Substrate mechanics dictate cell-cell communication by gap junctions in stem cells from human apical papilla

Journal Pre-proof

Substrate mechanics dictate cell-cell communication by gap junctions in stem cells from human apical papilla Chenchen Zhou , Demao Zhang , Wei Du , Jing Zou , Xiaobing Li , Jing Xie PII: DOI: Reference:

S1742-7061(20)30120-3 https://doi.org/10.1016/j.actbio.2020.02.032 ACTBIO 6606

To appear in:

Acta Biomaterialia

Received date: Revised date: Accepted date:

11 November 2019 31 January 2020 20 February 2020

Please cite this article as: Chenchen Zhou , Demao Zhang , Wei Du , Jing Zou , Xiaobing Li , Jing Xie , Substrate mechanics dictate cell-cell communication by gap junctions in stem cells from human apical papilla, Acta Biomaterialia (2020), doi: https://doi.org/10.1016/j.actbio.2020.02.032

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Ltd on behalf of Acta Materialia Inc.

Original article Substrate mechanics dictate cell-cell communication by gap junctions in stem cells from human apical papilla

Chenchen Zhou1, Demao Zhang1, Wei Du1, Jing Zou1, Xiaobing Li1, Jing Xie1*

1. State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, CHINA.

*Corresponding author: Jing Xie, Professor of State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University Chengdu Sichuan 610064, CHINA Tel: 86-28-85503469; Email: [email protected]

ABSTRACT It is recognized that the interaction between cells and their physical microenvironment plays a fundamental role in controlling cell behaviors and even in determining cell fate. Any change in the physical properties of the extracellular matrix (ECM), such as its topography, geometry, and stiffness, controls this interaction. In the current study, we revealed a potent interconnection between the cellmatrix interaction and cell-cell communication that is mediated by interface stiffness, and elucidated this process in stem cells from human apical papilla (hSCAPs) in terms of mechanosensing, mechanotransduction, and gap junction-mediated cell-cell communication. We first fabricated

polydimethylsiloxane (PDMS) substrates with the same topography and geometry but different stiffnesses and found that the cell morphology of the hSCAPs actively changed to adapt to the difference in substrate stiffness. We also found that the hSCAPs secreted more fibronectin in response to the stiff substrate. The focal adhesion plaques were changed by altering the expression of focal adhesion kinase (FAK) and paxillin. The FAK and paxillin bound to connexin 43 and, as a result, altered the gap junction formation. By performing a Lucifer yellow transfer assay, we further confirmed that the interface stiffness mediated cell-cell communication in living hSCAPs through changes in gap junction tunnels. The intrinsic mechanism that mediated cell-cell communication by extracellular stiffness show the great influence of the interaction between cells and their external physical microenvironment and stress the importance of microenvironmental mechanics in organ development and diseases.

Keywords: Substrate compliance, Stem cells from human apical papilla, Gap junction, Cell-matrix interaction

Statement of Significance Biochemical factors could direct cell behaviors such as cell proliferation, migration, differentiation, cell cycling and apoptosis. Likewise, biophysical factors could also decide cell behaviors in all biological processes. In the current study, we revealed a potent interconnection between the cell-matrix interaction and cell-cell communication by elucidating the whole process from cell mechanosensing, mechanotransduction to gap junction-mediated cell-cell communication. This process happens in a collective of cells but not in that of a single cell. Biophysical properties of ECM - induced cell-to-cell communication indicates the importance of microenvironmental mechanics in organ development and diseases. These findings should be of great interest in all biological fields, especially in biomaterials - cell/molecular biology involved in the interactions between the cell and its matrix.

