- Email: [email protected]
PDGFBB-modified stem cells from apical papilla and thermosensitive hydrogel scaffolds induced bone regeneration
Chemico-Biological Interactions 316 (2020) 108931
Contents lists available at ScienceDirect
Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint
PDGFBB-modified stem cells from apical papilla and thermosensitive hydrogel scaffolds induced bone regeneration
T
Jiajia Denga,b,1, Jie Pana,b,1, Xinxin Hanb, Liming Yua,b, Jing Chena,b, Weihua Zhanga,b, Luying Zhuc, Wei Huangb, Shangfeng Liub, Zhengwei Youd, Yuehua Liua,b,∗ a
Department of Orthodontics, Shanghai Stomatological Hospital, Fudan University, Shanghai, 200001, PR China Oral Biomedical Engineering Laboratory, Shanghai Stomatological Hospital, Fudan University, Shanghai, 200001, PR China c Xiangya School of Stomatology, Xiangya Stomatology Hospital, Central South University, Changsha, China d State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Shanghai Belt and Road Joint Laboratory of Advanced Fiber and Low-dimension Materials, Donghua University, Shanghai, 201620, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Hydrogel Bone defect repair SCAPs
Bone defects caused by cancer surgery or trauma have a strong negative impact on human health. Treatment with cell and material-based complexes provides an alternative strategy for the regeneration of damaged bone tissue. The good physical properties and suitable biodegradability of a thermosensitive hydrogel has been shown to act as a valuable scaffold. Platelet derived growth factor BB (PDGFBB) is mainly secreted by platelets and promotes the migration and angiogenesis of mesenchymal stem cells (MSCs). Although PDGFBB is known to indirectly enhance bone repair in vivo, the effects of PDGFBB on stem cells from apical papilla (SCAPs) require further investigation. In our study, the proliferation of cells was investigated by the cell counting kit-8 and live/ dead staining methods. The results indicated that PDGFBB promoted the proliferation of SCAPs. Real-time polymerase chain reaction and Western blot experiments were used to detect osteogenic genes and proteins. Moreover, calvarial defects were created in Sprague-Dawley rats and different complexes implanted. The results shown by micro-CT and hematoxylin and eosin analysis demonstrated that the hydrogel combined with lentiviral supernatant-green fluorescent protein-PDGFBB significantly improved new bone formation and mineralization compared with the other three groups. In summary, our research showed that a thermosensitive hydrogel can be used as a scaffold for 3D cell culture, and PDGFBB gene-modified SCAPs can improve bone formation in calvarial defects.
1. Introduction Bone defects caused by cancer surgery, trauma or other diseases are strongly associated with functional disorders [1]. Bone autografts are widely used for the surgical reconstruction of damaged bone tissue. However, autografts have certain limitations in terms of availability and volume, and are difficult to form into complex shapes [2,3]. Treatment with cell and material-based complexes provides an alternative strategy for the regeneration of damaged bone tissue. Although many studies have demonstrated that SCAPs represent early progenitor/stem cells with strong proliferative and osteoblast differentiation potential in vitro, the role of SCAPs in osteogenic differentiation in vivo requires further study [4,5]. Thermosensitive hydrogel is synthesized using natural polymers and
mimics [6,7]. Moreover, these polymers exhibit high biocompatibility and physical properties, and thus have potential in biomedical applications [8]. When combined with MSCs, hydrogel-based tissue engineering strategies have obvious advantages for the repair of various sized bone defects as the hydrogel can be molded into a variety of irregular shapes. In addition, delivery of gel-encapsulated cells via injection is a minimally invasive procedure, and the risk of wound infection is minimized. Thus, cells combined with a hydrogel scaffold have become a promising strategy in regenerative medicine. Many studies have suggested that growth factors can promote MSC self-renewal in vitro [9]. The platelet derived growth factor (PDGF) family includes AA, BB, AB, CC, and DD, which bind to their receptors (PDGFR-α and PDGFR-β) [10,11]. In addition, lentiviral vectors are extensively used to infect MSCs as they transfect cells effectively
∗
Corresponding author. Oral Biomedical Engineering Laboratory, Shanghai Stomatological Hospital, Fudan University, 2 Tianjing Road, Shanghai, 200001, China. E-mail address: [email protected] (Y. Liu). 1 These two authors contributed equally to this work. https://doi.org/10.1016/j.cbi.2019.108931 Received 5 August 2019; Received in revised form 30 November 2019; Accepted 17 December 2019 Available online 23 December 2019 0009-2797/ © 2019 Elsevier B.V. All rights reserved.
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Table 1 The sequences of primers used for PCR amplification. Gene
Forward primer (5′→ 3′)
Reverse primer(5′→ 3′)
OPN OCN PDGFBB OSX COL-1 VEGF GAPDH
CTCCATTGACTCGAACGACTC GGATGACCCCCAAATAGCCC ATAGACCGCACCAACGCCAACTTC CCTCTGCGGGACTCAACAAC GAGGGCCAAGACGAAGACATC AGGGCAGAATCATCACGAAGT CATCAAGAAGGTGGTGAAGCAGG
CAGGTCTGCGAAACTTCTTAGAT GCTTGGACACAAAGGCTGC TCCGCACAATCTCGATCTTTCTCA AGCCCATTAGTGCTTGTAAAGG CAGATCACGTCATCGCACAAC AGGGTCTCGATTGGATGGCA AAAGGTGGAGGAGTGGGTGTC
Fig. 1. Schematic of the study. Thermosensitive hydrogel was fabricated and subsequently PDGFBB gene-modified SCAPs seeded onto the hydrogel. The effect of PDGFBB on osteogenic differentiation of SCAPs was studied in vitro and in vivo.
2.2. Lentivirus transfection
[12,13]. It is crucial to improve the activity of seed cells in tissue engineering research. Therefore, in this research, we constructed PFGFBB genemodified SCAPs using lentiviral vectors and assessed the effects of PDGFBB on SCAPs viability and osteogenic differentiation capacity in vitro. Hydrogel loaded cell complexes were then constructed and implanted in rat calvarial defects.
SCAPs were grown on 6-well plates at an initial density of 1 × 105 cells/well. After 1 day, the SCAPs were transfected with PDGFBB lentiviral supernatant (Lentiv-green fluorescent protein (GFP)PDGFBB group). SCAPs infected with GFP lentiviral supernatant (Lentiv-GFP group) were included as the negative control group. In addition, a non-infected group was included as the blank control. The transfection complex was replaced by complete growing media 24 hpost transfection and thereafter sub-cultured for further experiments. Real-time polymerase chain reaction (PCR) and immunofluorescence analysis were performed after transfection in order to examine PDGFBB gene and protein expression. After transfection, SCAPs were fixed and incubated with osteopontin (OPN) and collagen type I (COL-I) antibody to analysis the osteogenic proteins of SCAPs.
2. Materials and methods 2.1. SCAPs culture The steps for SCAPs culture were according to previously reported methods [14,15]. Human immature impacted third molars were collected (16–18 years) from Shanghai Stomatological Hospital. The experiment was supported by the Ethical Review Committee of Shanghai Stomatological Hospital. Freshly extracted teeth were preserved in phosphate-buffered saline (PBS). Root apical papilla from the molars were gently scraped and placed in a culture dish at 37 °C in a 5% CO2 atmosphere. The culture medium consisted of 10% fetal bovine serum (FBS), minimum essential medium-alpha (α-MEM), and 1% penicillin/ streptomycin. The colony-forming cells were harvested for further experiments.
2.3. Cell proliferation assays The proliferation of cells was examined using cell counting kit-8 (CCK-8, Dojindo, Japan) [16]. The cells were cultured in 96-well plates, respectively, and were incubated with CCK‐8 reagent for 7 consecutive days, and then the absorbance of the solution was measured by a microplate reader (Epoch2, Biotek, USA) at 450 nm. 2
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 2. (A–B) The transfection efficiency and expression of PDGFBB protein were observed using inverted fluorescence microscopy. (C) Real-time PCR analysis of PDGFBB gene expression. (D) Immunofluorescence staining showed the expression of PDGFBB protein. (E) The results of the CCK-8 assay showed that PDGFBB promoted the proliferation of SCAPs. *P ≤ 0.05. **P ≤ 0.01. ***P ≤ 0.001.
secondary antibody (1: 10000) for 1 h, and then target bands were viewed using Western ECL Substrate.
2.4. Alizarin red staining in vitro SCAPs were seeded on 6-well plates, osteogenic induction began when the cells reached 80% confluence. The osteogenic medium contained α-MEM (Sigma-Aldrich), 10% FBS, 10 mmol/L β-glycerophosphate (Sigma-Aldrich), 50 mg/L ascorbic acid (Sigma-Aldrich) and 0.1 μmol/L dexamethasone (Sigma-Aldrich). Following 21 days of induction, the cells were stained with Alizarin Red S solution for 15–30 min.
2.7. Synthesis and analysis of the properties of PLGA–PEG–PLGA triblock copolymers Thermosensitive hydrogel was prepared by ring-opening polymerization. An amount of D, L-lactide (LA), Glycolide (GA), and poly (ethylene glycol) (PEG) (LA: GA: PEG = 15 : 5: 8) (Sigma) was weighed and mixed in an airtight reaction bottle. The container was placed in a vacuum at 120 °C for 30 min, and stannous caprylate (0.2% w/w, Sigma) was added as the catalyst and subsequently, heated to 170 °C for 8 h and then placed in a vacuum for 30 min to remove the unreacted monomer. The product was dissolved in water and then heated to 80 °C to precipitate, this procedure was repeated and the copolymer was obtained. Before the experiment, the copolymer was dissolved in 10% PBS and stored at 4 °C. The temperature of hydrogel transition was measured by the tube inversion method. Dynamic rheological analysis was carried out on 20 wt% copolymer with a strain amplitude of 1%, an angular frequency of 1 rad/s and a heating rate of 0.5 °C/min using an advanced rotatory rheological system (ARES-RFS, TA, USA). The energy storage modulus G'and loss modulus G″of the polymer at different temperatures were obtained.
