papillomaviruses OaPV1 and OaPV2. The exact locations of the ORFs and comparisons with related papillomaviruses are shown in Fig. 2 and Table 1, respectively. The noncoding region (NCR) The classic noncoding region, located between the stop codon of L1 and the start codon of E6, counts 635 bp in OaPV3 (nt 1 to 635). NCR usually contains an E1 recognition site (E1BS) flanked by two E2binding sites (E2BS), for binding of an E1/E2 complex in order to activate the origin of replication. OaPV3 NCR contains 6 typical E2binding sites (E2BS) with the consensus sequence ACC-N6-GGT at nt 107–118, 152–163, 190–201, 234–245, 314–325, and 367–378. We failed to locate an E1BS. A double polyadenylation signal (AATAAATAAA, nt 7336–2) required for the processing of the L1 and L2 capsid mRNA transcript is present upstream of a CA dinucleotide and of a G/T cluster. The OaPV3 NCR contains the tata box (TATAAAT, nt 604–609) of the E6 promoter, located 25 nucleotides upstream the E6 start codon. OaPV3 early region
Fig. 1. Rolling circle amplification and restriction analyses. (A). ML: 1 kb DNA ladder; 1 to 6, RCA digestions with NruI, MluI, SacI, EcoRI, KpnI, HindIII, respectively; 7, undigested RCA product. Production of Dig-labeled E6/E7 probes (B and C, respectively). ML, 100 bp DNA ladder; 1, digoxigenin-labeled probes; 2, unlabeled controls. Transcription of OaPV3 E6 from sSCC (D). ML: 1 kb DNA ladder; amplification of E6 from cDNA generated by using: 1, primer OaPV3/E6/START, and 2, random hexamers; 3, DNasetreated RNA extractions; 4, vendor positive control; 5, negative control; 6, Total OaPV3 DNA. Transcription of OaPV3 E7 from sSCC (E). ML: 1 kb DNA ladder; amplification of E7 from cDNA generated by using: 1, primer OaPV3/E7/START, and 2, random hexamers; 3, DNase-treated RNA extractions; 4, vendor negative control; 5, vendor positive control; 6, water; 7, Total OaPV3 DNA.
The putative OaPV3 E6 contains two conserved zinc-binding domains (C-X-X-C-X29-C-X-X-C), separated by 36 amino acids. The E7 ORF contains one such zinc-biding domain and the conserved retinoblastoma tumor suppressor binding domain (LYCDE). The E1 ORF codes for the largest OaPV3 protein (607 amino acids), and contains the conserved ATP-binding site for the ATP dependent helicase (GPSDTGKS) in its carboxy-terminal part. It also contains a cyclin interaction RXL motif (the native KRRLF recruitment motif) which mediates E1 interaction with and phosphorylation by cyclin/ Cdk complexes and is required for efficient HPV replication in vivo (Ma et al., 1999). Moreover, the open reading frame E4 was identified as a result of a spliced message unifying the first few codons of E1 (nt 1303–1315) with a downstream ORF in the + 1 frame of the E2 ORF (nt 3676–4013). Remarkably, the typical open reading frame E5 could not be identified.
354
A. Alberti et al. / Virology 407 (2010) 352–359
Fig. 2. Schematic representation of the OaPV3 genome. The genome is divided into three sections: early genes (Early region), late genes (Late region) and long control region (LCR). Coding sequences from initiation to stop codon are shown as rectangles.
OaPV3 late region The late region codes for the major (L1) and minor (L2) capsid protein genes. Both L1 (KRRRK) and L2 (KKKRKKKR) contain a series of arginine and lysine residues at their carboxy terminus, which are likely to function as a nuclear localization signal. A double polyadenylation signal (AATAAATAAA) for processing the early viral mRNA transcript is present within the beginning of the L2 ORF (nt 4417–4426, 102 nt downstream the E2 stop codon), 20 nt upstream of a CA dinucleotide. Similarity with other papillomaviruses and phylogenetic analysis The sequence similarity between OaPV3 and EdPV-1 (a malignant cutaneous North American porcupine PV of the Sigmapapillomavirus; GenBank accession number NC_006951), HPV-41 (a malignant cutaneous PV of the Nupapillomavirus; NC_001354), OaPV1 (a fibropapilloma-associated ovine PV of the Deltapapillomavirus; NC_001789), OaPV2 (a fibropapilloma-associated ovine PV of the Deltapapillomavirus; U83595), and HPV-16 (a prototype mucosal high-risk PV of the Alphagenus; NC_001526), was investigated by pairwise alignments of the corresponding ORFs and their proteins (Table 1). Such alignment revealed that OaPV3 sequence shares only a low degree of similarity with other PV sequences, slightly higher for the PV of the Nu and Sigma genera. The highest similarity (51 to 55%) was observed for the L1 ORF. This result places OaPV3 in a new PV genus, since different genera of PV are defined by sharing less than 60% nucleotide sequence identity in the L1 ORF (Bernard et al., 2010). A neighbor-joining phylogenetic tree was constructed, based on a concatenated E1/E2/L2/L1 nucleotide sequence alignment of OaPV3 and 70 PV-types of the different PV genera and species (Fig. 3). Nucleotide sequence alignments, based on the corresponding amino acid alignments, were constructed separately for the different ORFs. Regions where an unambiguous alignment could be obtained were included in one combined alignment of 1552 nucleotides (see supplementary material, S3). The resulting neighbor-joining phylogenetic tree clusters the PVs in the different genera, according to the new classification of PV (Bernard et al., 2010; de Villiers et al., 2004). In this tree, OaPV3 appears as a novel close-to-root papillomavirus Table 1 Percentage nucleotide (amino acid) identity of the different OaPV3 ORFs with the ORFs of several related papillomaviruses. OaPV3 ORF
EdPV-1
HPV-41
OaPV1
OaPV2
HPV-16
E6 E7 E1 E2 L2 L1
38 30 52 47 46 55
43 36 48 46 45 55
42 (20) 40 (23) 51 (37) 46 (27) 45 (24) 51 (44)
42 39 51 47 45 53
41 47 51 46 44 53
(19) (25) (49) (28) (29) (49)
(23) (26) (40) (28) (28) (46)
(21) (23) (37) (27) (22) (44)
(19) (35) (38) (30) (26) (45)
related to the Nu and Sigma genera, and weakly related to the arctiodactyl papillomaviruses of the Delta genus. Maximum parsimony trees constructed by using the same nucleotide alignment were in agreement with neighbor-joining trees (data not shown). In situ hybridization Slides were obtained from 4 SCC lesions and from normal skin of 4 sheep. The use of the L1 and E6 digoxigenated probes (Fig. 1B, C) resulted in the presence of an OaPV3 specific nuclear signal in slides derived from 2 of the 4 SCC samples (Fig. 4). These tumor DNA samples were the same that tested positive to RCA and were the source for OaPV3 isolation (see above). In particular, an OaPV3specific nuclear signal was observed in proliferating epithelium invading the derma, where intercellular bridges of epithelial cell and whorl pattern formation (keratin pearls) were evident. The OaPV3 nuclear signal was only observed in the positive anti-pancytokeratin cells, suggesting that exclusively epithelial cells were infected by OaPV3. A positive signal was also observed in adjacent normal skin tissue of the same samples/sheep (data not shown). Detection of OaPV3 DNA in healthy sheep skin samples A PCR targeting the L1 region of the OaPV3 genome was used to investigate the presence of OaPV3 DNA in skin obtained from healthy sheep sampled in flocks where SCC was present (flocks C, D), and in flocks where SCC was never observed (flocks E, F). OaPV3 DNA was detected in all flocks, with a percentage of positive sheep per flock ranging from 10% to 30% (see Table S4). This result was consistent for all three replicates of the 40 DNA samples, while liver DNA extractions and negative PCR controls tested constantly negative. Three independent replicates of the PCR assay originated the same result. Sequences obtained from amplicons shared a 100% homology and matched the corresponding region of OaPV3. Detection of OaPV3 RNA transcripts in ovine SCCs The presence of OaPV3 early transcripts in RNA extracted from the two RCA-positive SCC was established by applying E6 and E7 specific PCRs on cDNAs retrotranscribed independently with primers targeting the early region and with random hexamers. E6 and E7 specific PCRs demonstrated the presence of early transcripts in RNA samples extracted from both the SCC lesions (Fig. 1D, E). All cDNA replicates obtained either with random examers or retrotranscribed with primers targeting the early region of OaPV3 tested positive by E6 and E7 PCRs. Non-retrotranscribed DNase-treated tumor RNA extractions and sheep liver cDNA, used as negative controls for presence of residual DNA, were always PCR-negative. Sequencing of PCR products always resulted in sequences sharing 100% identity with the corresponding region of OaPV3.
A. Alberti et al. / Virology 407 (2010) 352–359
355
Fig. 3. Neighbor-joining phylogenetic tree, based on a 1552-bp combined concatenated E1/E2/L2/L1 nucleotide sequence alignment of OaPV3 and 70 other animal and human type PVs. The numbers at the internal nodes represent the bootstrap support values, determined for 10,000 iterations with the neighbor-joining method. Only bootstrap probabilities greater than 80% are shown.
Discussion SCC is the second most common form of skin cancer in humans, and has been frequently reported in different animal species, often in association with papillomaviruses (Bernard et al., 2010; zur Hausen, 2009). In sheep, it develops in conjunction with solar injury, which is heightened when animals ingest photosensitizing plants or are subjected to Mules' operation and tail docking (Méndez et al., 1997). Due to the high incidence recorded in some flocks, and the resulting decrease in yield and loss of income from the sale of breeding animals, ovine SCC is of economic significance in some parts of the world. In Australia, it was responsible for more than one third of all condemnations before slaughter (Hawkins et al., 1981). In Merinos, 12% of tumors have been observed to metastasize, mainly to the lung but also to the regional lymph node (Ladds and Entwistle, 1977; Lloyd, 1961). SCC poses a direct threat to sheep, especially to those highly selected for milk production, such as Sarda breed sheep, by compromising the udders of ewes. Although it was demonstrated
that papillomaviruses play an important role in the development of cervix cancer (zur Hausen, 2009), the association of papillomaviruses with tumors has been poorly investigated in sheep. The two sheep papillomavirus OaPV1 and OaPV2 identified to date belong to Delta papillomavirus, and were isolated from healthy sheep. Papillomaviruses of the Delta genus share a fibroblast cellular tropism, and lack the canonical pRB-binding domain in the E7 ORF, features related to the development of fibropapillomas (Narechania et al., 2004). For these reasons, OaPV1 and OaPV2 are poor candidates for a potential role in the development of SCC, which is a tumor of epithelial origin. On the other hand, epitheliotropic papillomaviruses have been isolated from cases of SCC in species other than sheep. In this study, we selected 4 cases of well differentiated SCC in sheep, and investigated them for the presence of papillomaviruses. First, we established the absence of OaPV1 and OaPV2 in the 4 tumors, by applying PCR tests designed to amplify the L1, E6, and E5 of these viruses (data not shown). Subsequently, we applied RCA combined to restriction analyses with a panel of endonucleases and we obtained an
356
A. Alberti et al. / Virology 407 (2010) 352–359
Fig. 4. Typical fields obtained when probing SCCs with the E6/L1 digoxigenated probes by in situ hybridization (left column). Top, middle: cordons of epithelial cells invading the derma with nuclei positive to OaPV3. Bottom: keratin pearl in detail: OaPV3-positive nuclei of squamous cells. Right column: positive cytoplasmic immunoreactivity of epithelial cells to anti-pan-cytokeratin. Same fields of in-situ hybridization.