1. Introduction It is well recognized that cells coordinate their behaviors during biological processes largely through the mechanical properties of the external micro-environment [1]. In contrast to that of a single cell, the behaviors of a collective of cells was found to rely on cellular interaction with both the surrounding extracellular matrix (ECM) and neighboring cells [1, 2]. In their interaction with the ECM, cells sense the mechanical properties of the surrounding microenvironment, such as topography, geometry and stiffness, and respond to them by changing their shape, viability, adhesion, proliferation, migration and differentiation, which finally lead to the alteration of tissue morphogenesis and homeostasis [3]. Furthermore, in the process of the cell-matrix interaction, cells simultaneously communicate with each other by responding either to the mechanical deformations generated by their neighbors or to the changes in the mechanical properties of the ECM caused by neighboring cells. This mutual communication between cell and matrix and between cells provides an innovative method that allows cells to share information and to act with their neighbors in a cooperative way [4]. Stem cells from apical papilla (SCAPs), a subpopulation of mesenchymal stem cells (MSCs) that is isolated from apical tissues of immature permanent teeth in humans and expresses stem markers, STRO-1, CD73, CD90 and CD105, have recently gained much attention in bioengineering due to their great advantages in colony formation, self-renewal, and multi-differentiation capacity toward osteogenesis, odontogenesis, adipogenesis, neurogenesis and angiogenesis [5, 6]. However, research on SCAPs has been confined to the phenotype level, and the understanding of the mechanisms involved in cell-matrix and cell-cell interactions have remained elusive. Many reports on stem cells have elucidated the important role of ECM mechanical properties in cell behaviors. For example, Le N et al. indicated that an increase in hydrogel stiffness resulted in increased initial adhesion, migration and proliferation in human MSCs [7]. Pek YS et al. found that the highest expression of neural (ENO2), myogenic (MYOG) and osteogenic (Runx2, OC) transcription factors were identified in thixotropic 3D gels with tau(y) values of 7, 25 and 75 Pa, respectively [8]. Engler et al. revealed that exposure of BMSCs to biointerfaces with low, intermediate, and high stiffnesses could direct cells to commit to adipogenic, myogenic, and osteogenic lineages, respectively [9]. In our previous study, we began to explore the mechanism of β-catenin translocation during the differentiation of adipose-derived stromal cells (ASCs) in response to substrate stiffness [10].

However, the exact mechanisms involved in mechanosensing and mechanotransduction in cell-matrix interactions in stem cells needs further elucidation. Although the literature on cell-matrix and cell-cell interactions is rapidly growing, most reports have been focused in a few aspects or components of the problem, such as the functions of individual proteins, ECM membrane receptors and focal adhesions (FA) and the differentiated phenotypes acquired by stem cells during osteogenesis and adipogenesis [2]. The accumulated progress in the field indicates that more efforts should be focused on integrating different components of the problem into a more systematic and comprehensive understanding of active mechanotransduction by cells. Investigating matrix-mediated mechanical cell-cell communication is experimentally challenging because it is difficult to isolate its specific contribution to cell behaviors from that of all other modes of communication, such as chemical cascading, electrical coupling and direct cell (contact) coupling [4, 11]. In this study, we used polydimethylsiloxane (PDMS) compliant substrates and RNA sequencing data to experimentally reveal the processes involved in gap junction-induced intracellular communication changes in hSCAPs that were mediated by substrate compliance. Elucidation of the process that extends from cell mechanosensing and mechanotransduction to gap junction-induced cell-cell communication provides us with increased understanding of the intrinsic mechanisms involved in the interaction between the cell and the matrix, which may ultimately determine the cell fate.

2. Method and materials 2.1. Chemical Reagents All routine chemical reagents were purchased from Sigma-Aldrich Corp (St. Louis, MO), unless otherwise indicated. The specific antibodies purchased from Abcam (Cambridge, UK) included: anti-alpha tubulin (ab64503), anti-beta tubulin (ab7792), anti-FAK (ab219363), anti-paxillin (ab32084), anti-connexin 43/GJA1 (ab11370), anti-COL1A1 (ab34710), anti-COL1A2 (ab96723), anti-MMP2 (ab37150). The secondary anti-bodies include: Goat Anti-Mouse IgG H&L (Alexa Fluor® 488) (ab150113), Goat Anti-Mouse IgG H&L (Alexa Fluor® 647) (ab150115), Donkey Anti-Rabbit IgG H&L (Alexa