2.5. Real-time PCR The expression levels of osteogenic genes, including OPN, Osterix (OSX), COL-1, and angiogenic gene, vascular endothelial growth factor (VEGF) were measured on days 7, 14, and 21 after osteogenic induction. Total RNA was isolated using Trizol Reagent. 1 μL RNA was used to synthesize complementary DNA. Real-time PCR was conducted with SYBR GREEN Mix. The specific primer sequences are listed in Table 1. The RNA expression levels of these genes were quantified by the2−ΔΔCt formula. 2.6. Western blot Total proteins were isolated using 2 × SDS loading buffer supplemented with proteinase inhibitor. The proteins were then denatured at 96 °C and 30 μL of proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. The PVDF membranes were blocked with 5% dehydrated milk for 45 min under agitation and then incubated with primary antibody, including OPN (ab8448, Abcam) (1:1000), OSX (ab22552, Abcam) (1:1000), COL-1 (ab34710, Abcam) (1:1000), VEGF (ab1316, Abcam) (1:1000), and GAPDH (1:10000). Subsequently, the membranes were immersed in the
2.8. Encapsulation of SCAPs and scanning electron microscopy (SEM) SCAPs were homogeneously resuspended in 100 μL of sterilized hydrogel at an initial density of 1 × 106 cells/mL. Thereafter, the hydrogel with the encapsulated SCAPs was placed in 37 °C and medium added. Cell proliferation was evaluated by the CCK-8 assay as described above. For SEM analysis, the encapsulated SCAPs were fixed overnight. All 3
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 3. Adhesion and proliferation of SCAPs cultured on hydrogel. (A) Molecular structure of PLGA–PEG–PLGA triblock copolymers. (B) The energy storage modulus G'and loss modulus G″of the polymer at different temperatures. (C) Gross appearance of the hydrogel at 20 °C and 37 °C. (D) SEM images of the hydrogel with SCAPs (white arrow). (E) Proliferation of SCAPs cultured in the hydrogel detected by the CCK-8 assay.
GFP-PDGFBB group, (2) Hydrogel mixed with Lentiv-GFP group, (3) Hydrogel only group, (4) Control group without treatment group. The surgical sites were sutured with 5–0 Vicryl suture and all animals received 80000 units of penicillin by intramuscular injection. The experimental procedure is presented in Fig. 1.
samples were then dehydrated through graded ethanol and analyzed by an ALTO 1000 scanning electron microscope (S–3400 N). 2.9. Cell viability in the hydrogels in vitro The attachment and spread of encapsulated SCAPs were assessed by the live/dead staining kit (Invitrogen). The composites were stained at 1, 3, 5, and 7 days after seeding, and submerged in the staining solution for 30 min. Viable cells stained green, whereas dead cells appeared red.
2.11. Micro-computed tomography (micro-CT) analysis At 4 and 8 weeks after surgery, the rats were sacrificed under anesthesia, and the specimens obtained were fixed with 4% paraformaldehyde (PFA). The calvarial defects were then scanned using a conical beam micro-CT scanner (energy 40 kV, current 250 μA, integration time 0.24 s, Sky-Scan 1076; Bruker micro-CT, Kontich, Belgium). Scanning was conducted with an isotropic voxel size of 18μm thick, and 3D reconstruction of the defect using NRecon v.1.6.9 software.
2.10. Animal models and surgical procedures In this study, twenty-four male Sprague-Dawley rats (8 weeks old) were housed in a specific-pathogen-free environment with a 12 h light/ dark cycle and free access to water and food. All experiments involving animals were conducted in accordance with the guidelines established by the Fudan University Animal Care and Use Committee. All rats were anesthetized by an intraperitoneal injection of 2% pentobarbital sodium (0.3 ml/100 g body weight). A trephine drill (5 mm) was used to create critical-sized full-thickness bone defects in the calvaria under saline perfusion [17–19]. All rats were randomly divided into the following 4 groups: (1) Hydrogel mixed with Lentiv-
2.12. Histological analysis Following micro-CT imaging, specimens of calvarial defects were decalcified in 10% ethylenediaminetetraacetic acid. The specimens were then dehydrated with graded ethanol, embedded in paraffin, and 4
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 4. (A and B) Alizarin Red staining and semi-quantitative calcium analysis. (C) Live/dead staining of SCAPs cultured in the hydrogel. (D) The images showed high cell viability of the encapsulated SCAPs. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
then sectioned at a thickness of 5 μm. A part of the section was stained using the hematoxylin and eosin (H&E) staining kit [20,21]. The expression of alkaline phosphatase (ALP) was detected via immunohistochemical (IHC) staining [22]. Samples were permeabilized with 0.25% Triton X-100 and blocked in 5% bovine serum albumin. The samples were subsequently incubated with primary antibody, then incubated with secondary antibodies conjugated to horse radish peroxidase (HRP) for 60 min. The samples were visualized by DAB staining. The stained sections were photographed under a fluorescent microscope.
an acceptable transfection level (Fig. 2B). Real‐time PCR showed that the PDGFBB mRNA levels were significantly upregulated compared with the control group at 3, 7, 14 and 21 days after transfection (P＜0.001) (Fig. 2C). Immunofluorescence staining (Fig. 2D) was performed to further validate the presence of PDGFBB proteins in SCAPs. These data suggested that the lentivirusmediated PDGFBB gene was successfully transfected into SCAPs and was stably expressed in SCAPs.
2.13. Statistical analysis All data were analyzed using PRISM 5 software. Significant differences between different groups were defined using one-way analysis of variance. Data are expressed as mean ± standard deviation. Values of P < 0.05 were considered statistically significant.
The effects of PDGFBB on SCAPs proliferation was investigated for seven consecutive days. As shown in Fig. 2, there were no obvious differences on the first two days after transfection (Fig. 2E). However, on the third day, the proliferation in the Lentiv-GFP-PDGFBB group was significantly increased compared with the other groups (P＜0.05), suggesting that PDGFBB can promote the proliferation of SCAPs.
3. Results
3.3. Properties of the thermosensitive hydrogel
3.1. Lentivirus transfection and expression of PDGFBB
The thermosensitive hydrogel was successfully prepared. Fig. 3A shows the molecular structure of the hydrogel. The temperature of thermosensitive hydrogel transition was measured by the tube inversion method. The results showed that the hydrogel transition temperature was 34.33 ± 0.57 °C. As shown in Fig. 3, the hydrogel changed from liquid to gel state rapidly at 37 °C (Fig. 3C). As the
3.2. PDGFBB promotes the proliferation of SCAPs
The results showed that SCAPs grew well in the Lentiv-GFP and Lentiv-GFP-PDGFBB groups. The multiplicity of infection (MOI) 80 group showed significant green fluorescence (Fig. 2A). Statistical analysis showed that the transfection efficiency exceeded 90% which was 5
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 5. PDGFBB overexpression enhanced the osteogenic differentiation of SCAPs. (A–D) Real-time PCR analysis of OPN, OSX, COL-1 and VEGF expression. (E) Immunofluorescence staining of OPN and COL-1 proteins. *P ≤ 0.05. **P ≤ 0.01. ***P ≤ 0.001.
3.4. Cell viability assay and SEM
temperature increased, the energy storage modulus G'and loss modulus G″increased sharply at approximately. 32 °C. The G″increased faster than the G'and the point of intersection was the hydrogel transition temperature which was approximately 33 °C (Fig. 3B). These results are consistent with the hydrogel transition temperature measured by the tube inversion method, and further demonstrated the temperature sensitivity of the hydrogel.
To examine the morphology of the SCAPs aggregates in the hydrogel, we observed and photographed the surface with SEM. As shown in Fig. 3, the SCAPs morphology was maintained, and aggregates adhered tightly to the hydrogel scaffold (Fig. 3D). In addition, live/dead staining was conducted to evaluate cell 6
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 6. Western blot analysis of OPN, OSX, COL-1, and VEGF proteins. *P ≤ 0.05. **P ≤ 0.01.
3.7. Micro-CT analysis
viability in the hydrogel. After 7 days, the samples were stained with ethidium homodimer-1 and calcein-AM solution. Fig. 4C–D shows that most of the stained cells were alive and green with only a few red dead cells. The CCK-8 assay also supported the above results (Fig. 3E). These findings indicated that the thermosensitive hydrogel was suitable for cell growth and had good biocompatibility.
The newly-formed tissues in the calvarial defects in the 4 groups were observed and characterized by micro-CT. Fig. 7 shows that there was limited new bone formation in the control group. New bone formation in the hydrogel groups was 31.02 ± 1.63% at 4 weeks and 37.15 ± 5.94% at 8 weeks, respectively. Furthermore, the hydrogel + Lentiv-GFP groups showed greater bone regeneration (41.73 ± 5.98% and 48.87 ± 3.35%) than the hydrogel group (Fig. 7A). The combination of hydrogel and Lentiv-GFP-PDGFBB had the greatest effect of new bone formation (48.85 ± 2.37% and 55.86 ± 1.89%) compared with the other groups (Fig. 7B). In summary, the combination treatment showed a greater positive effect on bone regeneration than either single treatment.
3.5. Alizarin red staining We further evaluated the osteogenic differentiation capacity in the 3 groups. At 21 days after osteogenic induction, a large amount of calcium deposition was observed which was stained red (Fig. 4A). However, the positive area in the Lentiv-GFP-PDGFBB group was substantially greater than that in the other 2 groups (P＜0.05) (Fig. 4B).
3.8. Histological analysis
3.6. PDGFBB induced OPN, OSX, COL-1 and VEGF expression in SCAPs
Eight weeks after surgery, limited new bone was observed in the control group (Fig. 7A–B). In contrast, the amount of new bone in the hydrogel group was greater. However, the hydrogel combined with Lentiv-GFP-PDGFBB group showed greater bone formation than the other groups (Fig. 7C). To further evaluate osteogenesis, we conducted an IHC analysis of ALP (Fig. 7D). IHC staining showed that the control group had the fewest ALP-positive regions, and the hydrogel combined with LentivGFP and Lentiv-GFP-PDGFBB groups had more ALP-positive areas. These results indicated that combination treatment with hydrogel and PDGFBB gene-modified SCAPs significantly enhanced bone formation in rat calvarial defects. In addition, this combination treatment may also play an important role in angiogenesis.