invariant pattern, consistent with the size of a papillomavirus genome, from 2 of the 4 SCCs (Fig. 1A). This pattern differed from the one calculated in silico for OaPV1 and OaPV2 (Table S2). The genome of this novel Papillomavirus, which we named OaPV3, was successfully cloned and fully sequenced. Unlike the Delta papillomaviruses OaPV1 and OaPV2, OaPV3 lacks an E5 gene and maintains the conserved retinoblastoma tumor suppressor binding sequence motif in E7. For these reasons, the OaPV3 genome does not meet the criteria for fibroblasts infection and fibropapilloma development typical of Arctiodactyl papillomaviruses, while its genes repertoire is reminiscent of the epitheliotropic human papillomavirus of the Beta genus. Indeed, in-situ hybridization experiments conducted in tumors confirmed that OaPV3 infects exclusively epithelial cells, arranged either in solid cords or nests forming often epithelial “pearls” in the derma (Fig. 4). Pairwise alignments of OaPV3 to selected Papilloma viruses (Table 1) demonstrate that the OaPV3 sequence shares only a low degree of similarity with other PVs. In particular, OaPV3 shares less than 60% nucleotide sequence identity in the L1 ORF with any other papillomavirus. This result, considered together with the OaPV3 peculiar cell tropism, places this virus in a new genus (tentatively Dyokappa), according to the criteria needed to declare detection of a novel genus among the papillomaviruses (Bernard et al., 2010). Phylogenetic analyses based on a concatenated E1/E2/L2/L1 nucleotide sequence alignment of OaPV3 with 70 PV-types of the different
PV genera and species (Fig. 3) confirmed OaPV3 as a novel close-toroot papillomavirus weakly related to the Nu and Sigma genera.. Notably, papillomaviruses representative of the Nu and Sigma genera were isolated from some skin carcinomas and premalignant keratoses of human patients and from hyperplastic papillomatous regions of a North American porcupine, respectively. Moreover, OaPV3 is actively transcribed in tumors (Fig. 1D, E). However, the previously described OaPV1 and OaPV2 were isolated only from sheep benign neoplasms such as fibropapillomas. OaPV3 was successfully amplified from DNA extracted from healthy skin of sheep belonging to geographically separated flocks (two of them with history of SCC), sampled in Sardinia (Italy). This demonstrates that OaPV3 does not represent a strain adapted to a single flock, but it is most likely a virus well represented in sheep of the Sarda breed. All skin samples generated constantly the same sequence (with only one point mutation in one sample), and this can be explained by considering that papillomaviruses are highly species specific and that the Sarda is a relatively primitive sheep breed highly selected for milk production. Therefore, a founder effect can be speculated to be acting not only on Sardinian sheep but also on their related papillomavirus genetic diversity. Our group recently used endogenous integrated retroviruses (retrotypes) to investigate sheep domestication events (Chessa et al., 2009), and demonstrated that sheep differentiated on the basis of their “retrotype” and dispersed across Eurasia and Africa via separate migratory episodes. It would be
A. Alberti et al. / Virology 407 (2010) 352–359
interesting to investigate more deeply sheep papillomavirus diversity in order to assess its applicability to studies on host phylogeny and phylogeography. Concluding, it can be stated that OaPV3 is a new papillomavirus with epithelial tropism, which is transcriptionally active in ovine SCCs and is potentially related to tumor development, similarly to what has been suggested for Beta papillomavirus and human SCC. Conclusions This paper represents a first step towards the understanding of oncogenic papillomavirus of sheep. The elucidation of OaPV3 oncogenic properties is hampered by the lack of diagnostic and cellular biology tools, such as specific antibodies and a suitable cellular model for ovine SCC. Remarkable epidemiologic similarities of this condition have been observed to exist in sheep and humans living in the same tropical environment (Ladds and Daniels, 1982). Likewise, the pathological features of hyperkeratoses in sheep resemble solar keratoses in man, and the same applies to more advanced lesions in these species. Therefore, further studies are welcomed to clarify the role of OaPV3 in precancerous skin lesions and in tumor progression, and to establish a suitable animal model for human SCC. Materials and methods Origin of the samples Biopsies were obtained from 4 sheep reared in 4 geographically separated flocks (A, B, C, D) located in Sardinia (Italy), and showing lesions macroscopically indicative of SCC. Full-thickness biopsies of each type of lesion and adjacent normal skin were taken. One set of biopsies was fixed in 10% neutral-buffered formalin, embedded in paraffin, and sectioned to 4–6 mm slices. Adjacent slices were mounted onto glass slides and alternatively stained with haematoxylin and eosin (H&E) for light microscopy, or used for in situ hybridization (ISH) experiments. A second set of tissues was kept at −80 °C until nucleic acids extraction. Skin samples of the same locations were also collected from healthy sheep (n = 40) of flocks C and D, and of flocks E and F (2 distinct flocks located in Sardinia where sheep papillomatosis was observed but SCC was never recorded). Ten sheep were sampled from each flock. Skin samples were obtained by scraping healthy sheep skin with a cover glass slide several times. The cover glass slides where then saved in a 50-ml falcon tube and stored at −20 °C until DNA extraction. Nucleic acids extraction and multiply primed rolling-circle amplification DNA was extracted from tumors (20 mg) using the DNeasy blood and tissue kit (Qiagen. Jesi, Italy), following vendor recommendations for tissue samples. The same procedure was used for extracting DNA from the 40 skin samples obtained from healthy sheep. RNA was extracted from tumors previously disrupted with a tissuelyser (Tissuelyser II; Qiagen, Iesi, Italy), by using the MagMax™ viral RNA isolation kit and a MagMax Express automatic nucleic acid extractor (Applied Biosystem, Monza. Italy), or alternatively the RNeasy micro kit (Qiagen, Jesi, Italy). Sheep liver tissue samples were coupled to each of the tumor and skin samples during nucleic acids extractions, as a negative control. Rolling Circle Amplification (RCA) (GE Healthcare, Milano, Italy) combined with restriction enzyme analyses were used in order to establish the presence of papillomavirus genomes in tumors. RCA was performed using the TempliPhi 100 Amplification kit (GE Healthcare, Milano, Italy), following protocols recently optimized for amplification of papillomaviral complete genomes (Rector et al., 2004; Van Doorslaer et al., 2006). Shortly, 5 μl of tumor DNA extraction were mixed with 10 μl of TempliPhi sample buffer and subsequently heated for 3 min at 95 °C, then
357
transferred into an ice-bucket. Ten microliters of TempliPhi reaction buffer containing salts and deoxynucleotides (dNTPs), 0.4 μl of TempliPhi enzyme mix containing the phi 29 DNA polymerase and random hexamers in 50% glycerol, and 450 mM of extra dNTPs per sample were mixed and added to the cooled samples, and the reactions were subsequently incubated overnight (approximately 20 h) at 30 °C. Eventually, the phi 29 DNA polymerase was inactivated at 65 °C for 10 min. After digestion with a restriction enzyme panel (Table S2), the products were run on a 0.8% agarose gel to check for the presence of a DNA band consistent with full-length papillomaviral genomes, or multiple bands with sizes adding up to this length. OaPV3 genome cloning, sequencing, sequence alignments, and phylogenetic analyses A 7.4-kb DNA fragment obtained by digesting RCA products with SacI was cloned into pUC19 (Invitrogen, Milano, Italy) to generate pUC19/OaPV3. Briefly, 10 μl of the RCA product were digested with 100 units of SacI overnight and run on a 0.8% agarose gel, after which the fragment was extracted by using the QIAquick Gel Extraction Kit (Qiagen, Jesi, Italy). The fragment was then ligated into the pUC19 vector that was previously cut with SacI and dephosphorylated, by using the Rapid DNA Dephos & Ligation Kit (Roche, Milano, Italy). Ligation product was used to transform One Shot MAX Efficiency DH5Alpha™-T1R competent cells (Invitrogen, Milano, Italy). Bacteria were incubated for blue-white colony screening on agar plates containing X-gal, and white colonies were checked by SacI digestion of miniprep DNA. One clone containing the 7.4 kb DNA fragment was selected. The complete genome of the Ovis aries Papillomavirus type 3 (OaPV3) was determined by primer-walking sequencing of the cloned DNA fragment, starting from the universal primers sites in the multiple cloning site of pUC19. Sequencing was performed on an ABI Prism 3100 Genetic Analyzer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA). Electropherograms were inspected and edited with Chromas 2.2 (Technelysium, Helensvale, Australia), and contigs were prepared using SeqMan II (DNASTAR, Madison, WI, USA). Two primers (OaPV3/F 5' GACACGTATATGCGGAATGC 3', OaPV3/R 5' GCTAACAGAATCAACAGGAG 3') surrounding the SacI site were designed based on the OaPV3 sequence available at