Fluor® 488) (ab150073), Donkey Anti-Rabbit IgG H&L (Alexa Fluor® 647) (ab150075). The specific antibodies purchased from Santa Cruz Biotech (Delaware Avenue, CA) include: β-Actin (C4) (sc-47778) and the secondary anti-bodies includes: m-IgGκ BP-HRP (sc-516102) and mouse antirabbit IgG-HRP (sc-2357). Anti-ITGB3 is purchased from Sigma (Ab-773). Fibronectin and FITClabeled phalloidin were purchased from Thermo Fisher Scientific (FBN11, MA5-11981, Waltham, MA). The specific protein regents included: the protein sample buffer (2× Laemmli Sample Buffer, No.1610737) were from Bio-Rad (Hercules, CA). The western blotting luminol reagent (sc-2048) was from Santa Cruz Biotech. Polyvinylidene difluoride (PVDF, Immobilon® Membranes, Sandwiches and Blotting Filter Paper) was purchased from Millipore (Billerica, MA). The specific gene reagents included the mRNA extract kit (the RNeasy Plus Mini Kit, No.74136) was purchased from Qiagen (Valencia, CA, USA). DNAse I enzyme was from Mbi (Glen Burnie, MD). The cDNA synthesis (RevertAid H Minus First Strand cDNA Synthesis Kit, No. K1632) was from Thermo Fisher Scientific. The TOPO II TA Cloning Kit for sequencing (K457501SC) was from Invitrogen (Carlsbad, CA). qPCR kit (SYBR® Premix Ex Taq™ II, No. RR82WR) was from TaKaRa (Tokyo, Japan). 2.1. Cell isolation and culture The dental materials used in this study were obtained according to the ethical principles, and the protocol was reviewed and approved before experiments began by our Institutional Review Board (IRB at the West China Hospital of Stomatology, No. WCHSIRB-D-2017-029). Human SCAPs were collected from the immature third molar of 16~18 year-old patients without caries as described [75]. The collected tissue was cut into 2 × 2 × 2 mm and washes in an aseptic 1 × PBS with 5% antibiotics and digested in 0.5% type I collage (C0130, Sigma, w/v) solution dissolved in α-MEM (HyClone, Logan, UT, USA , Supplemented with 0.1 mM non-essential amino acids, 4 mM L-glutamine, 1% antibiotics) for 3 h at 37 °C. Fresh 10% FBS α-MEM were then added by the same volume to neutralize protease solution. The suspension was collected in a 15 ml tube and was centrifuged at 1000 rpm for 5 min. After the removal of supernatant, the collected cells (8 × 10 5 primary cells per 2 × 2 × 2 mm papilla tissue) were re-suspended with fresh 10% FBS α-MEM. The

hSCAPs were cultured at 37 °C in 5% CO2 until the third passages. hSCAPs in Passage1-3 can be frozen into arrest with liquid nitrogen until use if necessary. 2.2. Preparation of compliant substrates For PDMS substrates, 1:5 and 1:45 ratios (curing agent (Sylgard 184, Corning, NY, USA) vs. oligomeric base) were mixed together onto single-well plate (Corning) to generate stiff/soft substrates as previously described [10, 12]. Elastomeric fluid mixtures were placed into the vacuum desiccator for 10 min to remove air bubbles, avoiding possible air bubbles left in the cured PDMS surface (or closed to PDMS surface). Subsequently, the single-well plates with elastomeric fluid mixtures were cured at 60 °C for 3 h. The PDMS substrates were fabricated. For 35 and 60 mm single-well plates, the PDMS thickness coated was about 1.5 mm. For single-well plate used in immunofluorescence (Glass bottom cell culture dish, Lot: #801002, NEST Biotechnology Co.LTD.), PDMS thickness was approximately 0.5 mm. After the sterilization step carried out by exposing PDMS substrates to UV radiation for 1 h, PDMS substrates could be used followed by aseptic hydrophilicity treatment by dopamine coating (0.12mg/ml, w/v, in 1 mg/ml Tris). The PDMS substrates were coated by dopamine solution for 12 h. Then, dopamine solution was removed ,and PDMS substrates were ready for cell seeding after three times washing with 1× PBS [37]. 2.3 Cell seeding After PDMS substrates were prepared, hSCAPs were seeded onto the PDMS-coated singlewell plates in 10% FBS α-MEM. The cells were allowed 12 h to seed and equilibration. Then, 10% FBS α-MEM culture media were removed and replaced by 2% FBS α-MEM for 12 h for starvation. Next, the culture media were changed to be 1% FBS α-MEM and the experiment time was started [10, 12, 38, 39]. In different experimentations, the cell density is different. For the assays of gene (qPCR and RNA sequencing) and protein (Western blot), cells at a concentration of 1 × 106 per plate (35 mm single well, Corning) were seeded; for scrap loading and dye transfer assay, cells at a concentration of 1 × 106 per plate were seeded (35 mm single well); for single cell’ immunofluorescence, cells at a concentration of 1 × 105 per plate were seeded (35 mm single well); for Co-IP, cells at a concentration of 2.5 × 106 per plate were seeded (60 mm single well). 2.4 Young’s modulus measurements of PDMS substrates