The expression levels of osteogenic genes were evaluated at 7, 14, and 21 days. The results showed that PDGFBB induced higher expression of OPN, OSX and COL-1, which reflected different periods of osteogenic differentiation (Fig. 5A–C). At day 7, the expression of OPN and OSX increased significantly and was consistently higher than that in the control group at day 14 (P＜0.05). Furthermore, the expression of COL-1 was significantly up-regulated at day 14 and 21 (P＜0.05). In addition, the expression of VEGF, which is involved in angiogenesis differentiation, was significantly increased in the Lentiv-GFP-PDGFBB group compared with the other groups (Fig. 5D). Similar results were obtained following immunofluorescence and western blot analysis (Figs. 5E and 6). These results showed that PDGFBB may be an important positive regulator of induced osteogenic and angiogenesis differentiation in SCAPs. 7
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 7. Micro-CT reconstruction and histological analysis. (A and B) Micro-CT reconstruction images and quantitative analysis of new bone formation (area of new bone formation/calvarial defect). (C) H&E staining of bone defect area. (D) IHC analysis shows the positive areas of ALP staining. *P ≤ 0.05. **P ≤ 0.01. ***P ≤ 0.001. NB: new bone. OB: old bone.
4. Discussion
PDGFBB gene was overexpressed by the lentivirus, we found that osteogenic markers of SCAPs such as OPN, OSX, and COL-1 were upregulated. Moreover, the expression of VEGF, which is related to angiogenesis, was also upregulated. These results demonstrated that PDGFBB may have a positive effect on the osteogenic differentiation of SCAPs. Although most previous studies have shown that SCAPs have strong osteogenic differentiation ability in vitro, further research is needed to determine osteogenic differentiation ability in vivo [32,33]. In recent studies, a thermosensitive hydrogel was designed with the extracellular matrix having various characteristics, such as guiding cell growth, migration, and differentiation. In addition, studies on the application of thermosensitive hydrogels in drug delivery and 3D cell culture have shown the excellent carrier properties of the hydrogels [34–36]. In order to study the growth of SCAPs in the hydrogel, we inoculated
Biological materials have been widely used in various fields of medicine [23–25]. These materials are important media for delivering seed cells and effective growth factors. A large number of studies have proved that lentiviral vectors are good tools for altering cells in order to repair bone defects [26–29]. Our research aimed to evaluate the effect of hydrogel combined with PDGFBB gene on osteoblastic differentiation of SCAPs in vitro and in vivo. In this study, we found that PDGFBB promoted the proliferation of SCAPs. Based on previous studies of recombinant human PDGFBB in bone marrow-derived mesenchymal stem cells (BMMSCs) and adiposederived stem cells (ADSCs), we hypothesized that PDGFBB gene plays a similar role in osteogenic differentiation of SCAPs [30,31]. When the 8
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Appendix A. Supplementary data
SCAPs into the thermosensitive hydrogel for 3D culture. Our research showed that SCAPs proliferated continuously for more than 7 days in the thermosensitive hydrogel. It can be seen from the SEM images that SCAPs were found in various forms in the hydrogel and were firmly adhered to the pores of the scaffold. In addition, the thermosensitive hydrogel can be shaped and injected into various types of bone defects. These results confirmed that the thermosensitive hydrogel is a good scaffold for 3D cell culture. To further evaluate the bone repair effect of PDGFBB in vivo, we constructed tissue-engineered bone combined with SCAPs, PDGFBB lentiviral vector, and the thermosensitive hydrogel to repair calvarial defects in rat. Rat models of skull defects have been widely used to study the bone repair capacity of scaffolds, cells, and genes [35,37]. Studies have shown that the optimal standard size for the establishment of a rat calvarial defect model is 5 mm in diameter [38]. Therefore, this study established bone defects 5 mm in diameter. It was found that new bone at the edge of the defects was limited and there was no significant difference in new bone at 4 and 8 weeks in the control group. We also found that the hydrogel scaffolds induced bone repair as the scaffold prevents early contraction of blood clots within the defect region and stimulates natural bone healing [38]. Interestingly, bone repair was significantly promoted after SCAPs inoculation in the hydrogel. However, there was no statistically significant difference between hydrogel + Lentiv-GFP and the hydrogel only groups at 8 weeks, which was different to that at 4 weeks. Eight weeks after surgery, micro-CT showed newer bone in the Lentiv-GFP-PDGFBB group than in the other groups. These data provide evidence that PDGFBB played a positive role in bone repair. Osteoprogenitor cells, frame materials, and growth factors are the three basic elements for bone tissue engineering. Dental stem cells have the advantages of easy harvest, rapid expansion and strong differentiation ability; thus, are promising osteoprogenitor cells for tissue regeneration [39–41]. In addition, seed cells, growth factors and scaffolds are key elements for constructing tissue engineered bone. However, our findings require further validation including the role of signaling pathways and studies should be carried out in larger animals. Further understanding of SCAPs, hydrogel scaffolds and how the PDGFBB gene coordinates multiple steps in the differentiation of osteoblasts, will help to better optimize bone regeneration strategies.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cbi.2019.108931. References [1] S. Bhumiratana, J.C. Bernhard, D.M. Alfi, K. Yeager, R.E. Eton, J. Bova, F. Shah, J.M. Gimble, M.J. Lopez, S.B. Eisig, G. Vunjak-Novakovic, Tissue-engineered autologous grafts for facial bone reconstruction, Sci. Transl. Med. 8 (343) (2016), https://doi.org/10.1126/scitranslmed.aad5904 343ra383. [2] Y. Chen, S.H. Ye, H. Sato, Y. Zhu, V. Shanov, T. Tiasha, A. D'Amore, S. Luketich, G. Wan, W.R. Wagner, Hybrid scaffolds of Mg alloy mesh reinforced polymer/extracellular matrix composite for critical-sized calvarial defect reconstruction, J. Tissue Eng. Regenerat. Med. 12 (6) (2018) 1374–1388, https://doi.org/10.1002/ term.2668. [3] J. Henkel, M.A. Woodruff, D.R. Epari, R. Steck, V. Glatt, I.C. Dickinson, P.F. Choong, M.A. Schuetz, D.W. Hutmacher, Bone regeneration based on tissue engineering conceptions - a 21st century perspective, Bone Res. 1 (3) (2013) 216–248, https://doi.org/10.4248/br201303002. [4] M. Amirikia, S.G. Ali Jorsaraei, S.M. Ali Shariatzadeh, M.S. Mehranjani, Differentiation of stem cells from the apical papilla into osteoblasts by the elastic modulus of porous silk fibroin scaffolds, Biologicals 57 (2019) 1–8, https://doi.org/ 10.1016/j.biologicals.2018.10.005. [5] J. Li, M. Yan, Z. Wang, S. Jing, Y. Li, G. Liu, J. Yu, Z. Fan, Effects of canonical NFkappaB signaling pathway on the proliferation and odonto/osteogenic differentiation of human stem cells from apical papilla, BioMed Res. Int. 2014 (2014) 319651, https://doi.org/10.1155/2014/319651. [6] S. Saravanan, S. Vimalraj, P. Thanikaivelan, S. Banudevi, G. Manivasagam, A review on injectable chitosan/beta glycerophosphate hydrogels for bone tissue regeneration, Int. J. Biol. Macromol. 121 (2019) 38–54, https://doi.org/10.1016/j. ijbiomac.2018.10.014. [7] C. Qu, Z. Bao, X. Zhang, Z. Wang, J. Ren, Z. Zhou, M. Tian, X. Cheng, X. Chen, C. Feng, A thermosensitive RGD-modified hydroxybutyl chitosan hydrogel as a 3D scaffold for BMSCs culture on keloid treatment, Int. J. Biol. Macromol. 125 (2019) 78–86, https://doi.org/10.1016/j.ijbiomac.2018.12.058. [8] U. Ahmad, M. Sohail, M. Ahmad, M.U. Minhas, S. Khan, Z. Hussain, M. Kousar, S. Mohsin, M. Abbasi, S.A. Shah, H. Rashid, Chitosan based thermosensitive injectable hydrogels for controlled delivery of loxoprofen: development, characterization and in-vivo evaluation, Int. J. Biol. Macromol. 129 (2019) 233–245, https:// doi.org/10.1016/j.ijbiomac.2019.02.031. [9] C.M. Kolf, E. Cho, R.S. Tuan, Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation, Arthritis Res. Ther. 9 (1) (2007) 204, https://doi.org/10.1186/ar2116. [10] J.O. Hollinger, C.E. Hart, S.N. Hirsch, S. Lynch, G.E. Friedlaender, Recombinant human platelet-derived growth factor: biology and clinical applications, J. Bone Joint Surg. Am. 90 (Suppl 1) (2008) 48–54, https://doi.org/10.2106/jbjs.g.01231. [11] K.D. Hankenson, K. Gagne, M. Shaughnessy, Extracellular signaling molecules to promote fracture healing and bone regeneration, Adv. Drug Deliv. Rev. 94 (2015) 3–12, https://doi.org/10.1016/j.addr.2015.09.008. [12] S. Alimperti, P. Lei, J. Tian, S.T. Andreadis, A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation, Gene Ther. 19 (12) (2012) 1123–1132, https://doi.org/10.1038/gt.2011.208. [13] J. Wen, C. Qian, M. Pan, X. Wang, Y. Li, Y. Lu, Z. Zhou, Q. Yan, L. Li, Z. Liu, W. Wu, J. Guo, Lentivirus-mediated RNA interference targeting RhoA slacks the migration, proliferation, and myelin formation of Schwann cells, Mol. Neurobiol. 