that point of the study. Primers OaPV3/F and OaPV3/R were used to exclude the presence of two or more adjacent SacI sites in the OaPV3 genome, potentially generating small DNA fragments not detectable in agarose gel electrophoresis after digestion of the RCA product, and therefore hampering the full length cloning of OaPV3 genome. This was done by amplifying 892 base pairs from both a tumor DNA extraction and from an undigested RCA product obtained from the same DNA sample. Amplicons were routinely cloned into pCDNA3.1 using the topoTA cloning kit (Invitrogen, Milano, Italy) following vendor recommendation. For each of the two amplicons, three clones were selected after transformation of E. coli DH5 alpha and sequenced for comparison. The nucleotide sequence of the OaPV3 genome was deposited in GenBank by using the National Center for Biotechnology Information (NCBI, Bethesda, MD) BankIt v3.0 submission tool (http://www3. ncbi.nlm.nih.gov/BankIt/) under accession number FJ796965. Prediction of open reading frames (ORFs) was performed using the ORF Finder tool on the NCBI server of the National Institutes of Health (http://www.ncbi.nlm.nih.gov/gorf.html). The molecular weight of the putative proteins was calculated using the ExPASy (Expert Protein Analysis System) Compute pI/Mw tool (http://www.expasy.org/ tools/pi_tool.html). Pairwise sequence alignments and sequences similarities were calculated using the ClustalW (Thompson et al., 1994) and the identity matrix options of Bioedit (Hall, 1999), respectively. For multiple nucleotide sequence alignments, the sequences of OaPV3 and 70 other PVs were imported in DAMBE version 4.2.7 (Xia and Xie, 2001), aligned at the amino acid level using ClustalW, after which the nucleotide sequences were aligned
358
A. Alberti et al. / Virology 407 (2010) 352–359
according to the aligned amino acid sequences. Also, alternative alignments were generated by omitting the third codon positions. This was done separately for the different ORFs, and the unambiguously alignable parts of the E1, E2, L2, and L1 ORFs were pasted together in one compiled alignment. Genetic distances among the operational taxonomic units (OTUs) were computed as percent of total nucleotide differences or by the Kimura 2-parameters method using MEGA version 2.1 (Kumar et al., 2001), and were used to construct neighbor-joining (NJ) trees (Saitou and Nei, 1987). Statistical support for internal branches of the trees was evaluated by bootstrapping (Felsenstein, 1985). Maximum parsimony (MP) trees and consensus values were generated using the same software. Trees were edited using NJplot (Perriere and Gouy, 1996) and Treeview v. 1.5.2 (Page, 1996). In situ hybridization and immunohistochemistry The PCR DIG Probe Synthesis Kit (Roche, Milano, Italy) was used to generate two digoxigenin-labeled probes by polymerase chain reaction. For each of the two probes a 50 μl reaction was set up by mixing 5 μl of PCR DIG Probe Synthesis Mix (containing 200 μM of each dNTP and 70 μM DIGdUTP) with 5 μl of 10× PCR buffer containing MgCl2, 0.75 μl of enzyme mix, 29.25 μl water, 5 μl (100 pg) of pUC19/OaPV3, and 10 μl of the appropriate primers mix. Digoxigenin labeled and unlabeled 151-bp-long E6 probes were generated by using primers OaPV3/E6F (5' AAGCCCTCGTACAATAGCTG 3') and OaPV3/E6R (5' GCCAAATCTCCAGAGTAAAGC 3'). Digoxigenin labeled and unlabeled 127-bp-long L1 probes were obtained with primers OaPV3/L1F (5' AACTGGACTTGTCTTCCATG 3') and OaPV3/L1R (5' AAAGACTCGGTATTGGGAGG 3'). PCR profiles were designed following the manufacturer's instructions for probe synthesis. Two unlabeled probes were generated by using the same protocol, without digoxigenin incorporation in the PCR mix. Both digoxigenin labeled and unlabeled probes were used (individually) for in situ hybridization (ISH) experiments. Briefly, paraffin embedded tissue sections mounted onto positively charged glass slides were incubated at 55 °C for 1 h, deparaffinized in changes of xylene, and rehydrated in decreasing concentrations of ethanol. The sections were placed in Tris-buffered saline (TBS) at 37 °C for 5 min, treated with pepsin, and rinsed in TBS. After rinsing in distilled water, sections were dehydrated in increasing concentrations of ethanol and air dried. Slides were treated with 200 μl of pre-hybridization solution (100 μl molecular grade Fluka hybridization solution II, 86 μl formamide, 14 μl mQ water) and incubated at 37 °C for 2 h in humidity chamber. After removing the Pre-hybridization solution, slides were covered with a cover glass, treated with 200 μl of hybridization solution (obtained by adding 5 μl of 40 ng/ml denatured molecular probe to 100 μl molecular grade Fluka hybridization solution II, 86 μl formamide, 9 μl mQ water), placed at 95 °C for 8 min, and then transferred in humidity chamber and incubated overnight. The following day the unhybridized probes were removed by washing tissue slides twice with TBS (5 min per wash) and then treated with decreasing concentrations of Sigma-Aldrich (Italy) molecular biology grade SSPE (5 minutes washes at 25 °C with 2×, 1×, 0.5× SSPE, 30 min wash at 50 °C with SSPE 0.1× and BSA 0.2%, 5 min wash at 25 °C with SSPE 0.1× and BSA 0.2%). Tissues slides were then washed for five minutes with buffer I (0.1 M Tris, 0.15 M NaCl; pH 7.6). Non-specific endogenous alkaline phosphatase was blocked with normal rabbit serum (NRS, Sigma-Aldrich, Italy) by incubating slides with 200 μl of blocking solution (20 μl NRS, 3.1 μl of 0.3% Triton X100; 980 μl buffer I) in humidity chamber at room temperature for 45 min. For detection of the digoxigenin-labeled hybrids, slides were incubated for 2 h with 1:25 diluted anti-digoxigenin-AP Fab fragments (Sigma-Aldrich, Italy) at room temperature. Slides were rinsed twice and incubated for 50 min at 37 °C in the dark with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitro blue tetrazolium chloride (NBT). Color
development was stopped with TE buffer (pH 8.0). Slides were mounted with Top-Water mount (W. Pabisch SpA, Italy), and photographed with a light microscope. After ISH, slides were submitted to immunohistochemistry and incubated with anti-pancytokeratin antibodies (anti-human pan cytokeratin AE1/AE3, Dako, Denmark) diluted 1:300. Sections were treated with preformed streptavidin biotin complex, and diamino-benzidine chromogen (DAB, LAB Probe Kit, Biomeda Corporation, CA), following the vendor recommendations. Slides were then washed in PBS, dehydrated through dH2O and graded alcohols, cleared with xylene, and mounted using Eukitt (Bio Optica Milano SpA, Italy) mounting media. Detection of OaPV3 DNA in healthy sheep skin samples Primers OVPV3/L1F and OVPV3/L1R, targeting 127 bp of the OAPV3 L1 gene, were designed to and used to detect specific OaPV3 DNA in 40 sheep skin DNA extractions. Briefly, 5 μl of skin DNA extractions (100 ng) were used in a typical PCR reaction, containing 200 μM dNTPs, 1 μM primers, and 1.25 U of GoTAQ (Promega, Milano, Italy). PCR profile and mix were designed according to the manufacturer's instructions for GoTAQ. Skin DNA samples were run in triplicate and coupled with the sheep liver DNA samples used as negative controls for extractions. PCR was repeated three times. Amplicons were routinely cloned into pCR2.1TOPO (Invitrogen, Milano, Italy) and automatically sequenced. Detection of OaPV3 early transcripts in ovine SCC Complementary DNA was obtained from 2 ovine SCCs and from liver RNA extractions by using the SuperScript® First-Strand Synthesis System for RT-PCR, following the vendor instructions (Invitrogen, Milano, Italy). Either random hexamers, primer OaPV3/ E6/START: 5' ATGGAGGGAAGCCCTCGTAC 3', and primer OaPV3/E7/ START: 5' ATGCGTGGTCAGCAGCCCAC 3', were separately used to prime first-strand synthesis. The presence of early transcripts in tumors was investigated by using the cDNAs obtained as templates for two distinct PCR assays, based on the use of primers pairs (OaPV3/E6/ START: 5' ATGGAGGGAAGCCCTCGTAC 3' and OaPV3/E6/STOP: 5' TCAGGGAGTGTGGGCTGCTG 3' for E6; OaPV3/E7/START: 5' ATGCGTGGTCAGCAGCCCAC 3' and OaPV3/E7/STOP: 5' CTATGCAGCACACGGCGGAC 3' for E7). PCR profiles and mixes were set up according to manufacturer's recommendations for the polymerase used (GoTAQ Promega, Italy). As an additional control, aliquots of DNase-treated RNA extractions were subjected to PCR in order to rule out the presence of residual DNA in samples. PCRs were repeated 3 times starting from 3 replicates of independently-obtained cDNA batches. PCR products were routinely cloned and sequenced. Acknowledgments This work was supported by funding from Grant Ricerca sanitaria 2006, UPB S 12 025cap. 12012, and Misura P5 Biodiversitá animale (Regione Sardegna). Appendix A. Supplementary data Supplementary data to this article can be found online at doi:10.1016/j.virol.2010.08.034. References Bernard, H.U., Burk, R.D., Chen, Z., van Doorslaer, K., zur Hausen, H., de Villiers, E.M., 2010. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 401 (1), 70–79. Borzacchiello, G., Iovane, G., Marcante, M.L., Poggiali, F., Roperto, F., Roperto, S., Venuti, A., 2003. Presence of bovine papillomavirus type 2 DNA and expression of the viral oncoprotein E5 in naturally occurring urinary bladder tumours in cows. J. Gen. Virol. 84 (11), 2921–2926.