Young’s modulus detection was carried out by ElectroForce 3100 test instrument (Bose, Shanghai, China) [10, 12]. The detailed parameters included the following: a spherical indenter 3 mm in radius was in use; the loading procedures were achieved by displacement control (the maximum indentation depth was set to be 3 mm and the loading rate was set at 2 mm / s); the candidate PDMS substrates had a diameter of 55 mm and height of 15 mm. The depth-indentation load curves were generated and recorded based on the six measurement points at different positions of the sample. The primary shear modulus was generated by fitting the load curves up to different ratios of h/R using the Hertzian solution and the Hyperelastic solution [10]. P

16 h E Rhh (1  0.15 ) 9 R

where E represents the Young’s modulus, P presents the indentation load, h presents the indentation depth and R presents the indenter radius. 2.5. Atomic force microscopy (AFM) The AFM test was described in our previously published paper [10]. Briefly, the PDMS films with different stiffness were recorded in tapping mode with 512 × 512 pixel or 1024 × 1024 data. The scan speed was controlled at 1 Hz. The topographic image was obtained according to the standard silicon tip on a cantilever beam. The spring constant of the cantilever was 50 pN/nm, and its length was 125 lm, with a resonant frequency of 300 kHz. 2.6. Scanning electron microscope (SEM) The SEM test was described in our previously published paper [13]. Briefly, the hSCAPs were fixed by Glutaraldehyde (2.5%, v/v) for 1-2 h. The samples were then dehydrated in gradient by ethylalcohol from 50% to 100%. The samples were spouted with a layer of gold powder and then scanned by SEM. 2.7. RNA sequencing The hSCAPs were cultured onto stiff and soft PDMS substrates (at a concentration of 1 × 10 6 per plate, 35 mm single well) for 12 h, and followed starvation for 12 h in 2% FBS α-MEM. The cells were cultured in 1% FBS α-MEM for 72 h. Cell lysate samples (cell confluence reached up to 95%) were collected using Trizol (No. 15596-026, Thermo Fisher Scientific). Three independent repeats