54 (2) (2017) 1229–1239, https://doi.org/10.1007/s12035-016-9733-5. [14] N.B. Ruparel, J.F. de Almeida, M.A. Henry, A. Diogenes, Characterization of a stem cell of apical papilla cell line: effect of passage on cellular phenotype, J. Endod. 39 (3) (2013) 357–363, https://doi.org/10.1016/j.joen.2012.10.027. [15] F. Jin, C. Qiao, N. Luan, H. Li, Lentivirus-mediated PHLDA2 overexpression inhibits trophoblast proliferation, migration and invasion, and induces apoptosis, Int. J. Mol. Med. 37 (4) (2016) 949–957, https://doi.org/10.3892/ijmm.2016.2508. [16] W. Zhang, X. Zhang, J. Li, J. Zheng, X. Hu, M. Xu, X. Mao, J. Ling, Foxc2 and BMP2 induce osteogenic/odontogenic differentiation and mineralization of human stem cells from apical papilla, Stem Cell. Int. 2018 (2018) 2363917, https://doi.org/10. 1155/2018/2363917. [17] S. Jahangir, S. Hosseini, F. Mostafaei, F.A. Sayahpour, M. Baghaban Eslaminejad, 3D-porous beta-tricalcium phosphate-alginate-gelatin scaffold with DMOG delivery promotes angiogenesis and bone formation in rat calvarial defects, J. Mater. Sci. Mater. Med. 30 (1) (2018) 1, https://doi.org/10.1007/s10856-018-6202-x. [18] X. Yang, H.N.S. Almassri, Q. Zhang, Y. Ma, D. Zhang, M. Chen, X. Wu, Electrosprayed naringin-loaded microsphere/SAIB hybrid depots enhance bone formation in a mouse calvarial defect model, Drug Deliv. 26 (1) (2019) 137–146, https://doi.org/10.1080/10717544.2019.1568620. [19] S.J. Weng, D.Y. Yan, J.H. Tang, Z.J. Shen, Z.Y. Wu, Z.J. Xie, J.Y. Yang, B.L. Bai, L. Chen, V. Boodhun, L. Yang, X. Da Eric Dong, L. Yang, Combined treatment with Cinnamaldehyde and beta-TCP had an additive effect on bone formation and angiogenesis in critical size calvarial defect in ovariectomized rats, Biomed. Pharmacother. 109 (2019) 573–581, https://doi.org/10.1016/j.biopha.2018.10. 085. [20] L.H. Han, B. Conrad, M.T. Chung, L. Deveza, X. Jiang, A. Wang, M.J. Butte, M.T. Longaker, D. Wan, F. Yang, Winner of the young investigator award of the society for biomaterials at the 10th world biomaterials congress, may 17-22, 2016,
5. Conclusions In summary, our research showed that PDGFBB gene improved the proliferation and osteogenic differentiation of SCAPs. Experiments in rats showed that the hydrogel can be used as a scaffold for 3D cell culture and can promote the repair of bone defects. Moreover, the hydrogel combined with SCAPs and PDGFBB gene can also significantly improve new bone formation and mineralization. Therefore, tissue engineered bone constructed using the PDGFBB gene, SCAPs and hydrogel scaffolds can effectively repair calvarial defects. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This work was supported by the National Natural Science Foundation of China (81470768), Shanghai Science and Technology Innovation Fund (19ZR1445500), Project of Shanghai Municipal Health Commission (201840148), Shanghai Sailing Program (17YF1416500). We thank the researchers from Donghua University for their help in the preparation and performance testing of hydrogel scaffolds. 9
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
[21]
[22]
[23] [24]
[25]
[26]
[27]
[28]
[29]
[30]
[31] Y. Jin, W. Zhang, Y. Liu, M. Zhang, L. Xu, Q. Wu, X. Zhang, Z. Zhu, Q. Huang, X. Jiang, rhPDGF-BB via ERK pathway osteogenesis and adipogenesis balancing in ADSCs for critical-sized calvarial defect repair, Tissue Eng. A 20 (23–24) (2014) 3303–3313, https://doi.org/10.1089/ten.TEA.2013.0556. [32] A. Bakopoulou, G. Leyhausen, J. Volk, A. Tsiftsoglou, P. Garefis, P. Koidis, W. Geurtsen, Comparative analysis of in vitro osteo/odontogenic differentiation potential of human dental pulp stem cells (DPSCs) and stem cells from the apical papilla (SCAP), Arch. Oral Biol. 56 (7) (2011) 709–721, https://doi.org/10.1016/j. archoralbio.2010.12.008. [33] A.A. Volponi, E. Gentleman, R. Fatscher, Y.W. Pang, M.M. Gentleman, P.T. Sharpe, Composition of mineral produced by dental mesenchymal stem cells, J. Dent. Res. 94 (11) (2015) 1568–1574, https://doi.org/10.1177/0022034515599765. [34] K.T. Peng, M.Y. Hsieh, C.T. Lin, C.F. Chen, M.S. Lee, Y.Y. Huang, P.J. Chang, Treatment of critically sized femoral defects with recombinant BMP-2 delivered by a modified mPEG-PLGA biodegradable thermosensitive hydrogel, BMC Muscoskelet. Disord. 17 (2016) 286, https://doi.org/10.1186/s12891-016-1131-7. [35] H. Li, Q. Ji, X. Chen, Y. Sun, Q. Xu, P. Deng, F. Hu, J. Yang, Accelerated bony defect healing based on chitosan thermosensitive hydrogel scaffolds embedded with chitosan nanoparticles for the delivery of BMP2 plasmid DNA, J. Biomed. Mater. Res. A 105 (1) (2017) 265–273, https://doi.org/10.1002/jbm.a.35900. [36] H. Ruan, Y. Yu, X. Guo, Q. Jiang, Y. Luo, The possibility of healing alveolar bone defects with simvastatin thermosensitive gel: in vitro/in vivo evaluation, Drug Des. Dev. Ther. 12 (2018) 1997–2003, https://doi.org/10.2147/dddt.s163986. [37] C.M. Cowan, Y.Y. Shi, O.O. Aalami, Y.F. Chou, C. Mari, R. Thomas, N. Quarto, C.H. Contag, B. Wu, M.T. Longaker, Adipose-derived adult stromal cells heal critical-size mouse calvarial defects, Nat. Biotechnol. 22 (5) (2004) 560–567, https:// doi.org/10.1038/nbt958. [38] A.A. Sawyer, S.J. Song, E. Susanto, P. Chuan, C.X. Lam, M.A. Woodruff, D.W. Hutmacher, S.M. Cool, The stimulation of healing within a rat calvarial defect by mPCL-TCP/collagen scaffolds loaded with rhBMP-2, Biomaterials 30 (13) (2009) 2479–2488, https://doi.org/10.1016/j.biomaterials.2008.12.055. [39] J. Liu, F. Yu, Y. Sun, B. Jiang, W. Zhang, J. Yang, G.T. Xu, A. Liang, S. Liu, Concise reviews: characteristics and potential applications of human dental tissue-derived mesenchymal stem cells, Stem Cells 33 (3) (2015) 627–638, https://doi.org/10. 1002/stem.1909. [40] J. Botelho, M.A. Cavacas, V. Machado, J.J. Mendes, Dental stem cells: recent progresses in tissue engineering and regenerative medicine, Ann. Med. 49 (8) (2017) 644–651, https://doi.org/10.1080/07853890.2017.1347705. [41] P. Ercal, G.G. Pekozer, G.T. Kose, Dental stem cells in bone tissue engineering: current overview and challenges, Adv. Exp. Med. Biol. 1107 (2018) 113–127, https://doi.org/10.1007/5584_2018_171.
montreal QC, Canada: microribbon-based hydrogels accelerate stem cell-based bone regeneration in a mouse critical-size cranial defect model, J. Biomed. Mater. Res. A 104 (6) (2016) 1321–1331, https://doi.org/10.1002/jbm.a.35715. L. Elkhateb, A. Zohdy, S.S. Atalla, M.H. Moussa, G.G. Hamam, F. Zahra, Comparative study on acellular dermal graft versus propylene mesh both either loaded or unloaded with BM-MSCs in healing of skull bone defect in rats: histological and immunohistochemical study, Int. J. Stem Cells 11 (2) (2018) 216–226, https://doi.org/10.15283/ijsc18019. C. Huang, V.P. Ness, X. Yang, H. Chen, J. Luo, E.B. Brown, X. Zhang, Spatiotemporal analyses of osteogenesis and angiogenesis via intravital imaging in cranial bone defect repair, J. Bone Miner. Res. 30 (7) (2015) 1217–1230, https://doi.org/10. 1002/jbmr.2460. H.X. Deng, Y. Wang, Q.R. Ding, D.L. Li, Y.Q. Wei, Gene therapy research in Asia, Gene Ther. 24 (9) (2017) 572–577, https://doi.org/10.1038/gt.2017.62. R. Okawa, O. Iijima, M. Kishino, H. Okawa, S. Toyosawa, H. Sugano-Tajima, T. Shimada, T. Okada, K. Ozono, T. Ooshima, K. Nakano, Gene therapy improves dental manifestations in hypophosphatasia model mice, J. Periodontal. Res. 52 (3) (2017) 471–478, https://doi.org/10.1111/jre.12412. K. Gupta, S. Singh, K.N. Garg, Gene therapy in dentistry: tool of genetic engineering. Revisited, Arch. Oral Biol. 60 (3) (2015) 439–446, https://doi.org/10.1016/j. archoralbio.2014.11.018. A. Atasoy-Zeybek, G.T. Kose, Gene therapy strategies in bone tissue engineering and current clinical applications, Adv. Exp. Med. Biol. 1119 (2018) 85–101, https://doi. org/10.1007/5584_2018_253. F. Zhang, W.X. Peng, L. Wang, J. Zhang, W.T. Dong, J.H. Wu, H. Zhang, J.B. Wang, Y. Zhao, Role of FGF-2 transfected bone marrow mesenchymal stem cells in engineered bone tissue for repair of avascular necrosis of femoral head in rabbits, Cell. Physiol. Biochem. 48 (2) (2018) 773–784, https://doi.org/10.1159/000491906. O. Sugiyama, D.S. An, S.P. Kung, B.T. Feeley, S. Gamradt, N.Q. Liu, I.S. Chen, J.R. Lieberman, Lentivirus-mediated gene transfer induces long-term transgene expression of BMP-2 in vitro and new bone formation in vivo, Mol. Ther. 11 (3) (2005) 390–398, https://doi.org/10.1016/j.ymthe.2004.10.019. S. Srouji, D. Ben-David, O. Fromigue, P. Vaudin, G. Kuhn, R. Muller, E. Livne, P.J. Marie, Lentiviral-mediated integrin alpha5 expression in human adult mesenchymal stromal cells promotes bone repair in mouse cranial and long-bone defects, Hum. Gene Ther. 23 (2) (2012) 167–172, https://doi.org/10.1089/hum. 2011.059. L. Xu, K. Lv, W. Zhang, X. Zhang, X. Jiang, F. Zhang, The healing of critical-size calvarial bone defects in rat with rhPDGF-BB, BMSCs, and beta-TCP scaffolds, J. Mater. Sci. Mater. Med. 23 (4) (2012) 1073–1084, https://doi.org/10.1007/ s10856-012-4558-x.