A. Alberti et al. / Virology 407 (2010) 352–359 Campo, M.S., 2002. Animal models of papillomavirus pathogenesis. Virus Res. 89 (2), 249–261. Chambers, G., Ellsmore, V.A., O'Brien, P.M., Reid, S.W., Love, S., Campo, M.S., Nasir, L., 2003. Association of bovine papillomavirus with the equine sarcoid. J. Gen. Virol. 84 (5), 1055–1062. Chessa, B., Pereira, F., Arnaud, F., Amorim, A., Goyache, F., Mainland, I., Kao, R.R., Pemberton, J.M., Beraldi, D., Stear, M.J., Alberti, A., Pittau, M., Iannuzzi, L., Banabazi, M.H., Kazwala, R.R., Zhang, Y.P., Arranz, J.J., Ali, B.A., Wang, Z., Uzun, M., Dione, M.M., Olsaker, I., Holm, L.E., Saarma, U., Ahmad, S., Marzanov, N., Eythorsdottir, E., Holland, M.J., Ajmone-Marsan, P., Bruford, M.W., Kantanen, J., Spencer, T.E., Palmarini, M., 2009. Revealing the history of sheep domestication using retrovirus integrations. Science 24 (5926), 532–536. de Villiers, E.M., Fauquet, C., Broker, T.R., Bernard, H.U., zur Hausen, H., 2004. Classification of papillomaviruses. Virology 324 (1), 17–27. Dean, F.B., Nelson, J.R., Giesler, T.L., Lasken, R.S., 2001. Rapid amplification of plasmid and phage DNA using Phi 29 DNA polymerase and multiply-primed rolling circle amplification. Genome Res. 11 (6), 1095–1099. Del Fava, C., Verissimo, C.J., Rodrigues, C.F.C., Cunha, E.A., Ueda, M., Maiorka, P.C., D´ Angelino, J.L., 2001. Occurrence of squamous cell carcinoma in sheep from a farm in São Paulo state, Brazil. Arq. Inst. Biol. 68 (1), 35–40. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39 (4), 783–791. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98. Hawkins, C.D., Swan, R.A., Chapman, H.M., 1981. The epidemiology of squamous cell carcinoma of the perineal region of sheep. Aust. Vet. J. 57 (10), 455–457. Kim, T., Park, J.C., Roh, M.R., Park, J.M., Cho, N.H., Lee, M.G., 2010. Development of aggressive squamous cell carcinoma in epidermodysplasia verruciformis associated with human papillomavirus type 22b. Dermatology10.1159/000290759 Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: Molecular Evolutionary Genetics Analysis Software. Bioinformatics 17, 1244–1245. Ladds, P.W., Daniels, P.W., 1982. Animal model of human disease. Squamous cell carcinoma. Ovine squamous cell carcinoma. Am. J. Pathol. 107 (1), 122–123. Ladds, P.W., Entwistle, K.W., 1977. Observations on squamous cell carcinoma of sheep in Queensland, Australia. Br. J. Cancer 35 (1), 110–114. Lagadic, M., Wyers, M., Mialot, J.P., Parodi, A.L., 1982. Enzootic vulvar cancer in sheep. Zentralbl. Veterinärmed. A 29 (2), 123–135. Lloyd, L.C., 1961. Epithelial tumours of the skin of sheep. Br. J. Cancer 15 (4), 780–789. Ma, T., Zou, N., Lin, B.Y., Chow, L.T., Harper, J.W., 1999. Interaction between cyclindependent kinases and human papillomavirus replication–initiation protein E1 is required for efficient viral replication. Proc. Natl Acad. Sci. USA 96 (2), 382–387. Méndez, A., Pérez, J., Ruiz-Villamor, E., García, R., Martín, M.P., Mozos, E., 1997. Clinicopathological study of an outbreak of squamous cell carcinoma in sheep. Vet. Rec. 141 (23), 597–600. Munday, J.S., Howe, L., French, A., Squires, R.A., Sugiarto, H., 2009. Detection of papillomaviral DNA sequences in a feline oral squamous cell carcinoma. Res. Vet. Sci. 86 (2), 359–361. Narechania, A., Terai, M., Chen, C.Z., DeSalle, R., Burk, R.D., 2004. Lack of the canonical pRB-binding domain in the E7 ORF of artiodactyl papillomaviruses is associated with the development of fibropapillomas. J. Gen. Virol. 85 (5), 1243–1250. Nasir, L., Campo, M.S., 2008. Bovine papillomaviruses: their role in the aetiology of cutaneous tumours of bovids and equids. Vet. Dermatol. 19 (5), 243–254.
.
359
Nelson, J.R., Cai, Y.C., Giesler, T.L., Farchaus, J.W., Sundaram, S.T., Ortiz-Rivera, M., Hosta, L.P., Hewitt, P.L., Mamone, J.A., Palaniappan, C., Fuller, C.W., 2002. TempliPhi, phi29 DNA polymerase based rolling circle amplification of templates for DNA sequencing. Biotechniques 44–47 Jun;Suppl. Nuovo, G.J., Ishag, M., 2000. The histologic spectrum of epidermodysplasia verruciformis. Am. J. Surg. Pathol. 24 (10), 1400–1406. Page, R.D.M., 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12 (4), 357–358. Perriere, G., Gouy, M., 1996. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 78 (5), 364–369. Ramadan, R.O., Gameel, A.A., el Hassan, A.M., 1991. Squamous cell carcinoma in sheep in Saudi Arabia. Rev. Élev. Méd. Vét. Pays Trop. 44, 23–26. Rector, A., Bossart, G.D., Ghim, S.J., Sundberg, J.P., Jenson, A.B., Van Ranst, M., 2004. Characterization of a novel close-to-root papillomavirus from a Florida manatee by using multiply primed rolling-circle amplification: Trichechus manatus latirostris papillomavirus type 1. J. Virol. 78 (22), 12698–12702. Rector, A., Tachezy, R., Van Doorslaer, K., MacNamara, T., Burk, R.D., Sundberg, J.P., Van Ranst, M., 2005. Isolation and cloning of a papillomavirus from a North American porcupine by using multiply primed rolling-circle amplification: the Erethizon dorsatum papillomavirus type 1. Virology 331 (2), 449–456. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425. Swan, R.A., Chapman, H.M., Hawkins, C.D., Howell, J.M., Spalding, V.T., 1984. The epidemiology of squamous cell carcinoma of the perineal region of sheep: abattoir and flock studies. Aust. Vet. J. 61 (5), 146–151. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22 (22), 4673–4680. Tilbrook, P.A., Sterrett, G., Kulski, J.K., 1992. Detection of papillomaviral-like DNA sequences in premalignant and malignant perineal lesions of sheep. Vet. Microbiol. 31 (4), 327–341. Trenfield, K., Spradbrow, P.B., Vanselow, B.A., 1990. Detection of papillomavirus DNA in precancerous lesions of the ears of sheep. Vet. Microbiol. 25 (2–3), 103–116. Tustin, R.C., Thornton, D.J., McNaughton, H., 1982. High incidence of squamous cell carcinoma of the vulva in Merino ewes on a South African farm. J. S. Afr. Vet. Assoc. 53 (3), 141–143. Van Doorslaer, K., Rector, A., Vos, P., Van Ranst, M., 2006. Genetic characterization of the Capra hircus papillomavirus: a novel close-to-root artiodactyl papillomavirus. Virus Res. 118 (1–2), 164–169. Van Ranst, M., Kaplan, J.B., Burk, R.D., 1992. Phylogenetic classification of human papillomaviruses: correlation with clinical manifestations. J. Gen. Virol. 73, 2653–2660. Vanselow, A., Spradbrow, P.B., 1983. Squamous cell carcinoma of the vulva, hyperkeratosis and papillomaviruses in a ewe. Aust. Vet. J. 60 (6), 194–195. Xia, X., Xie, Z., 2001. DAMBE: data analysis in molecular biology and evolution. J. Hered. 92 (4), 371–373. Yuan, H., Ghim, S., Newsome, J., Apolinario, T., Olcese, V., Martin, M., Delius, H., Felsburg, P., Jenson, B., Schlegel, R., 2007. An epidermotropic canine papillomavirus with malignant potential contains an E5 gene and establishes a unique genus. Virology 359 (1), 28–36. zur Hausen, H., 2009. Papillomaviruses in the causation of human cancers—a brief historical account. Virology 384 (2), 260–265. zur Hausen, H., de Villiers, E.M., 1994. Human papillomaviruses. Annu. Rev. Microbiol. 48, 427–447.
Contents lists available at ScienceDirect
Virology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y v i r o
Ovis aries Papillomavirus 3: A prototype of a novel genus in the family Papillomaviridae associated with ovine squamous cell carcinoma Alberto Alberti a,⁎, Salvatore Pirino a, Francesca Pintore a, Maria Filippa Addis a,b, Bernardo Chessa a, Carla Cacciotto a, Tiziana Cubeddu a, Antonio Anfossi a, Gavino Benenati a, Elisabetta Coradduzza a, Roberta Lecis a, Elisabetta Antuofermo a, Laura Carcangiu a, Marco Pittau a a b
Dipartimento di Patologia e Clinica Veterinaria, Università degli Studi di Sassari, via Vienna, 2, 07100 Sassari, Italy Porto Conte Ricerche Srl, S.P. 55 Porto Conte/Capo Caccia Km 8.400, Tramariglio, 07041, Alghero (SS), Italy
a r t i c l e
i n f o
Article history: Received 21 June 2010 Returned to author for revision 2 August 2010 Accepted 30 August 2010 Available online 21 September 2010 Keywords: Skin cancer Artiodactyl papillomavirus Sheep Rolling circle amplification In-situ Hybridization Biodiversity Phylogeny
a b s t r a c t Papillomaviruses play an important role in human cancer development, and have been isolated from a number of animal malignancies. However, the association of papillomaviruses with tumors has been poorly investigated in sheep. In this study, a novel ovine Papillomavirus, OaPV3, was cloned from sheep squamous cell carcinoma. Unlike the already known ovine papillomaviruses, belonging to the Delta genus, OaPV3 lacks the E5 open reading frame and maintains the conserved retinoblastoma motif in the E7 gene. OaPV3 infects exclusively epithelial cells, and was found in skin of healthy sheep of geographically separated flocks located in Sardinia (Italy). This new virus is transcriptionally active in tumors and shares low homology with all the other papillomaviruses, establishing a new genus. Taken together, the co-occurrence of OaPV3 and tumors, its cell and tissue tropism, and its gene repertoire, suggests a role for this virus in development of sheep squamous cell carcinoma. © 2010 Elsevier Inc. All rights reserved.