based on different hSCAPs from immature third molars of different patients were carried out. The cell samples were sent for transcriptome analysis at Shanghai Lifegenes Biotechnology CO., Ltd (Shanghai, China). Before transcriptome sequencing, the RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), A total amount of 1.5 µg RNA per sample was used as the input material for the RNA sample detection according to the manufacturer's instruction. The clustering of the index-coded samples was performed on a cBot Cluster Generation System using HiSeq 4000 PE Cluster Kit (Illumia, San Diego, CA, USA). Raw data (raw reads) of fast q format were firstly processed through in-house perl scripts. In this step, clean data (clean reads) were obtained by removing reads containing adapter, reads containing ploy-N and low quality reads from raw data. Paired-end clean reads were aligned to the reference genome using HISAT2 v2.1.0. In data analysis, HTSeq v0.6.1 was used to count the reads numbers mapped to each gene. Gene FPKMs were computed by summing the FPKMs of transcripts in each gene group. The differential expressed genes were based on Gene Ontology (GO) and KEGG enrichment analysis. GO enrichment analysis of differentially expressed genes was obtained through DAVID database. GO terms with P-value less than 0.05 were considered significantly enriched by differential expressed genes. KEGG is a database resource for understanding high-level functions and utilities of the biological system. We used KOBAS v3.0 software to test the statistical enrichment of differential expression genes in KEGG pathways. KEGG terms with P-value less than 0.05 were considered significantly enriched by differential expressed genes. In differential expression analysis, differential expression analysis (Soft substrate group vs stiff substrate group) was performed using the DESeq2 R package (1.26.0). P value < 0.05 and |FoldChange| ≥ 1.5 were set as the threshold for significantly differential expression. 2.8. Quantitative Real-Time PCR (qPCR) hSCAPs were cultured onto soft and stiff substrates at a concentration of 1 × 10 6 per plate (35 mm single well). Cells were allowed 12 h to seed and equilibration. Then 10% FBS α-MEM culture media were removed and replaced by 2% FBS α-MEM for 12 h for starvation. The culture media were changed to be fresh 1% FBS α-MEM. We collected cell samples on soft and stiff substrates after 3 day’s culture. Total RNA was isolated using the Pure RNA Isolation Kit (RP5611, Bioteke Corporation, Peking, China) after removal of potential PDMS debris by centrifuging the sample in a 1.5 ml tube

(Aseptic RNase free tube, Coring) at 12000 rpm, 4°C for 15 min. RNA was dissolved in RNAse-free water and its concentration was measured by Nano Drop® spectrophotometer (NANODROP 2000, Thermo). RNA samples were then treated with DNAse I (Mbi, Glen Burnie, MD), and the first strand cDNA was synthesized to form a final volume of 20 μl by using 5 μg of total RNA in each sample according to manufacturer’s instructions (RevertAid H Minus First Strand cDNA Synthesis Kit, No. K1632, Thermo Fisher Scientific). qPCR was used to confirm the related gene changes in ECM-receptor interaction, focal adhesion, intracellular transduction and gap junction pathways. In brief, qPCR was performed by amplifying the gene products with a mixed 25μl system containing 1μl cDNA, 12.5 μl SYBR Green I -PCR master mix (Takara), 1μl forward and 1 μl reverse primer (10 μM) and 9.5μl DDH 2O. The reaction was started at 95°C pre-denaturation for 10 minutes, followed by 45 cycles of melting (95°C, 5 sec), annealing (60°C, 10~15 sec) and elongation (72°C, 10~15 sec). Each gene was performed in triplicate. The primer pairs were designed on table 1. The fold change was calculated by cycle threshold (∆∆CT) method. Glyceraldehydes-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. 2.9. Western Blot hSCAPs were cultured onto soft and stiff substrates at a concentration of 1 × 10 6 per plate (35 mm single well). Cells were allowed 12 h to seed and equilibration. Then, 10% FBS α-MEM culture media were removed and replaced by 2% FBS α-MEM for 12 h for starvation. Next, the culture media were changed to be fresh 1% FBS α-MEM. We collected cell samples on soft and stiff substrates after 3 day’s culture. The total protein was collected by RIPA Lysis Buffer (P0013C, Beyotime, Guangzhou, China) involving 1% PMSF (P7626, Sigma) after removal of potential PDMS debris by centrifuging the sample in a 1.5 ml tube (Aseptic RNase free tube, Coring) at 12000 rpm, 4°C for 15 min. quantified by BCA kit (Beyotime, Shanghai, China) and boiled for 5 min with protein sample buffer (No.1610737, Bio-Rad) at 1:1 ratio. The equal amounts of protein were separated by 10% SDS-PAGE and then transferred to PVDF membranes. After blocking with 5% non-fat milk for 1~2 h at RT, the primary antibody was added (Concentration dilution: for Abcam antibodies at ratio 1:1000, for Santa Cruz Biotech at ratio 1:500, other companies at 1:800, dependent on the specific antibody information) and incubated overnight. The secondary antibody was used according to the source of primary antibody the next day (Dilution: anti-mouse at ratio 1:5000 and anti-rabbit at ratio 1:3000,