10
Contents lists available at ScienceDirect
Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint
PDGFBB-modified stem cells from apical papilla and thermosensitive hydrogel scaffolds induced bone regeneration
T
Jiajia Denga,b,1, Jie Pana,b,1, Xinxin Hanb, Liming Yua,b, Jing Chena,b, Weihua Zhanga,b, Luying Zhuc, Wei Huangb, Shangfeng Liub, Zhengwei Youd, Yuehua Liua,b,∗ a
Department of Orthodontics, Shanghai Stomatological Hospital, Fudan University, Shanghai, 200001, PR China Oral Biomedical Engineering Laboratory, Shanghai Stomatological Hospital, Fudan University, Shanghai, 200001, PR China c Xiangya School of Stomatology, Xiangya Stomatology Hospital, Central South University, Changsha, China d State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Shanghai Belt and Road Joint Laboratory of Advanced Fiber and Low-dimension Materials, Donghua University, Shanghai, 201620, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Hydrogel Bone defect repair SCAPs
Bone defects caused by cancer surgery or trauma have a strong negative impact on human health. Treatment with cell and material-based complexes provides an alternative strategy for the regeneration of damaged bone tissue. The good physical properties and suitable biodegradability of a thermosensitive hydrogel has been shown to act as a valuable scaffold. Platelet derived growth factor BB (PDGFBB) is mainly secreted by platelets and promotes the migration and angiogenesis of mesenchymal stem cells (MSCs). Although PDGFBB is known to indirectly enhance bone repair in vivo, the effects of PDGFBB on stem cells from apical papilla (SCAPs) require further investigation. In our study, the proliferation of cells was investigated by the cell counting kit-8 and live/ dead staining methods. The results indicated that PDGFBB promoted the proliferation of SCAPs. Real-time polymerase chain reaction and Western blot experiments were used to detect osteogenic genes and proteins. Moreover, calvarial defects were created in Sprague-Dawley rats and different complexes implanted. The results shown by micro-CT and hematoxylin and eosin analysis demonstrated that the hydrogel combined with lentiviral supernatant-green fluorescent protein-PDGFBB significantly improved new bone formation and mineralization compared with the other three groups. In summary, our research showed that a thermosensitive hydrogel can be used as a scaffold for 3D cell culture, and PDGFBB gene-modified SCAPs can improve bone formation in calvarial defects.
1. Introduction Bone defects caused by cancer surgery, trauma or other diseases are strongly associated with functional disorders [1]. Bone autografts are widely used for the surgical reconstruction of damaged bone tissue. However, autografts have certain limitations in terms of availability and volume, and are difficult to form into complex shapes [2,3]. Treatment with cell and material-based complexes provides an alternative strategy for the regeneration of damaged bone tissue. Although many studies have demonstrated that SCAPs represent early progenitor/stem cells with strong proliferative and osteoblast differentiation potential in vitro, the role of SCAPs in osteogenic differentiation in vivo requires further study [4,5]. Thermosensitive hydrogel is synthesized using natural polymers and
mimics [6,7]. Moreover, these polymers exhibit high biocompatibility and physical properties, and thus have potential in biomedical applications [8]. When combined with MSCs, hydrogel-based tissue engineering strategies have obvious advantages for the repair of various sized bone defects as the hydrogel can be molded into a variety of irregular shapes. In addition, delivery of gel-encapsulated cells via injection is a minimally invasive procedure, and the risk of wound infection is minimized. Thus, cells combined with a hydrogel scaffold have become a promising strategy in regenerative medicine. Many studies have suggested that growth factors can promote MSC self-renewal in vitro [9]. The platelet derived growth factor (PDGF) family includes AA, BB, AB, CC, and DD, which bind to their receptors (PDGFR-α and PDGFR-β) [10,11]. In addition, lentiviral vectors are extensively used to infect MSCs as they transfect cells effectively
∗
Corresponding author. Oral Biomedical Engineering Laboratory, Shanghai Stomatological Hospital, Fudan University, 2 Tianjing Road, Shanghai, 200001, China. E-mail address: [email protected] (Y. Liu). 1 These two authors contributed equally to this work. https://doi.org/10.1016/j.cbi.2019.108931 Received 5 August 2019; Received in revised form 30 November 2019; Accepted 17 December 2019 Available online 23 December 2019 0009-2797/ © 2019 Elsevier B.V. All rights reserved.
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Table 1 The sequences of primers used for PCR amplification. Gene
Forward primer (5′→ 3′)
Reverse primer(5′→ 3′)
OPN OCN PDGFBB OSX COL-1 VEGF GAPDH
CTCCATTGACTCGAACGACTC GGATGACCCCCAAATAGCCC ATAGACCGCACCAACGCCAACTTC CCTCTGCGGGACTCAACAAC GAGGGCCAAGACGAAGACATC AGGGCAGAATCATCACGAAGT CATCAAGAAGGTGGTGAAGCAGG
CAGGTCTGCGAAACTTCTTAGAT GCTTGGACACAAAGGCTGC TCCGCACAATCTCGATCTTTCTCA AGCCCATTAGTGCTTGTAAAGG CAGATCACGTCATCGCACAAC AGGGTCTCGATTGGATGGCA AAAGGTGGAGGAGTGGGTGTC
Fig. 1. Schematic of the study. Thermosensitive hydrogel was fabricated and subsequently PDGFBB gene-modified SCAPs seeded onto the hydrogel. The effect of PDGFBB on osteogenic differentiation of SCAPs was studied in vitro and in vivo.
2.2. Lentivirus transfection
[12,13]. It is crucial to improve the activity of seed cells in tissue engineering research. Therefore, in this research, we constructed PFGFBB genemodified SCAPs using lentiviral vectors and assessed the effects of PDGFBB on SCAPs viability and osteogenic differentiation capacity in vitro. Hydrogel loaded cell complexes were then constructed and implanted in rat calvarial defects.
SCAPs were grown on 6-well plates at an initial density of 1 × 105 cells/well. After 1 day, the SCAPs were transfected with PDGFBB lentiviral supernatant (Lentiv-green fluorescent protein (GFP)PDGFBB group). SCAPs infected with GFP lentiviral supernatant (Lentiv-GFP group) were included as the negative control group. In addition, a non-infected group was included as the blank control. The transfection complex was replaced by complete growing media 24 hpost transfection and thereafter sub-cultured for further experiments. Real-time polymerase chain reaction (PCR) and immunofluorescence analysis were performed after transfection in order to examine PDGFBB gene and protein expression. After transfection, SCAPs were fixed and incubated with osteopontin (OPN) and collagen type I (COL-I) antibody to analysis the osteogenic proteins of SCAPs.
2. Materials and methods 2.1. SCAPs culture The steps for SCAPs culture were according to previously reported methods [14,15]. Human immature impacted third molars were collected (16–18 years) from Shanghai Stomatological Hospital. The experiment was supported by the Ethical Review Committee of Shanghai Stomatological Hospital. Freshly extracted teeth were preserved in phosphate-buffered saline (PBS). Root apical papilla from the molars were gently scraped and placed in a culture dish at 37 °C in a 5% CO2 atmosphere. The culture medium consisted of 10% fetal bovine serum (FBS), minimum essential medium-alpha (α-MEM), and 1% penicillin/ streptomycin. The colony-forming cells were harvested for further experiments.
2.3. Cell proliferation assays The proliferation of cells was examined using cell counting kit-8 (CCK-8, Dojindo, Japan) [16]. The cells were cultured in 96-well plates, respectively, and were incubated with CCK‐8 reagent for 7 consecutive days, and then the absorbance of the solution was measured by a microplate reader (Epoch2, Biotek, USA) at 450 nm. 2
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 2. (A–B) The transfection efficiency and expression of PDGFBB protein were observed using inverted fluorescence microscopy. (C) Real-time PCR analysis of PDGFBB gene expression. (D) Immunofluorescence staining showed the expression of PDGFBB protein. (E) The results of the CCK-8 assay showed that PDGFBB promoted the proliferation of SCAPs. *P ≤ 0.05. **P ≤ 0.01. ***P ≤ 0.001.
secondary antibody (1: 10000) for 1 h, and then target bands were viewed using Western ECL Substrate.
2.4. Alizarin red staining in vitro SCAPs were seeded on 6-well plates, osteogenic induction began when the cells reached 80% confluence. The osteogenic medium contained α-MEM (Sigma-Aldrich), 10% FBS, 10 mmol/L β-glycerophosphate (Sigma-Aldrich), 50 mg/L ascorbic acid (Sigma-Aldrich) and 0.1 μmol/L dexamethasone (Sigma-Aldrich). Following 21 days of induction, the cells were stained with Alizarin Red S solution for 15–30 min.
2.7. Synthesis and analysis of the properties of PLGA–PEG–PLGA triblock copolymers Thermosensitive hydrogel was prepared by ring-opening polymerization. An amount of D, L-lactide (LA), Glycolide (GA), and poly (ethylene glycol) (PEG) (LA: GA: PEG = 15 : 5: 8) (Sigma) was weighed and mixed in an airtight reaction bottle. The container was placed in a vacuum at 120 °C for 30 min, and stannous caprylate (0.2% w/w, Sigma) was added as the catalyst and subsequently, heated to 170 °C for 8 h and then placed in a vacuum for 30 min to remove the unreacted monomer. The product was dissolved in water and then heated to 80 °C to precipitate, this procedure was repeated and the copolymer was obtained. Before the experiment, the copolymer was dissolved in 10% PBS and stored at 4 °C. The temperature of hydrogel transition was measured by the tube inversion method. Dynamic rheological analysis was carried out on 20 wt% copolymer with a strain amplitude of 1%, an angular frequency of 1 rad/s and a heating rate of 0.5 °C/min using an advanced rotatory rheological system (ARES-RFS, TA, USA). The energy storage modulus G'and loss modulus G″of the polymer at different temperatures were obtained.