Introduction Papillomaviruses (PVs) are a diverse group of small, nonenveloped, double stranded DNA viruses that cause proliferations of the stratified squamous epithelium of the skin and of the mucosa in a wide variety of host species (Bernard et al., 2010; zur Hausen and de Villiers, 1994). A large number of different PV types have been genetically characterized and defined as genotypes, most of them being highly species-specific, and some being associated to defined degrees of pathogenicity (de Villiers et al., 2004; Van Ranst et al., 1992). More than 100 human genotypes (HPVs) are implicated in both benign (warts, papillomas or condylomas) and malignant lesions (zur Hausen, 2009). The Alpha genus contains predominantly mucosal HPVs, among which HPV16 and HPV18 are involved in the development of about two thirds of all cervical carcinomas worldwide. Moreover, several cutaneous HPVs of the Beta genus (types 5, 8, 9, 12, 14, 15, 17, 19–25) and of the Nu genus (type 41), have been frequently reported in association with squamous cell skin carcinomas of immunosuppressed but also of immunocompetent patients (zur Hausen, 2009), and in patients with the rare hereditary disease ⁎ Corresponding author. Dipartimento di Patologia e Clinica Veterinaria Dell'Università degli Studi di Sassari, Facoltà di Medicina Veterinaria, Via Vienna 2, 07100 Sassari, Italy. Fax: + 39 079 229451. E-mail address: [email protected] (A. Alberti). 0042-6822/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2010.08.034
epidermodysplasia verruciformis (Kim et al, 2010; Nuovo and Ishag, 2000). Similarly, several animal genotypes have been isolated from canine, feline, rodents, primate, and bovine squamous cell carcinomas, and from other malignancies (see Table S1) (Borzacchiello et al., 2003; Campo, 2002; Chambers et al., 2003; Munday et al., 2009; Nasir and Campo, 2008; Yuan et al., 2007). Squamous cell carcinoma (SCC) is the most common form of skin cancer in sheep (Ovis aries), and it has been reported in Australia (Hawkins et al, 1981; Swan et al, 1984; Tilbrook et al., 1992), South Africa (Tustin et al., 1982), France (Lagadic et al., 1982), Spain (Méndez et al., 1997), Saudi Arabia (Ramadan et al., 1991), and Brazil (Del Fava et al., 2001). Papillomavirus DNA was identified by means of “in situ” hybridization techniques in pre-cancerous ear lesions (Trenfield et al., 1990), and in sheep perineal tumors (Tilbrook et al., 1992). Additionally, papillomavirus particles were identified by electron microscopy in pre-tumoral and tumoral lesions of ewes (Vanselow and Spradbrow, 1983). However, the two papillomavirus genotypes OaPV1 and OaPV2 isolated so far in sheep seem to associate only to fibropapillomas and have never been observed in precancerous lesions and skin tumors. Based on these preliminary data, we hypothesized that unknown epidermotropic ovine papillomaviruses (OaPVs) may exist, and that they may be detected in cases of ovine SCC. Consequently, we extracted DNA from cases of well differentiated ovine SCCs, and amplified circular DNA by the recently described multiple-primed rolling-circle amplification (RCA) method, which has been shown to
A. Alberti et al. / Virology 407 (2010) 352–359
be useful for the cloning of entire papillomavirus genomes (Dean et al., 2001; Rector et al, 2004; Rector et al, 2005). Indeed, papillomavirus-like DNA was amplified from two ovine SCCs, cloned, and sequenced. Sequence determination and analysis resulted in the detection and primary description of a third OaPV (OaPV3). The new isolate meets the majority of criteria needed to declare detection of a novel genus among the papillomaviruses (Bernard et al., 2010; de Villiers et al., 2004). In situ hybridization combined to immunohistochemistry revealed that OaPV3 infects exclusively epithelial cells. Finally PCR and RT-PCR allowed establishing the presence of OaPV3 in geographically separated flocks and of OaPV3 early transcripts in tumors, respectively. Results RCA, cloning and sequencing of the OaPV3 genome DNA samples representative of 4 SCC biopsies were amplified using multiply primed rolling circle amplification (RCA). RCA generates linear, double-stranded tandem-repeated copies of circular template DNAs (Dean et al., 2001; Nelson et al., 2002). After denaturation of circular DNA templates, exonuclease-protected random hexamer primers anneal to the template DNA at multiple sites, and are extended by a phi 29 DNA polymerase. When this DNA polymerase reaches a downstream extended primer, strand displacement occurs. Newly synthesized strands can subsequently be available as targets for additional priming events, thus resulting in exponential isothermal amplification. The obtained double-stranded, high molecular-weight, tandem-repeated copies of the template DNA are then digested with a panel of restriction enzymes, and the presence of a papillomavirus genome is established by the appearance of a band (or multiple bands) consistent with the size of a papillomavirus genome (about 7–8 kb) in agarose electrophoresis. After digestion with a panel of restriction endonucleases, RCA products obtained from 2 of the 4 SCCs generated an invariant pattern consistent with the size of a papillomavirus genome (Fig. 1A). In particular, EcoRI and StuI produced a single band of about 7.5 Kb. Digestions with HindIII resulted in 3 DNA fragments of approximately 1, 2.1, and 4.2 kb, respectively. The use of NruI, MluI, and KpnI did not
353
result in the appearance of detectable DNA fragments. The restriction pattern associated with the 2 SCC samples was compared to that of the fully sequenced ovine papillomaviruses OaPV1 and OaPV2, obtained in silico with the same restriction endonucleases (Table S2). Based on RCA results, we hypothesized the presence of an unknown papillomavirus in the 2 SCC samples. According to the guidelines for Papillomavirus taxonomy (Bernard et al., 2010; de Villiers et al., 2004), this putative novel papillomavirus was named OaPV3. The 7.5 Kb SacI fragments obtained from the 2 RCA-amplified SCC DNA samples were successfully cloned into pUC19. When the two SCC clones were independently sequenced by primer walking, a 100% identity was observed, confirming that both SCC carcinomas contained the same virus. In order to establish that SacI was indeed a single cutter of the OaPV3 genome, and to confirm that the full genome of OaPV3 was properly cloned into pUC19, a 0.8-kb region surrounding the SacI site was amplified from SCC DNA and from a non-digested RCA product obtained from the same sample. Comparison of the nucleotide sequences obtained from the amplicons resulted in 100% identity, confirming that the complete OaPV3 genome was correctly cloned into pUC19 (data not shown). The complete OaPV3 genome sequence The complete nucleotide sequence of the Ovis aries papillomavirus type 3 genome (OaPV3, GenBank accession number FJ796965) counts 7344 bp, and has a GC content of 46.8%. The OaPV3 genome contains the classical PV major ORFs E6, E7, E1, E2, L2, L1. A putative E4 is also present as a result of a spliced message. Notably, OaPV3 lacks the E5 ORF, which is constantly present in the ovine Papillomaviruses OaPV1 and OaPV2. The exact locations of the ORFs and comparisons with related papillomaviruses are shown in Fig. 2 and Table 1, respectively. The noncoding region (NCR) The classic noncoding region, located between the stop codon of L1 and the start codon of E6, counts 635 bp in OaPV3 (nt 1 to 635). NCR usually contains an E1 recognition site (E1BS) flanked by two E2binding sites (E2BS), for binding of an E1/E2 complex in order to activate the origin of replication. OaPV3 NCR contains 6 typical E2binding sites (E2BS) with the consensus sequence ACC-N6-GGT at nt 107–118, 152–163, 190–201, 234–245, 314–325, and 367–378. We failed to locate an E1BS. A double polyadenylation signal (AATAAATAAA, nt 7336–2) required for the processing of the L1 and L2 capsid mRNA transcript is present upstream of a CA dinucleotide and of a G/T cluster. The OaPV3 NCR contains the tata box (TATAAAT, nt 604–609) of the E6 promoter, located 25 nucleotides upstream the E6 start codon. OaPV3 early region
Fig. 1. Rolling circle amplification and restriction analyses. (A). ML: 1 kb DNA ladder; 1 to 6, RCA digestions with NruI, MluI, SacI, EcoRI, KpnI, HindIII, respectively; 7, undigested RCA product. Production of Dig-labeled E6/E7 probes (B and C, respectively). ML, 100 bp DNA ladder; 1, digoxigenin-labeled probes; 2, unlabeled controls. Transcription of OaPV3 E6 from sSCC (D). ML: 1 kb DNA ladder; amplification of E6 from cDNA generated by using: 1, primer OaPV3/E6/START, and 2, random hexamers; 3, DNasetreated RNA extractions; 4, vendor positive control; 5, negative control; 6, Total OaPV3 DNA. Transcription of OaPV3 E7 from sSCC (E). ML: 1 kb DNA ladder; amplification of E7 from cDNA generated by using: 1, primer OaPV3/E7/START, and 2, random hexamers; 3, DNase-treated RNA extractions; 4, vendor negative control; 5, vendor positive control; 6, water; 7, Total OaPV3 DNA.
The putative OaPV3 E6 contains two conserved zinc-binding domains (C-X-X-C-X29-C-X-X-C), separated by 36 amino acids. The E7 ORF contains one such zinc-biding domain and the conserved retinoblastoma tumor suppressor binding domain (LYCDE). The E1 ORF codes for the largest OaPV3 protein (607 amino acids), and contains the conserved ATP-binding site for the ATP dependent helicase (GPSDTGKS) in its carboxy-terminal part. It also contains a cyclin interaction RXL motif (the native KRRLF recruitment motif) which mediates E1 interaction with and phosphorylation by cyclin/ Cdk complexes and is required for efficient HPV replication in vivo (Ma et al., 1999). Moreover, the open reading frame E4 was identified as a result of a spliced message unifying the first few codons of E1 (nt 1303–1315) with a downstream ORF in the + 1 frame of the E2 ORF (nt 3676–4013). Remarkably, the typical open reading frame E5 could not be identified.
354
A. Alberti et al. / Virology 407 (2010) 352–359
Fig. 2. Schematic representation of the OaPV3 genome. The genome is divided into three sections: early genes (Early region), late genes (Late region) and long control region (LCR). Coding sequences from initiation to stop codon are shown as rectangles.
OaPV3 late region The late region codes for the major (L1) and minor (L2) capsid protein genes. Both L1 (KRRRK) and L2 (KKKRKKKR) contain a series of arginine and lysine residues at their carboxy terminus, which are likely to function as a nuclear localization signal. A double polyadenylation signal (AATAAATAAA) for processing the early viral mRNA transcript is present within the beginning of the L2 ORF (nt 4417–4426, 102 nt downstream the E2 stop codon), 20 nt upstream of a CA dinucleotide. Similarity with other papillomaviruses and phylogenetic analysis The sequence similarity between OaPV3 and EdPV-1 (a malignant cutaneous North American porcupine PV of the Sigmapapillomavirus; GenBank accession number NC_006951), HPV-41 (a malignant cutaneous PV of the Nupapillomavirus; NC_001354), OaPV1 (a fibropapilloma-associated ovine PV of the Deltapapillomavirus; NC_001789), OaPV2 (a fibropapilloma-associated ovine PV of the Deltapapillomavirus; U83595), and HPV-16 (a prototype mucosal high-risk PV of the Alphagenus; NC_001526), was investigated by pairwise alignments of the corresponding ORFs and their proteins (Table 1). Such alignment revealed that OaPV3 sequence shares only a low degree of similarity with other PV sequences, slightly higher for the PV of the Nu and Sigma genera. The highest similarity (51 to 55%) was observed for the L1 ORF. This result places OaPV3 in a new PV genus, since different genera of PV are defined by sharing less than 60% nucleotide sequence identity in the L1 ORF (Bernard et al., 2010). A neighbor-joining phylogenetic tree was constructed, based on a concatenated E1/E2/L2/L1 nucleotide sequence alignment of OaPV3 and 70 PV-types of the different PV genera and species (Fig. 3). Nucleotide sequence alignments, based on the corresponding amino acid alignments, were constructed separately for the different ORFs. Regions where an unambiguous alignment could be obtained were included in one combined alignment of 1552 nucleotides (see supplementary material, S3). The resulting neighbor-joining phylogenetic tree clusters the PVs in the different genera, according to the new classification of PV (Bernard et al., 2010; de Villiers et al., 2004). In this tree, OaPV3 appears as a novel close-to-root papillomavirus Table 1 Percentage nucleotide (amino acid) identity of the different OaPV3 ORFs with the ORFs of several related papillomaviruses. OaPV3 ORF
EdPV-1
HPV-41
OaPV1
OaPV2
HPV-16
E6 E7 E1 E2 L2 L1
38 30 52 47 46 55
43 36 48 46 45 55
42 (20) 40 (23) 51 (37) 46 (27) 45 (24) 51 (44)
42 39 51 47 45 53
41 47 51 46 44 53
(19) (25) (49) (28) (29) (49)
(23) (26) (40) (28) (28) (46)
(21) (23) (37) (27) (22) (44)
(19) (35) (38) (30) (26) (45)
related to the Nu and Sigma genera, and weakly related to the arctiodactyl papillomaviruses of the Delta genus. Maximum parsimony trees constructed by using the same nucleotide alignment were in agreement with neighbor-joining trees (data not shown). In situ hybridization Slides were obtained from 4 SCC lesions and from normal skin of 4 sheep. The use of the L1 and E6 digoxigenated probes (Fig. 1B, C) resulted in the presence of an OaPV3 specific nuclear signal in slides derived from 2 of the 4 SCC samples (Fig. 4). These tumor DNA samples were the same that tested positive to RCA and were the source for OaPV3 isolation (see above). In particular, an OaPV3specific nuclear signal was observed in proliferating epithelium invading the derma, where intercellular bridges of epithelial cell and whorl pattern formation (keratin pearls) were evident. The OaPV3 nuclear signal was only observed in the positive anti-pancytokeratin cells, suggesting that exclusively epithelial cells were infected by OaPV3. A positive signal was also observed in adjacent normal skin tissue of the same samples/sheep (data not shown). Detection of OaPV3 DNA in healthy sheep skin samples A PCR targeting the L1 region of the OaPV3 genome was used to investigate the presence of OaPV3 DNA in skin obtained from healthy sheep sampled in flocks where SCC was present (flocks C, D), and in flocks where SCC was never observed (flocks E, F). OaPV3 DNA was detected in all flocks, with a percentage of positive sheep per flock ranging from 10% to 30% (see Table S4). This result was consistent for all three replicates of the 40 DNA samples, while liver DNA extractions and negative PCR controls tested constantly negative. Three independent replicates of the PCR assay originated the same result. Sequences obtained from amplicons shared a 100% homology and matched the corresponding region of OaPV3. Detection of OaPV3 RNA transcripts in ovine SCCs The presence of OaPV3 early transcripts in RNA extracted from the two RCA-positive SCC was established by applying E6 and E7 specific PCRs on cDNAs retrotranscribed independently with primers targeting the early region and with random hexamers. E6 and E7 specific PCRs demonstrated the presence of early transcripts in RNA samples extracted from both the SCC lesions (Fig. 1D, E). All cDNA replicates obtained either with random examers or retrotranscribed with primers targeting the early region of OaPV3 tested positive by E6 and E7 PCRs. Non-retrotranscribed DNase-treated tumor RNA extractions and sheep liver cDNA, used as negative controls for presence of residual DNA, were always PCR-negative. Sequencing of PCR products always resulted in sequences sharing 100% identity with the corresponding region of OaPV3.