Santa Cruz Biotech). β-actin (sc-47778, Santa Cruz Biotech) was used as the internal control. Immunoreactive blots were recorded by using Immobilon ® Western (P90719, Millipore). 2.10. Co-immunoprecipitation (Co-IP) hSCAPs were cultured onto soft and stiff substrates at a concentration of 2.5 × 10 6 per plate (60 mm single well). Cells were allowed 12 h to seed and equilibration. Then 10% FBS α-MEM culture media were removed and replaced by 2% FBS α-MEM for 12 h for starvation. After that, the culture media were changed to be fresh 1% FBS α-MEM. We collected cell samples on soft and stiff substrates after 3 day’s culture. Co-IP was performed by using Pierce Co-immunoprecipitation Kit (lot no. SB240573B) as previously described [14-16]. In brief, the cell lysates from cultured hSCAPs in stiff/soft PDMS substrates were collected by the IP Lysis/Wash buffer provided by the Kit. The bait protein (FAK, 15 μl × 0.98 μg/μl, and paxillin, 15 μl × 0.04 μg/μl) was firstly bound to resin, and then incubated with cell lysates for 2 h or overnight at 4°C (Recommended). The antigen (bait protein, FAK and paxillin) and the bounded proteins were collected by the centrifugal column provided by the kit. Through the elution process, the bounded proteins were collected at 50 μl elution buffer and quantified by BCA kit above (Beyotime). This collected bounded protein solution needs to be mixed at ratio 1:1 with 10% (1.5 M Tris-HCl, pH 8.8, v/v), 34% protein sample buffer (No.1610737, BioRad, v/v), 5% saturated dithiothreitol (DTT, v/v) and 1% protease inhibitor cocktail (P8340, Sigma, v/v), and then the mixture was boiled for 5 min. The samples were ready for western blots. FAK and paxillin were detected by using primary antibodies (dilution at 1:500) and secondary antibodies (dilution at 1:2000). The dosages used for prey proteins were as follows: Fibronectin (primary antibody: 1:200, secondary antibody: 1:2000); Col1a1/Col1a2 (primary antibody: 1:500, secondary antibody: 1:2000); MMP2 and β-actin (primary antibody: 1:1000, secondary antibody: 1:2000). Quantification of prey amounts was based on optical density (OD) value and was performed by ImageJ 2.0. 2.11. Immunofluorescence and confocal laser scanning microscopy (CLSM) hSCAPs were cultured onto soft and stiff substrates at a concentration of 1 × 10 5 per plate (35 mm single well). Cells were allowed 12 h to seed and equilibration. Then 10% FBS α-MEM culture media were removed and replaced by 2% FBS α-MEM for 12 h for starvation. The culture media were changed to be fresh 1% FBS α-MEM. After 3 days’ culture, the immunofluorescence was

performed following the previous method [17, 18]. The hSCAPs were washed with 1 × PBS three times and fixed with 4% paraformaldehyde (PFA) for 10 min and then permeabilized with 0.5% Triton X-100 for 5 min. Before blockage with 5% BSA for 2 h, the cells were needed to wash three times in 1 × PBS. After blockage, the cells were incubated with the primary antibody (dilution ratio 1:200, except for Cx43 1:400 and Fibronectin 1:100) for 2 h or overnight at 4°C. The secondary antibody (dilution ratio 1:200) was used to interact with the primary antibody for 2 h at RT (AlexaFluor647 was usually chosen to label the secondary antibody). The FITC-labeled labeled phalloidin for F-actin (Green) and Dapi (blue) were counterstained. Immunofluorescent images were recorded using CLSM (A1R MP+, Nikon, Tokyo, Japan and Olympus, FV3000, Japan). 2.12. Scrape loading and dye transfer Lucifer Yellow (LY, MW457, L0259, Sigma) was used for scrape loading/dye transfer based on the transfer capacity of LY small fluorescent molecular in the intercellular movement between cells through gap junctional intercellular communication (GJIC) as previously described [19-21]. The LY molecular cannot enter into the intact cells whereas it can be introduced into cells through transient tear in the cell membrane generated by scrape loading. In the study, the hSCAPs were seeded onto stiff/soft PDMS substrates with 60% confluence (at a concentration of 0.6 × 106 per 35 mm signal well) through cell counting. The cells were allowed 3 days to proliferate to reach to 95% ~ 100% confluence on stiff/soft substrates. Then, the cells were washed three times with 1 × Ca 2+-Mg2+ PBS (to improve the transmission efficiency of LY in living cells) and were scraped by a surgical blade to form a transient tear (Scratch wound). Lucifer Yellow at 1 mg/ml was immediately added at the sites of scratch wound, and recorded the time. Every 30 s, the samples were taken out and molecular transferring was stopped by fixation in 4% PFA for 10 min. The cell samples, in which the LY transferred for 90 180 until 630 sec, were collected and imaged by CLSM. 2.13. Statistical analysis The analyzed results are presented as mean ± SEM. All analyses were performed in at least biological triplicates (n = 3). Statistical analysis was achieved by one/two-way analysis of variance (ANOVA) to determine whether differences existed among groups. Post-hoc analysis used Fisher’s protected least significant differences (PLSD). In each analysis, significance levels were set at *p < 0.05, **p < 0.01, ***p < 0.001.