2.5. Real-time PCR The expression levels of osteogenic genes, including OPN, Osterix (OSX), COL-1, and angiogenic gene, vascular endothelial growth factor (VEGF) were measured on days 7, 14, and 21 after osteogenic induction. Total RNA was isolated using Trizol Reagent. 1 μL RNA was used to synthesize complementary DNA. Real-time PCR was conducted with SYBR GREEN Mix. The specific primer sequences are listed in Table 1. The RNA expression levels of these genes were quantified by the2−ΔΔCt formula. 2.6. Western blot Total proteins were isolated using 2 × SDS loading buffer supplemented with proteinase inhibitor. The proteins were then denatured at 96 °C and 30 μL of proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. The PVDF membranes were blocked with 5% dehydrated milk for 45 min under agitation and then incubated with primary antibody, including OPN (ab8448, Abcam) (1:1000), OSX (ab22552, Abcam) (1:1000), COL-1 (ab34710, Abcam) (1:1000), VEGF (ab1316, Abcam) (1:1000), and GAPDH (1:10000). Subsequently, the membranes were immersed in the
2.8. Encapsulation of SCAPs and scanning electron microscopy (SEM) SCAPs were homogeneously resuspended in 100 μL of sterilized hydrogel at an initial density of 1 × 106 cells/mL. Thereafter, the hydrogel with the encapsulated SCAPs was placed in 37 °C and medium added. Cell proliferation was evaluated by the CCK-8 assay as described above. For SEM analysis, the encapsulated SCAPs were fixed overnight. All 3
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 3. Adhesion and proliferation of SCAPs cultured on hydrogel. (A) Molecular structure of PLGA–PEG–PLGA triblock copolymers. (B) The energy storage modulus G'and loss modulus G″of the polymer at different temperatures. (C) Gross appearance of the hydrogel at 20 °C and 37 °C. (D) SEM images of the hydrogel with SCAPs (white arrow). (E) Proliferation of SCAPs cultured in the hydrogel detected by the CCK-8 assay.
GFP-PDGFBB group, (2) Hydrogel mixed with Lentiv-GFP group, (3) Hydrogel only group, (4) Control group without treatment group. The surgical sites were sutured with 5–0 Vicryl suture and all animals received 80000 units of penicillin by intramuscular injection. The experimental procedure is presented in Fig. 1.
samples were then dehydrated through graded ethanol and analyzed by an ALTO 1000 scanning electron microscope (S–3400 N). 2.9. Cell viability in the hydrogels in vitro The attachment and spread of encapsulated SCAPs were assessed by the live/dead staining kit (Invitrogen). The composites were stained at 1, 3, 5, and 7 days after seeding, and submerged in the staining solution for 30 min. Viable cells stained green, whereas dead cells appeared red.
2.11. Micro-computed tomography (micro-CT) analysis At 4 and 8 weeks after surgery, the rats were sacrificed under anesthesia, and the specimens obtained were fixed with 4% paraformaldehyde (PFA). The calvarial defects were then scanned using a conical beam micro-CT scanner (energy 40 kV, current 250 μA, integration time 0.24 s, Sky-Scan 1076; Bruker micro-CT, Kontich, Belgium). Scanning was conducted with an isotropic voxel size of 18μm thick, and 3D reconstruction of the defect using NRecon v.1.6.9 software.
2.10. Animal models and surgical procedures In this study, twenty-four male Sprague-Dawley rats (8 weeks old) were housed in a specific-pathogen-free environment with a 12 h light/ dark cycle and free access to water and food. All experiments involving animals were conducted in accordance with the guidelines established by the Fudan University Animal Care and Use Committee. All rats were anesthetized by an intraperitoneal injection of 2% pentobarbital sodium (0.3 ml/100 g body weight). A trephine drill (5 mm) was used to create critical-sized full-thickness bone defects in the calvaria under saline perfusion [17–19]. All rats were randomly divided into the following 4 groups: (1) Hydrogel mixed with Lentiv-
2.12. Histological analysis Following micro-CT imaging, specimens of calvarial defects were decalcified in 10% ethylenediaminetetraacetic acid. The specimens were then dehydrated with graded ethanol, embedded in paraffin, and 4
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 4. (A and B) Alizarin Red staining and semi-quantitative calcium analysis. (C) Live/dead staining of SCAPs cultured in the hydrogel. (D) The images showed high cell viability of the encapsulated SCAPs. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
then sectioned at a thickness of 5 μm. A part of the section was stained using the hematoxylin and eosin (H&E) staining kit [20,21]. The expression of alkaline phosphatase (ALP) was detected via immunohistochemical (IHC) staining [22]. Samples were permeabilized with 0.25% Triton X-100 and blocked in 5% bovine serum albumin. The samples were subsequently incubated with primary antibody, then incubated with secondary antibodies conjugated to horse radish peroxidase (HRP) for 60 min. The samples were visualized by DAB staining. The stained sections were photographed under a fluorescent microscope.
an acceptable transfection level (Fig. 2B). Real‐time PCR showed that the PDGFBB mRNA levels were significantly upregulated compared with the control group at 3, 7, 14 and 21 days after transfection (P＜0.001) (Fig. 2C). Immunofluorescence staining (Fig. 2D) was performed to further validate the presence of PDGFBB proteins in SCAPs. These data suggested that the lentivirusmediated PDGFBB gene was successfully transfected into SCAPs and was stably expressed in SCAPs.
2.13. Statistical analysis All data were analyzed using PRISM 5 software. Significant differences between different groups were defined using one-way analysis of variance. Data are expressed as mean ± standard deviation. Values of P < 0.05 were considered statistically significant.
The effects of PDGFBB on SCAPs proliferation was investigated for seven consecutive days. As shown in Fig. 2, there were no obvious differences on the first two days after transfection (Fig. 2E). However, on the third day, the proliferation in the Lentiv-GFP-PDGFBB group was significantly increased compared with the other groups (P＜0.05), suggesting that PDGFBB can promote the proliferation of SCAPs.
3. Results
3.3. Properties of the thermosensitive hydrogel
3.1. Lentivirus transfection and expression of PDGFBB
The thermosensitive hydrogel was successfully prepared. Fig. 3A shows the molecular structure of the hydrogel. The temperature of thermosensitive hydrogel transition was measured by the tube inversion method. The results showed that the hydrogel transition temperature was 34.33 ± 0.57 °C. As shown in Fig. 3, the hydrogel changed from liquid to gel state rapidly at 37 °C (Fig. 3C). As the
3.2. PDGFBB promotes the proliferation of SCAPs
The results showed that SCAPs grew well in the Lentiv-GFP and Lentiv-GFP-PDGFBB groups. The multiplicity of infection (MOI) 80 group showed significant green fluorescence (Fig. 2A). Statistical analysis showed that the transfection efficiency exceeded 90% which was 5
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 5. PDGFBB overexpression enhanced the osteogenic differentiation of SCAPs. (A–D) Real-time PCR analysis of OPN, OSX, COL-1 and VEGF expression. (E) Immunofluorescence staining of OPN and COL-1 proteins. *P ≤ 0.05. **P ≤ 0.01. ***P ≤ 0.001.
3.4. Cell viability assay and SEM
temperature increased, the energy storage modulus G'and loss modulus G″increased sharply at approximately. 32 °C. The G″increased faster than the G'and the point of intersection was the hydrogel transition temperature which was approximately 33 °C (Fig. 3B). These results are consistent with the hydrogel transition temperature measured by the tube inversion method, and further demonstrated the temperature sensitivity of the hydrogel.
To examine the morphology of the SCAPs aggregates in the hydrogel, we observed and photographed the surface with SEM. As shown in Fig. 3, the SCAPs morphology was maintained, and aggregates adhered tightly to the hydrogel scaffold (Fig. 3D). In addition, live/dead staining was conducted to evaluate cell 6
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 6. Western blot analysis of OPN, OSX, COL-1, and VEGF proteins. *P ≤ 0.05. **P ≤ 0.01.
3.7. Micro-CT analysis
viability in the hydrogel. After 7 days, the samples were stained with ethidium homodimer-1 and calcein-AM solution. Fig. 4C–D shows that most of the stained cells were alive and green with only a few red dead cells. The CCK-8 assay also supported the above results (Fig. 3E). These findings indicated that the thermosensitive hydrogel was suitable for cell growth and had good biocompatibility.
The newly-formed tissues in the calvarial defects in the 4 groups were observed and characterized by micro-CT. Fig. 7 shows that there was limited new bone formation in the control group. New bone formation in the hydrogel groups was 31.02 ± 1.63% at 4 weeks and 37.15 ± 5.94% at 8 weeks, respectively. Furthermore, the hydrogel + Lentiv-GFP groups showed greater bone regeneration (41.73 ± 5.98% and 48.87 ± 3.35%) than the hydrogel group (Fig. 7A). The combination of hydrogel and Lentiv-GFP-PDGFBB had the greatest effect of new bone formation (48.85 ± 2.37% and 55.86 ± 1.89%) compared with the other groups (Fig. 7B). In summary, the combination treatment showed a greater positive effect on bone regeneration than either single treatment.
3.5. Alizarin red staining We further evaluated the osteogenic differentiation capacity in the 3 groups. At 21 days after osteogenic induction, a large amount of calcium deposition was observed which was stained red (Fig. 4A). However, the positive area in the Lentiv-GFP-PDGFBB group was substantially greater than that in the other 2 groups (P＜0.05) (Fig. 4B).
3.8. Histological analysis
3.6. PDGFBB induced OPN, OSX, COL-1 and VEGF expression in SCAPs
Eight weeks after surgery, limited new bone was observed in the control group (Fig. 7A–B). In contrast, the amount of new bone in the hydrogel group was greater. However, the hydrogel combined with Lentiv-GFP-PDGFBB group showed greater bone formation than the other groups (Fig. 7C). To further evaluate osteogenesis, we conducted an IHC analysis of ALP (Fig. 7D). IHC staining showed that the control group had the fewest ALP-positive regions, and the hydrogel combined with LentivGFP and Lentiv-GFP-PDGFBB groups had more ALP-positive areas. These results indicated that combination treatment with hydrogel and PDGFBB gene-modified SCAPs significantly enhanced bone formation in rat calvarial defects. In addition, this combination treatment may also play an important role in angiogenesis.