A. Alberti et al. / Virology 407 (2010) 352–359
355
Fig. 3. Neighbor-joining phylogenetic tree, based on a 1552-bp combined concatenated E1/E2/L2/L1 nucleotide sequence alignment of OaPV3 and 70 other animal and human type PVs. The numbers at the internal nodes represent the bootstrap support values, determined for 10,000 iterations with the neighbor-joining method. Only bootstrap probabilities greater than 80% are shown.
Discussion SCC is the second most common form of skin cancer in humans, and has been frequently reported in different animal species, often in association with papillomaviruses (Bernard et al., 2010; zur Hausen, 2009). In sheep, it develops in conjunction with solar injury, which is heightened when animals ingest photosensitizing plants or are subjected to Mules' operation and tail docking (Méndez et al., 1997). Due to the high incidence recorded in some flocks, and the resulting decrease in yield and loss of income from the sale of breeding animals, ovine SCC is of economic significance in some parts of the world. In Australia, it was responsible for more than one third of all condemnations before slaughter (Hawkins et al., 1981). In Merinos, 12% of tumors have been observed to metastasize, mainly to the lung but also to the regional lymph node (Ladds and Entwistle, 1977; Lloyd, 1961). SCC poses a direct threat to sheep, especially to those highly selected for milk production, such as Sarda breed sheep, by compromising the udders of ewes. Although it was demonstrated
that papillomaviruses play an important role in the development of cervix cancer (zur Hausen, 2009), the association of papillomaviruses with tumors has been poorly investigated in sheep. The two sheep papillomavirus OaPV1 and OaPV2 identified to date belong to Delta papillomavirus, and were isolated from healthy sheep. Papillomaviruses of the Delta genus share a fibroblast cellular tropism, and lack the canonical pRB-binding domain in the E7 ORF, features related to the development of fibropapillomas (Narechania et al., 2004). For these reasons, OaPV1 and OaPV2 are poor candidates for a potential role in the development of SCC, which is a tumor of epithelial origin. On the other hand, epitheliotropic papillomaviruses have been isolated from cases of SCC in species other than sheep. In this study, we selected 4 cases of well differentiated SCC in sheep, and investigated them for the presence of papillomaviruses. First, we established the absence of OaPV1 and OaPV2 in the 4 tumors, by applying PCR tests designed to amplify the L1, E6, and E5 of these viruses (data not shown). Subsequently, we applied RCA combined to restriction analyses with a panel of endonucleases and we obtained an
356
A. Alberti et al. / Virology 407 (2010) 352–359
Fig. 4. Typical fields obtained when probing SCCs with the E6/L1 digoxigenated probes by in situ hybridization (left column). Top, middle: cordons of epithelial cells invading the derma with nuclei positive to OaPV3. Bottom: keratin pearl in detail: OaPV3-positive nuclei of squamous cells. Right column: positive cytoplasmic immunoreactivity of epithelial cells to anti-pan-cytokeratin. Same fields of in-situ hybridization.
invariant pattern, consistent with the size of a papillomavirus genome, from 2 of the 4 SCCs (Fig. 1A). This pattern differed from the one calculated in silico for OaPV1 and OaPV2 (Table S2). The genome of this novel Papillomavirus, which we named OaPV3, was successfully cloned and fully sequenced. Unlike the Delta papillomaviruses OaPV1 and OaPV2, OaPV3 lacks an E5 gene and maintains the conserved retinoblastoma tumor suppressor binding sequence motif in E7. For these reasons, the OaPV3 genome does not meet the criteria for fibroblasts infection and fibropapilloma development typical of Arctiodactyl papillomaviruses, while its genes repertoire is reminiscent of the epitheliotropic human papillomavirus of the Beta genus. Indeed, in-situ hybridization experiments conducted in tumors confirmed that OaPV3 infects exclusively epithelial cells, arranged either in solid cords or nests forming often epithelial “pearls” in the derma (Fig. 4). Pairwise alignments of OaPV3 to selected Papilloma viruses (Table 1) demonstrate that the OaPV3 sequence shares only a low degree of similarity with other PVs. In particular, OaPV3 shares less than 60% nucleotide sequence identity in the L1 ORF with any other papillomavirus. This result, considered together with the OaPV3 peculiar cell tropism, places this virus in a new genus (tentatively Dyokappa), according to the criteria needed to declare detection of a novel genus among the papillomaviruses (Bernard et al., 2010). Phylogenetic analyses based on a concatenated E1/E2/L2/L1 nucleotide sequence alignment of OaPV3 with 70 PV-types of the different
PV genera and species (Fig. 3) confirmed OaPV3 as a novel close-toroot papillomavirus weakly related to the Nu and Sigma genera.. Notably, papillomaviruses representative of the Nu and Sigma genera were isolated from some skin carcinomas and premalignant keratoses of human patients and from hyperplastic papillomatous regions of a North American porcupine, respectively. Moreover, OaPV3 is actively transcribed in tumors (Fig. 1D, E). However, the previously described OaPV1 and OaPV2 were isolated only from sheep benign neoplasms such as fibropapillomas. OaPV3 was successfully amplified from DNA extracted from healthy skin of sheep belonging to geographically separated flocks (two of them with history of SCC), sampled in Sardinia (Italy). This demonstrates that OaPV3 does not represent a strain adapted to a single flock, but it is most likely a virus well represented in sheep of the Sarda breed. All skin samples generated constantly the same sequence (with only one point mutation in one sample), and this can be explained by considering that papillomaviruses are highly species specific and that the Sarda is a relatively primitive sheep breed highly selected for milk production. Therefore, a founder effect can be speculated to be acting not only on Sardinian sheep but also on their related papillomavirus genetic diversity. Our group recently used endogenous integrated retroviruses (retrotypes) to investigate sheep domestication events (Chessa et al., 2009), and demonstrated that sheep differentiated on the basis of their “retrotype” and dispersed across Eurasia and Africa via separate migratory episodes. It would be
A. Alberti et al. / Virology 407 (2010) 352–359
interesting to investigate more deeply sheep papillomavirus diversity in order to assess its applicability to studies on host phylogeny and phylogeography. Concluding, it can be stated that OaPV3 is a new papillomavirus with epithelial tropism, which is transcriptionally active in ovine SCCs and is potentially related to tumor development, similarly to what has been suggested for Beta papillomavirus and human SCC. Conclusions This paper represents a first step towards the understanding of oncogenic papillomavirus of sheep. The elucidation of OaPV3 oncogenic properties is hampered by the lack of diagnostic and cellular biology tools, such as specific antibodies and a suitable cellular model for ovine SCC. Remarkable epidemiologic similarities of this condition have been observed to exist in sheep and humans living in the same tropical environment (Ladds and Daniels, 1982). Likewise, the pathological features of hyperkeratoses in sheep resemble solar keratoses in man, and the same applies to more advanced lesions in these species. Therefore, further studies are welcomed to clarify the role of OaPV3 in precancerous skin lesions and in tumor progression, and to establish a suitable animal model for human SCC. Materials and methods Origin of the samples Biopsies were obtained from 4 sheep reared in 4 geographically separated flocks (A, B, C, D) located in Sardinia (Italy), and showing lesions macroscopically indicative of SCC. Full-thickness biopsies of each type of lesion and adjacent normal skin were taken. One set of biopsies was fixed in 10% neutral-buffered formalin, embedded in paraffin, and sectioned to 4–6 mm slices. Adjacent slices were mounted onto glass slides and alternatively stained with haematoxylin and eosin (H&E) for light microscopy, or used for in situ hybridization (ISH) experiments. A second set of tissues was kept at −80 °C until nucleic acids extraction. Skin samples of the same locations were also collected from healthy sheep (n = 40) of flocks C and D, and of flocks E and F (2 distinct flocks located in Sardinia where sheep papillomatosis was observed but SCC was never recorded). Ten sheep were sampled from each flock. Skin samples were obtained by scraping healthy sheep skin with a cover glass slide several times. The cover glass slides where then saved in a 50-ml falcon tube and stored at −20 °C until DNA extraction. Nucleic acids extraction and multiply primed rolling-circle amplification DNA was extracted from tumors (20 mg) using the DNeasy blood and tissue kit (Qiagen. Jesi, Italy), following vendor recommendations for tissue samples. The same procedure was used for extracting DNA from the 40 skin samples obtained from healthy sheep. RNA was extracted from tumors previously disrupted with a tissuelyser (Tissuelyser II; Qiagen, Iesi, Italy), by using the MagMax™ viral RNA isolation kit and a MagMax Express automatic nucleic acid extractor (Applied Biosystem, Monza. Italy), or alternatively the RNeasy micro kit (Qiagen, Jesi, Italy). Sheep liver tissue samples were coupled to each of the tumor and skin samples during nucleic acids extractions, as a negative control. Rolling Circle Amplification (RCA) (GE Healthcare, Milano, Italy) combined with restriction enzyme analyses were used in order to establish the presence of papillomavirus genomes in tumors. RCA was performed using the TempliPhi 100 Amplification kit (GE Healthcare, Milano, Italy), following protocols recently optimized for amplification of papillomaviral complete genomes (Rector et al., 2004; Van Doorslaer et al., 2006). Shortly, 5 μl of tumor DNA extraction were mixed with 10 μl of TempliPhi sample buffer and subsequently heated for 3 min at 95 °C, then
357
transferred into an ice-bucket. Ten microliters of TempliPhi reaction buffer containing salts and deoxynucleotides (dNTPs), 0.4 μl of TempliPhi enzyme mix containing the phi 29 DNA polymerase and random hexamers in 50% glycerol, and 450 mM of extra dNTPs per sample were mixed and added to the cooled samples, and the reactions were subsequently incubated overnight (approximately 20 h) at 30 °C. Eventually, the phi 29 DNA polymerase was inactivated at 65 °C for 10 min. After digestion with a restriction enzyme panel (Table S2), the products were run on a 0.8% agarose gel to check for the presence of a DNA band consistent with full-length papillomaviral genomes, or multiple bands with sizes adding up to this length. OaPV3 genome cloning, sequencing, sequence alignments, and phylogenetic analyses A 7.4-kb DNA fragment obtained by digesting RCA products with SacI was cloned into pUC19 (Invitrogen, Milano, Italy) to generate pUC19/OaPV3. Briefly, 10 μl of the RCA product were digested with 100 units of SacI overnight and run on a 0.8% agarose gel, after which the fragment was extracted by using the QIAquick Gel Extraction Kit (Qiagen, Jesi, Italy). The fragment was then ligated into the pUC19 vector that was previously cut with SacI and dephosphorylated, by using the Rapid DNA Dephos & Ligation Kit (Roche, Milano, Italy). Ligation product was used to transform One Shot MAX Efficiency DH5Alpha™-T1R competent cells (Invitrogen, Milano, Italy). Bacteria were incubated for blue-white colony screening on agar plates containing X-gal, and white colonies were checked by SacI digestion of miniprep DNA. One clone containing the 7.4 kb DNA fragment was selected. The complete genome of the Ovis aries Papillomavirus type 3 (OaPV3) was determined by primer-walking sequencing of the cloned DNA fragment, starting from the universal primers sites in the multiple cloning site of pUC19. Sequencing was performed on an ABI Prism 3100 Genetic Analyzer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA). Electropherograms were inspected and edited with Chromas 2.2 (Technelysium, Helensvale, Australia), and contigs were prepared using SeqMan II (DNASTAR, Madison, WI, USA). Two primers (OaPV3/F 5' GACACGTATATGCGGAATGC 3', OaPV3/R 5' GCTAACAGAATCAACAGGAG 3') surrounding the SacI site were designed based on the OaPV3 sequence available at that point of the study. Primers OaPV3/F and OaPV3/R were used to exclude the presence of two or more adjacent SacI sites in the OaPV3 genome, potentially generating small DNA fragments not detectable in agarose gel electrophoresis after digestion of the RCA product, and therefore hampering the full length cloning of OaPV3 genome. This was done by amplifying 892 base pairs from both a tumor DNA extraction and from an undigested RCA product obtained from the same DNA sample. Amplicons were routinely cloned into pCDNA3.1 using the topoTA cloning kit (Invitrogen, Milano, Italy) following vendor recommendation. For each of the two amplicons, three clones were selected after transformation of E. coli DH5 alpha and sequenced for comparison. The nucleotide sequence of the OaPV3 genome was deposited in GenBank by using the National Center for Biotechnology Information (NCBI, Bethesda, MD) BankIt v3.0 submission tool (http://www3. ncbi.nlm.nih.gov/BankIt/) under accession number FJ796965. Prediction of open reading frames (ORFs) was performed using the ORF Finder tool on the NCBI server of the National Institutes of Health (http://www.ncbi.nlm.nih.gov/gorf.html). The molecular weight of the putative proteins was calculated using the ExPASy (Expert Protein Analysis System) Compute pI/Mw tool (http://www.expasy.org/ tools/pi_tool.html). Pairwise sequence alignments and sequences similarities were calculated using the ClustalW (Thompson et al., 1994) and the identity matrix options of Bioedit (Hall, 1999), respectively. For multiple nucleotide sequence alignments, the sequences of OaPV3 and 70 other PVs were imported in DAMBE version 4.2.7 (Xia and Xie, 2001), aligned at the amino acid level using ClustalW, after which the nucleotide sequences were aligned
358
A. Alberti et al. / Virology 407 (2010) 352–359
according to the aligned amino acid sequences. Also, alternative alignments were generated by omitting the third codon positions. This was done separately for the different ORFs, and the unambiguously alignable parts of the E1, E2, L2, and L1 ORFs were pasted together in one compiled alignment. Genetic distances among the operational taxonomic units (OTUs) were computed as percent of total nucleotide differences or by the Kimura 2-parameters method using MEGA version 2.1 (Kumar et al., 2001), and were used to construct neighbor-joining (NJ) trees (Saitou and Nei, 1987). Statistical support for internal branches of the trees was evaluated by bootstrapping (Felsenstein, 1985). Maximum parsimony (MP) trees and consensus values were generated using the same software. Trees were edited using NJplot (Perriere and Gouy, 1996) and Treeview v. 1.5.2 (Page, 1996). In situ hybridization and immunohistochemistry The PCR DIG Probe Synthesis Kit (Roche, Milano, Italy) was used to generate two digoxigenin-labeled probes by polymerase chain reaction. For each of the two probes a 50 μl reaction was set up by mixing 5 μl of PCR DIG Probe Synthesis Mix (containing 200 μM of each dNTP and 70 μM DIGdUTP) with 5 μl of 10× PCR buffer containing MgCl2, 0.75 μl of enzyme mix, 29.25 μl water, 5 μl (100 pg) of pUC19/OaPV3, and 10 μl of the appropriate primers mix. Digoxigenin labeled and unlabeled 151-bp-long E6 probes were generated by using primers OaPV3/E6F (5' AAGCCCTCGTACAATAGCTG 3') and OaPV3/E6R (5' GCCAAATCTCCAGAGTAAAGC 3'). Digoxigenin labeled and unlabeled 127-bp-long L1 probes were obtained with primers OaPV3/L1F (5' AACTGGACTTGTCTTCCATG 3') and OaPV3/L1R (5' AAAGACTCGGTATTGGGAGG 3'). PCR profiles were designed following the manufacturer's instructions for probe synthesis. Two unlabeled probes were generated by using the same protocol, without digoxigenin incorporation in the PCR mix. Both digoxigenin labeled and unlabeled probes were used (individually) for in situ hybridization (ISH) experiments. Briefly, paraffin embedded tissue sections mounted onto positively charged glass slides were incubated at 55 °C for 1 h, deparaffinized in changes of xylene, and rehydrated in decreasing concentrations of ethanol. The sections were placed in Tris-buffered saline (TBS) at 37 °C for 5 min, treated with pepsin, and rinsed in TBS. After rinsing in distilled water, sections were dehydrated in increasing concentrations of ethanol and air dried. Slides were treated with 200 μl of pre-hybridization solution (100 μl molecular grade Fluka hybridization solution II, 86 μl formamide, 14 μl mQ water) and incubated at 37 °C for 2 h in humidity chamber. After removing the Pre-hybridization solution, slides were covered with a cover glass, treated with 200 μl of hybridization solution (obtained by adding 5 μl of 40 ng/ml denatured molecular probe to 100 μl molecular grade Fluka hybridization solution II, 86 μl formamide, 9 μl mQ water), placed at 95 °C for 8 min, and then transferred in humidity chamber and incubated overnight. The following day the unhybridized probes were removed by washing tissue slides twice with TBS (5 min per wash) and then treated with decreasing concentrations of Sigma-Aldrich (Italy) molecular biology grade SSPE (5 minutes washes at 25 °C with 2×, 1×, 0.5× SSPE, 30 min wash at 50 °C with SSPE 0.1× and BSA 0.2%, 5 min wash at 25 °C with SSPE 0.1× and BSA 0.2%). Tissues slides were then washed for five minutes with buffer I (0.1 M Tris, 0.15 M NaCl; pH 7.6). Non-specific endogenous alkaline phosphatase was blocked with normal rabbit serum (NRS, Sigma-Aldrich, Italy) by incubating slides with 200 μl of blocking solution (20 μl NRS, 3.1 μl of 0.3% Triton X100; 980 μl buffer I) in humidity chamber at room temperature for 45 min. For detection of the digoxigenin-labeled hybrids, slides were incubated for 2 h with 1:25 diluted anti-digoxigenin-AP Fab fragments (Sigma-Aldrich, Italy) at room temperature. Slides were rinsed twice and incubated for 50 min at 37 °C in the dark with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitro blue tetrazolium chloride (NBT). Color
development was stopped with TE buffer (pH 8.0). Slides were mounted with Top-Water mount (W. Pabisch SpA, Italy), and photographed with a light microscope. After ISH, slides were submitted to immunohistochemistry and incubated with anti-pancytokeratin antibodies (anti-human pan cytokeratin AE1/AE3, Dako, Denmark) diluted 1:300. Sections were treated with preformed streptavidin biotin complex, and diamino-benzidine chromogen (DAB, LAB Probe Kit, Biomeda Corporation, CA), following the vendor recommendations. Slides were then washed in PBS, dehydrated through dH2O and graded alcohols, cleared with xylene, and mounted using Eukitt (Bio Optica Milano SpA, Italy) mounting media. Detection of OaPV3 DNA in healthy sheep skin samples Primers OVPV3/L1F and OVPV3/L1R, targeting 127 bp of the OAPV3 L1 gene, were designed to and used to detect specific OaPV3 DNA in 40 sheep skin DNA extractions. Briefly, 5 μl of skin DNA extractions (100 ng) were used in a typical PCR reaction, containing 200 μM dNTPs, 1 μM primers, and 1.25 U of GoTAQ (Promega, Milano, Italy). PCR profile and mix were designed according to the manufacturer's instructions for GoTAQ. Skin DNA samples were run in triplicate and coupled with the sheep liver DNA samples used as negative controls for extractions. PCR was repeated three times. Amplicons were routinely cloned into pCR2.1TOPO (Invitrogen, Milano, Italy) and automatically sequenced. Detection of OaPV3 early transcripts in ovine SCC Complementary DNA was obtained from 2 ovine SCCs and from liver RNA extractions by using the SuperScript® First-Strand Synthesis System for RT-PCR, following the vendor instructions (Invitrogen, Milano, Italy). Either random hexamers, primer OaPV3/ E6/START: 5' ATGGAGGGAAGCCCTCGTAC 3', and primer OaPV3/E7/ START: 5' ATGCGTGGTCAGCAGCCCAC 3', were separately used to prime first-strand synthesis. The presence of early transcripts in tumors was investigated by using the cDNAs obtained as templates for two distinct PCR assays, based on the use of primers pairs (OaPV3/E6/ START: 5' ATGGAGGGAAGCCCTCGTAC 3' and OaPV3/E6/STOP: 5' TCAGGGAGTGTGGGCTGCTG 3' for E6; OaPV3/E7/START: 5' ATGCGTGGTCAGCAGCCCAC 3' and OaPV3/E7/STOP: 5' CTATGCAGCACACGGCGGAC 3' for E7). PCR profiles and mixes were set up according to manufacturer's recommendations for the polymerase used (GoTAQ Promega, Italy). As an additional control, aliquots of DNase-treated RNA extractions were subjected to PCR in order to rule out the presence of residual DNA in samples. PCRs were repeated 3 times starting from 3 replicates of independently-obtained cDNA batches. PCR products were routinely cloned and sequenced. Acknowledgments This work was supported by funding from Grant Ricerca sanitaria 2006, UPB S 12 025cap. 12012, and Misura P5 Biodiversitá animale (Regione Sardegna). Appendix A. Supplementary data Supplementary data to this article can be found online at doi:10.1016/j.virol.2010.08.034. References Bernard, H.U., Burk, R.D., Chen, Z., van Doorslaer, K., zur Hausen, H., de Villiers, E.M., 2010. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 401 (1), 70–79. Borzacchiello, G., Iovane, G., Marcante, M.L., Poggiali, F., Roperto, F., Roperto, S., Venuti, A., 2003. Presence of bovine papillomavirus type 2 DNA and expression of the viral oncoprotein E5 in naturally occurring urinary bladder tumours in cows. J. Gen. Virol. 84 (11), 2921–2926.