The expression levels of osteogenic genes were evaluated at 7, 14, and 21 days. The results showed that PDGFBB induced higher expression of OPN, OSX and COL-1, which reflected different periods of osteogenic differentiation (Fig. 5A–C). At day 7, the expression of OPN and OSX increased significantly and was consistently higher than that in the control group at day 14 (P＜0.05). Furthermore, the expression of COL-1 was significantly up-regulated at day 14 and 21 (P＜0.05). In addition, the expression of VEGF, which is involved in angiogenesis differentiation, was significantly increased in the Lentiv-GFP-PDGFBB group compared with the other groups (Fig. 5D). Similar results were obtained following immunofluorescence and western blot analysis (Figs. 5E and 6). These results showed that PDGFBB may be an important positive regulator of induced osteogenic and angiogenesis differentiation in SCAPs. 7
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Fig. 7. Micro-CT reconstruction and histological analysis. (A and B) Micro-CT reconstruction images and quantitative analysis of new bone formation (area of new bone formation/calvarial defect). (C) H&E staining of bone defect area. (D) IHC analysis shows the positive areas of ALP staining. *P ≤ 0.05. **P ≤ 0.01. ***P ≤ 0.001. NB: new bone. OB: old bone.
4. Discussion
PDGFBB gene was overexpressed by the lentivirus, we found that osteogenic markers of SCAPs such as OPN, OSX, and COL-1 were upregulated. Moreover, the expression of VEGF, which is related to angiogenesis, was also upregulated. These results demonstrated that PDGFBB may have a positive effect on the osteogenic differentiation of SCAPs. Although most previous studies have shown that SCAPs have strong osteogenic differentiation ability in vitro, further research is needed to determine osteogenic differentiation ability in vivo [32,33]. In recent studies, a thermosensitive hydrogel was designed with the extracellular matrix having various characteristics, such as guiding cell growth, migration, and differentiation. In addition, studies on the application of thermosensitive hydrogels in drug delivery and 3D cell culture have shown the excellent carrier properties of the hydrogels [34–36]. In order to study the growth of SCAPs in the hydrogel, we inoculated
Biological materials have been widely used in various fields of medicine [23–25]. These materials are important media for delivering seed cells and effective growth factors. A large number of studies have proved that lentiviral vectors are good tools for altering cells in order to repair bone defects [26–29]. Our research aimed to evaluate the effect of hydrogel combined with PDGFBB gene on osteoblastic differentiation of SCAPs in vitro and in vivo. In this study, we found that PDGFBB promoted the proliferation of SCAPs. Based on previous studies of recombinant human PDGFBB in bone marrow-derived mesenchymal stem cells (BMMSCs) and adiposederived stem cells (ADSCs), we hypothesized that PDGFBB gene plays a similar role in osteogenic differentiation of SCAPs [30,31]. When the 8
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
Appendix A. Supplementary data
SCAPs into the thermosensitive hydrogel for 3D culture. Our research showed that SCAPs proliferated continuously for more than 7 days in the thermosensitive hydrogel. It can be seen from the SEM images that SCAPs were found in various forms in the hydrogel and were firmly adhered to the pores of the scaffold. In addition, the thermosensitive hydrogel can be shaped and injected into various types of bone defects. These results confirmed that the thermosensitive hydrogel is a good scaffold for 3D cell culture. To further evaluate the bone repair effect of PDGFBB in vivo, we constructed tissue-engineered bone combined with SCAPs, PDGFBB lentiviral vector, and the thermosensitive hydrogel to repair calvarial defects in rat. Rat models of skull defects have been widely used to study the bone repair capacity of scaffolds, cells, and genes [35,37]. Studies have shown that the optimal standard size for the establishment of a rat calvarial defect model is 5 mm in diameter [38]. Therefore, this study established bone defects 5 mm in diameter. It was found that new bone at the edge of the defects was limited and there was no significant difference in new bone at 4 and 8 weeks in the control group. We also found that the hydrogel scaffolds induced bone repair as the scaffold prevents early contraction of blood clots within the defect region and stimulates natural bone healing [38]. Interestingly, bone repair was significantly promoted after SCAPs inoculation in the hydrogel. However, there was no statistically significant difference between hydrogel + Lentiv-GFP and the hydrogel only groups at 8 weeks, which was different to that at 4 weeks. Eight weeks after surgery, micro-CT showed newer bone in the Lentiv-GFP-PDGFBB group than in the other groups. These data provide evidence that PDGFBB played a positive role in bone repair. Osteoprogenitor cells, frame materials, and growth factors are the three basic elements for bone tissue engineering. Dental stem cells have the advantages of easy harvest, rapid expansion and strong differentiation ability; thus, are promising osteoprogenitor cells for tissue regeneration [39–41]. In addition, seed cells, growth factors and scaffolds are key elements for constructing tissue engineered bone. However, our findings require further validation including the role of signaling pathways and studies should be carried out in larger animals. Further understanding of SCAPs, hydrogel scaffolds and how the PDGFBB gene coordinates multiple steps in the differentiation of osteoblasts, will help to better optimize bone regeneration strategies.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cbi.2019.108931. References [1] S. Bhumiratana, J.C. Bernhard, D.M. Alfi, K. Yeager, R.E. Eton, J. Bova, F. Shah, J.M. Gimble, M.J. Lopez, S.B. Eisig, G. Vunjak-Novakovic, Tissue-engineered autologous grafts for facial bone reconstruction, Sci. Transl. Med. 8 (343) (2016), https://doi.org/10.1126/scitranslmed.aad5904 343ra383. [2] Y. Chen, S.H. Ye, H. Sato, Y. Zhu, V. Shanov, T. Tiasha, A. D'Amore, S. Luketich, G. Wan, W.R. Wagner, Hybrid scaffolds of Mg alloy mesh reinforced polymer/extracellular matrix composite for critical-sized calvarial defect reconstruction, J. Tissue Eng. Regenerat. Med. 12 (6) (2018) 1374–1388, https://doi.org/10.1002/ term.2668. [3] J. Henkel, M.A. Woodruff, D.R. Epari, R. Steck, V. Glatt, I.C. Dickinson, P.F. Choong, M.A. Schuetz, D.W. Hutmacher, Bone regeneration based on tissue engineering conceptions - a 21st century perspective, Bone Res. 1 (3) (2013) 216–248, https://doi.org/10.4248/br201303002. [4] M. Amirikia, S.G. Ali Jorsaraei, S.M. Ali Shariatzadeh, M.S. Mehranjani, Differentiation of stem cells from the apical papilla into osteoblasts by the elastic modulus of porous silk fibroin scaffolds, Biologicals 57 (2019) 1–8, https://doi.org/ 10.1016/j.biologicals.2018.10.005. [5] J. Li, M. Yan, Z. Wang, S. Jing, Y. Li, G. Liu, J. Yu, Z. Fan, Effects of canonical NFkappaB signaling pathway on the proliferation and odonto/osteogenic differentiation of human stem cells from apical papilla, BioMed Res. Int. 2014 (2014) 319651, https://doi.org/10.1155/2014/319651. [6] S. Saravanan, S. Vimalraj, P. Thanikaivelan, S. Banudevi, G. Manivasagam, A review on injectable chitosan/beta glycerophosphate hydrogels for bone tissue regeneration, Int. J. Biol. Macromol. 121 (2019) 38–54, https://doi.org/10.1016/j. ijbiomac.2018.10.014. [7] C. Qu, Z. Bao, X. Zhang, Z. Wang, J. Ren, Z. Zhou, M. Tian, X. Cheng, X. Chen, C. Feng, A thermosensitive RGD-modified hydroxybutyl chitosan hydrogel as a 3D scaffold for BMSCs culture on keloid treatment, Int. J. Biol. Macromol. 125 (2019) 78–86, https://doi.org/10.1016/j.ijbiomac.2018.12.058. [8] U. Ahmad, M. Sohail, M. Ahmad, M.U. Minhas, S. Khan, Z. Hussain, M. Kousar, S. Mohsin, M. Abbasi, S.A. Shah, H. Rashid, Chitosan based thermosensitive injectable hydrogels for controlled delivery of loxoprofen: development, characterization and in-vivo evaluation, Int. J. Biol. Macromol. 129 (2019) 233–245, https:// doi.org/10.1016/j.ijbiomac.2019.02.031. [9] C.M. Kolf, E. Cho, R.S. Tuan, Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation, Arthritis Res. Ther. 9 (1) (2007) 204, https://doi.org/10.1186/ar2116. [10] J.O. Hollinger, C.E. Hart, S.N. Hirsch, S. Lynch, G.E. Friedlaender, Recombinant human platelet-derived growth factor: biology and clinical applications, J. Bone Joint Surg. Am. 90 (Suppl 1) (2008) 48–54, https://doi.org/10.2106/jbjs.g.01231. [11] K.D. Hankenson, K. Gagne, M. Shaughnessy, Extracellular signaling molecules to promote fracture healing and bone regeneration, Adv. Drug Deliv. Rev. 94 (2015) 3–12, https://doi.org/10.1016/j.addr.2015.09.008. [12] S. Alimperti, P. Lei, J. Tian, S.T. Andreadis, A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation, Gene Ther. 19 (12) (2012) 1123–1132, https://doi.org/10.1038/gt.2011.208. [13] J. Wen, C. Qian, M. Pan, X. Wang, Y. Li, Y. Lu, Z. Zhou, Q. Yan, L. Li, Z. Liu, W. Wu, J. Guo, Lentivirus-mediated RNA interference targeting RhoA slacks the migration, proliferation, and myelin formation of Schwann cells, Mol. Neurobiol. 54 (2) (2017) 1229–1239, https://doi.org/10.1007/s12035-016-9733-5. [14] N.B. Ruparel, J.F. de Almeida, M.A. Henry, A. Diogenes, Characterization of a stem cell of apical papilla cell line: effect of passage on cellular phenotype, J. Endod. 39 (3) (2013) 357–363, https://doi.org/10.1016/j.joen.2012.10.027. [15] F. Jin, C. Qiao, N. Luan, H. Li, Lentivirus-mediated PHLDA2 overexpression inhibits trophoblast proliferation, migration and invasion, and induces apoptosis, Int. J. Mol. Med. 37 (4) (2016) 949–957, https://doi.org/10.3892/ijmm.2016.2508. [16] W. Zhang, X. Zhang, J. Li, J. Zheng, X. Hu, M. Xu, X. Mao, J. Ling, Foxc2 and BMP2 induce osteogenic/odontogenic differentiation and mineralization of human stem cells from apical papilla, Stem Cell. Int. 2018 (2018) 2363917, https://doi.org/10. 1155/2018/2363917. [17] S. Jahangir, S. Hosseini, F. Mostafaei, F.A. Sayahpour, M. Baghaban Eslaminejad, 3D-porous beta-tricalcium phosphate-alginate-gelatin scaffold with DMOG delivery promotes angiogenesis and bone formation in rat calvarial defects, J. Mater. Sci. Mater. Med. 30 (1) (2018) 1, https://doi.org/10.1007/s10856-018-6202-x. [18] X. Yang, H.N.S. Almassri, Q. Zhang, Y. Ma, D. Zhang, M. Chen, X. Wu, Electrosprayed naringin-loaded microsphere/SAIB hybrid depots enhance bone formation in a mouse calvarial defect model, Drug Deliv. 26 (1) (2019) 137–146, https://doi.org/10.1080/10717544.2019.1568620. [19] S.J. Weng, D.Y. Yan, J.H. Tang, Z.J. Shen, Z.Y. Wu, Z.J. Xie, J.Y. Yang, B.L. Bai, L. Chen, V. Boodhun, L. Yang, X. Da Eric Dong, L. Yang, Combined treatment with Cinnamaldehyde and beta-TCP had an additive effect on bone formation and angiogenesis in critical size calvarial defect in ovariectomized rats, Biomed. Pharmacother. 109 (2019) 573–581, https://doi.org/10.1016/j.biopha.2018.10. 085. [20] L.H. Han, B. Conrad, M.T. Chung, L. Deveza, X. Jiang, A. Wang, M.J. Butte, M.T. Longaker, D. Wan, F. Yang, Winner of the young investigator award of the society for biomaterials at the 10th world biomaterials congress, may 17-22, 2016,
5. Conclusions In summary, our research showed that PDGFBB gene improved the proliferation and osteogenic differentiation of SCAPs. Experiments in rats showed that the hydrogel can be used as a scaffold for 3D cell culture and can promote the repair of bone defects. Moreover, the hydrogel combined with SCAPs and PDGFBB gene can also significantly improve new bone formation and mineralization. Therefore, tissue engineered bone constructed using the PDGFBB gene, SCAPs and hydrogel scaffolds can effectively repair calvarial defects. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This work was supported by the National Natural Science Foundation of China (81470768), Shanghai Science and Technology Innovation Fund (19ZR1445500), Project of Shanghai Municipal Health Commission (201840148), Shanghai Sailing Program (17YF1416500). We thank the researchers from Donghua University for their help in the preparation and performance testing of hydrogel scaffolds. 9
Chemico-Biological Interactions 316 (2020) 108931
J. Deng, et al.
[21]
[22]
[23] [24]
[25]
[26]
[27]
[28]
[29]
[30]
[31] Y. Jin, W. Zhang, Y. Liu, M. Zhang, L. Xu, Q. Wu, X. Zhang, Z. Zhu, Q. Huang, X. Jiang, rhPDGF-BB via ERK pathway osteogenesis and adipogenesis balancing in ADSCs for critical-sized calvarial defect repair, Tissue Eng. A 20 (23–24) (2014) 3303–3313, https://doi.org/10.1089/ten.TEA.2013.0556. [32] A. Bakopoulou, G. Leyhausen, J. Volk, A. Tsiftsoglou, P. Garefis, P. Koidis, W. Geurtsen, Comparative analysis of in vitro osteo/odontogenic differentiation potential of human dental pulp stem cells (DPSCs) and stem cells from the apical papilla (SCAP), Arch. Oral Biol. 56 (7) (2011) 709–721, https://doi.org/10.1016/j. archoralbio.2010.12.008. [33] A.A. Volponi, E. Gentleman, R. Fatscher, Y.W. Pang, M.M. Gentleman, P.T. Sharpe, Composition of mineral produced by dental mesenchymal stem cells, J. Dent. Res. 94 (11) (2015) 1568–1574, https://doi.org/10.1177/0022034515599765. [34] K.T. Peng, M.Y. Hsieh, C.T. Lin, C.F. Chen, M.S. Lee, Y.Y. Huang, P.J. Chang, Treatment of critically sized femoral defects with recombinant BMP-2 delivered by a modified mPEG-PLGA biodegradable thermosensitive hydrogel, BMC Muscoskelet. Disord. 17 (2016) 286, https://doi.org/10.1186/s12891-016-1131-7. [35] H. Li, Q. Ji, X. Chen, Y. Sun, Q. Xu, P. Deng, F. Hu, J. Yang, Accelerated bony defect healing based on chitosan thermosensitive hydrogel scaffolds embedded with chitosan nanoparticles for the delivery of BMP2 plasmid DNA, J. Biomed. Mater. Res. A 105 (1) (2017) 265–273, https://doi.org/10.1002/jbm.a.35900. [36] H. Ruan, Y. Yu, X. Guo, Q. Jiang, Y. Luo, The possibility of healing alveolar bone defects with simvastatin thermosensitive gel: in vitro/in vivo evaluation, Drug Des. Dev. Ther. 12 (2018) 1997–2003, https://doi.org/10.2147/dddt.s163986. [37] C.M. Cowan, Y.Y. Shi, O.O. Aalami, Y.F. Chou, C. Mari, R. Thomas, N. Quarto, C.H. Contag, B. Wu, M.T. Longaker, Adipose-derived adult stromal cells heal critical-size mouse calvarial defects, Nat. Biotechnol. 22 (5) (2004) 560–567, https:// doi.org/10.1038/nbt958. [38] A.A. Sawyer, S.J. Song, E. Susanto, P. Chuan, C.X. Lam, M.A. Woodruff, D.W. Hutmacher, S.M. Cool, The stimulation of healing within a rat calvarial defect by mPCL-TCP/collagen scaffolds loaded with rhBMP-2, Biomaterials 30 (13) (2009) 2479–2488, https://doi.org/10.1016/j.biomaterials.2008.12.055. [39] J. Liu, F. Yu, Y. Sun, B. Jiang, W. Zhang, J. Yang, G.T. Xu, A. Liang, S. Liu, Concise reviews: characteristics and potential applications of human dental tissue-derived mesenchymal stem cells, Stem Cells 33 (3) (2015) 627–638, https://doi.org/10. 1002/stem.1909. [40] J. Botelho, M.A. Cavacas, V. Machado, J.J. Mendes, Dental stem cells: recent progresses in tissue engineering and regenerative medicine, Ann. Med. 49 (8) (2017) 644–651, https://doi.org/10.1080/07853890.2017.1347705. [41] P. Ercal, G.G. Pekozer, G.T. Kose, Dental stem cells in bone tissue engineering: current overview and challenges, Adv. Exp. Med. Biol. 1107 (2018) 113–127, https://doi.org/10.1007/5584_2018_171.
montreal QC, Canada: microribbon-based hydrogels accelerate stem cell-based bone regeneration in a mouse critical-size cranial defect model, J. Biomed. Mater. Res. A 104 (6) (2016) 1321–1331, https://doi.org/10.1002/jbm.a.35715. L. Elkhateb, A. Zohdy, S.S. Atalla, M.H. Moussa, G.G. Hamam, F. Zahra, Comparative study on acellular dermal graft versus propylene mesh both either loaded or unloaded with BM-MSCs in healing of skull bone defect in rats: histological and immunohistochemical study, Int. J. Stem Cells 11 (2) (2018) 216–226, https://doi.org/10.15283/ijsc18019. C. Huang, V.P. Ness, X. Yang, H. Chen, J. Luo, E.B. Brown, X. Zhang, Spatiotemporal analyses of osteogenesis and angiogenesis via intravital imaging in cranial bone defect repair, J. Bone Miner. Res. 30 (7) (2015) 1217–1230, https://doi.org/10. 1002/jbmr.2460. H.X. Deng, Y. Wang, Q.R. Ding, D.L. Li, Y.Q. Wei, Gene therapy research in Asia, Gene Ther. 24 (9) (2017) 572–577, https://doi.org/10.1038/gt.2017.62. R. Okawa, O. Iijima, M. Kishino, H. Okawa, S. Toyosawa, H. Sugano-Tajima, T. Shimada, T. Okada, K. Ozono, T. Ooshima, K. Nakano, Gene therapy improves dental manifestations in hypophosphatasia model mice, J. Periodontal. Res. 52 (3) (2017) 471–478, https://doi.org/10.1111/jre.12412. K. Gupta, S. Singh, K.N. Garg, Gene therapy in dentistry: tool of genetic engineering. Revisited, Arch. Oral Biol. 60 (3) (2015) 439–446, https://doi.org/10.1016/j. archoralbio.2014.11.018. A. Atasoy-Zeybek, G.T. Kose, Gene therapy strategies in bone tissue engineering and current clinical applications, Adv. Exp. Med. Biol. 1119 (2018) 85–101, https://doi. org/10.1007/5584_2018_253. F. Zhang, W.X. Peng, L. Wang, J. Zhang, W.T. Dong, J.H. Wu, H. Zhang, J.B. Wang, Y. Zhao, Role of FGF-2 transfected bone marrow mesenchymal stem cells in engineered bone tissue for repair of avascular necrosis of femoral head in rabbits, Cell. Physiol. Biochem. 48 (2) (2018) 773–784, https://doi.org/10.1159/000491906. O. Sugiyama, D.S. An, S.P. Kung, B.T. Feeley, S. Gamradt, N.Q. Liu, I.S. Chen, J.R. Lieberman, Lentivirus-mediated gene transfer induces long-term transgene expression of BMP-2 in vitro and new bone formation in vivo, Mol. Ther. 11 (3) (2005) 390–398, https://doi.org/10.1016/j.ymthe.2004.10.019. S. Srouji, D. Ben-David, O. Fromigue, P. Vaudin, G. Kuhn, R. Muller, E. Livne, P.J. Marie, Lentiviral-mediated integrin alpha5 expression in human adult mesenchymal stromal cells promotes bone repair in mouse cranial and long-bone defects, Hum. Gene Ther. 23 (2) (2012) 167–172, https://doi.org/10.1089/hum. 2011.059. L. Xu, K. Lv, W. Zhang, X. Zhang, X. Jiang, F. Zhang, The healing of critical-size calvarial bone defects in rat with rhPDGF-BB, BMSCs, and beta-TCP scaffolds, J. Mater. Sci. Mater. Med. 23 (4) (2012) 1073–1084, https://doi.org/10.1007/ s10856-012-4558-x.
10