A. Alberti et al. / Virology 407 (2010) 352–359 Campo, M.S., 2002. Animal models of papillomavirus pathogenesis. Virus Res. 89 (2), 249–261. Chambers, G., Ellsmore, V.A., O'Brien, P.M., Reid, S.W., Love, S., Campo, M.S., Nasir, L., 2003. Association of bovine papillomavirus with the equine sarcoid. J. Gen. Virol. 84 (5), 1055–1062. Chessa, B., Pereira, F., Arnaud, F., Amorim, A., Goyache, F., Mainland, I., Kao, R.R., Pemberton, J.M., Beraldi, D., Stear, M.J., Alberti, A., Pittau, M., Iannuzzi, L., Banabazi, M.H., Kazwala, R.R., Zhang, Y.P., Arranz, J.J., Ali, B.A., Wang, Z., Uzun, M., Dione, M.M., Olsaker, I., Holm, L.E., Saarma, U., Ahmad, S., Marzanov, N., Eythorsdottir, E., Holland, M.J., Ajmone-Marsan, P., Bruford, M.W., Kantanen, J., Spencer, T.E., Palmarini, M., 2009. Revealing the history of sheep domestication using retrovirus integrations. Science 24 (5926), 532–536. de Villiers, E.M., Fauquet, C., Broker, T.R., Bernard, H.U., zur Hausen, H., 2004. Classification of papillomaviruses. Virology 324 (1), 17–27. Dean, F.B., Nelson, J.R., Giesler, T.L., Lasken, R.S., 2001. Rapid amplification of plasmid and phage DNA using Phi 29 DNA polymerase and multiply-primed rolling circle amplification. Genome Res. 11 (6), 1095–1099. Del Fava, C., Verissimo, C.J., Rodrigues, C.F.C., Cunha, E.A., Ueda, M., Maiorka, P.C., D´ Angelino, J.L., 2001. Occurrence of squamous cell carcinoma in sheep from a farm in São Paulo state, Brazil. Arq. Inst. Biol. 68 (1), 35–40. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39 (4), 783–791. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98. Hawkins, C.D., Swan, R.A., Chapman, H.M., 1981. The epidemiology of squamous cell carcinoma of the perineal region of sheep. Aust. Vet. J. 57 (10), 455–457. Kim, T., Park, J.C., Roh, M.R., Park, J.M., Cho, N.H., Lee, M.G., 2010. Development of aggressive squamous cell carcinoma in epidermodysplasia verruciformis associated with human papillomavirus type 22b. Dermatology10.1159/000290759 Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: Molecular Evolutionary Genetics Analysis Software. Bioinformatics 17, 1244–1245. Ladds, P.W., Daniels, P.W., 1982. Animal model of human disease. Squamous cell carcinoma. Ovine squamous cell carcinoma. Am. J. Pathol. 107 (1), 122–123. Ladds, P.W., Entwistle, K.W., 1977. Observations on squamous cell carcinoma of sheep in Queensland, Australia. Br. J. Cancer 35 (1), 110–114. Lagadic, M., Wyers, M., Mialot, J.P., Parodi, A.L., 1982. Enzootic vulvar cancer in sheep. Zentralbl. Veterinärmed. A 29 (2), 123–135. Lloyd, L.C., 1961. Epithelial tumours of the skin of sheep. Br. J. Cancer 15 (4), 780–789. Ma, T., Zou, N., Lin, B.Y., Chow, L.T., Harper, J.W., 1999. Interaction between cyclindependent kinases and human papillomavirus replication–initiation protein E1 is required for efficient viral replication. Proc. Natl Acad. Sci. USA 96 (2), 382–387. Méndez, A., Pérez, J., Ruiz-Villamor, E., García, R., Martín, M.P., Mozos, E., 1997. Clinicopathological study of an outbreak of squamous cell carcinoma in sheep. Vet. Rec. 141 (23), 597–600. Munday, J.S., Howe, L., French, A., Squires, R.A., Sugiarto, H., 2009. Detection of papillomaviral DNA sequences in a feline oral squamous cell carcinoma. Res. Vet. Sci. 86 (2), 359–361. Narechania, A., Terai, M., Chen, C.Z., DeSalle, R., Burk, R.D., 2004. Lack of the canonical pRB-binding domain in the E7 ORF of artiodactyl papillomaviruses is associated with the development of fibropapillomas. J. Gen. Virol. 85 (5), 1243–1250. Nasir, L., Campo, M.S., 2008. Bovine papillomaviruses: their role in the aetiology of cutaneous tumours of bovids and equids. Vet. Dermatol. 19 (5), 243–254.
.
359
Nelson, J.R., Cai, Y.C., Giesler, T.L., Farchaus, J.W., Sundaram, S.T., Ortiz-Rivera, M., Hosta, L.P., Hewitt, P.L., Mamone, J.A., Palaniappan, C., Fuller, C.W., 2002. TempliPhi, phi29 DNA polymerase based rolling circle amplification of templates for DNA sequencing. Biotechniques 44–47 Jun;Suppl. Nuovo, G.J., Ishag, M., 2000. The histologic spectrum of epidermodysplasia verruciformis. Am. J. Surg. Pathol. 24 (10), 1400–1406. Page, R.D.M., 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12 (4), 357–358. Perriere, G., Gouy, M., 1996. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 78 (5), 364–369. Ramadan, R.O., Gameel, A.A., el Hassan, A.M., 1991. Squamous cell carcinoma in sheep in Saudi Arabia. Rev. Élev. Méd. Vét. Pays Trop. 44, 23–26. Rector, A., Bossart, G.D., Ghim, S.J., Sundberg, J.P., Jenson, A.B., Van Ranst, M., 2004. Characterization of a novel close-to-root papillomavirus from a Florida manatee by using multiply primed rolling-circle amplification: Trichechus manatus latirostris papillomavirus type 1. J. Virol. 78 (22), 12698–12702. Rector, A., Tachezy, R., Van Doorslaer, K., MacNamara, T., Burk, R.D., Sundberg, J.P., Van Ranst, M., 2005. Isolation and cloning of a papillomavirus from a North American porcupine by using multiply primed rolling-circle amplification: the Erethizon dorsatum papillomavirus type 1. Virology 331 (2), 449–456. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425. Swan, R.A., Chapman, H.M., Hawkins, C.D., Howell, J.M., Spalding, V.T., 1984. The epidemiology of squamous cell carcinoma of the perineal region of sheep: abattoir and flock studies. Aust. Vet. J. 61 (5), 146–151. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22 (22), 4673–4680. Tilbrook, P.A., Sterrett, G., Kulski, J.K., 1992. Detection of papillomaviral-like DNA sequences in premalignant and malignant perineal lesions of sheep. Vet. Microbiol. 31 (4), 327–341. Trenfield, K., Spradbrow, P.B., Vanselow, B.A., 1990. Detection of papillomavirus DNA in precancerous lesions of the ears of sheep. Vet. Microbiol. 25 (2–3), 103–116. Tustin, R.C., Thornton, D.J., McNaughton, H., 1982. High incidence of squamous cell carcinoma of the vulva in Merino ewes on a South African farm. J. S. Afr. Vet. Assoc. 53 (3), 141–143. Van Doorslaer, K., Rector, A., Vos, P., Van Ranst, M., 2006. Genetic characterization of the Capra hircus papillomavirus: a novel close-to-root artiodactyl papillomavirus. Virus Res. 118 (1–2), 164–169. Van Ranst, M., Kaplan, J.B., Burk, R.D., 1992. Phylogenetic classification of human papillomaviruses: correlation with clinical manifestations. J. Gen. Virol. 73, 2653–2660. Vanselow, A., Spradbrow, P.B., 1983. Squamous cell carcinoma of the vulva, hyperkeratosis and papillomaviruses in a ewe. Aust. Vet. J. 60 (6), 194–195. Xia, X., Xie, Z., 2001. DAMBE: data analysis in molecular biology and evolution. J. Hered. 92 (4), 371–373. Yuan, H., Ghim, S., Newsome, J., Apolinario, T., Olcese, V., Martin, M., Delius, H., Felsburg, P., Jenson, B., Schlegel, R., 2007. An epidermotropic canine papillomavirus with malignant potential contains an E5 gene and establishes a unique genus. Virology 359 (1), 28–36. zur Hausen, H., 2009. Papillomaviruses in the causation of human cancers—a brief historical account. Virology 384 (2), 260–265. zur Hausen, H., de Villiers, E.M., 1994. Human papillomaviruses. Annu. Rev. Microbiol. 48, 427–447.