3. Results 3.1. Cell morphology changes in hSCAPs in response to stiff and soft substrates The two polydimethylsiloxane (PDMS) substrates were fabricated with 1:5 and 1:45 ratios (curing agent to oligomeric base) as previously described [10, 12]. The two PDMS substrates showed lower surface roughness than a normal Petri dish when characterized by AFM (Fig. 1A, surface topology) and Ra parameters (Fig.1B, surface roughness change). Before the cells were seeded onto these substrates, a hydrophilicity/hydrophobicity test (Fig.S1A-B) confirmed that the two substrates had the same water contact angle. Fourier transform infrared spectroscopy (FTIR) also confirmed the consistency of the chemical composition of the two substrates (Fig.S1C). However, the two PDMS substrates showed significant differences in stiffness based on Young’s modulus (Fig.1C). When we seeded the hSCAPs onto the PDMS substrates for 48 h, we first observed a change in cell morphology in response to these substrates by SEM (Fig.1D). We analyzed the cell spreading areas that contained approximately 400 cells in the stiff and soft substrate groups based on six independent experiments, and we found that the cell morphologies of the hSCAPs were altered in the soft substrate relative to those in the stiff substrate (Fig. 1E). The cytoskeletal changes were further confirmed by characterizing the changes in microfilaments and microtubules in response to substrate stiffness (Fig.2). For microfilaments, we found the changes in F-actin in hSCAPs in response to substrate stiffness by IF staining (Fig.2A and S2A). Fluorescent intensity quantification further confirmed the changes in hSCAPs in response to substrate stiffness (Fig. 2B). For microtubules, we showed changes of microtubules by characterizing α-tubulin (green) and β-tubulin (red) in hSCAPs in response to substrate stiffness (Fig.2C and S3A). Fluorescent intensity quantification further confirmed the changes in hSCAPs in response to substrate stiffness (Fig. 2D). Based on the high-low model (black and white) in CLSM, the textures of the microfilaments and microtubules could be further observed in both stiff and soft substrates (Fig.2E, S2 and S3). We next classified the cell population based on cell shape (Fig.2E, S2B and S3B). The cells were classified into three types: elongated (most cells that were found in the stiff group); spread and unrounded (most cells that were found in the soft group); spread and rounded cells. After cell

classification between stiff and soft substrates, we found that the elongated cells accounted for 68.75% of cells in the stiff group and 17.50% of cells in the soft group; spread and unrounded cells accounted for 27.60% and 70.20% of cells, respectively, and spread and rounded cells accounted for 3.65% and 12.30% of cells in the stiff and soft groups, respectively (Fig.2F and G). 3.2. Fibronectin enrichment in hSCAPs in response to stiff and soft substrates Extracellular matrix is mainly composed of two kinds of proteins. One is structural components involving collagens and glycoproteins [22], and the other is linkage proteins such as fibronectin and laminins [23]. Through RNA sequencing, we found that fibronectin (encoded by FN1 gene) was changed in hSCAPs in response to substrate stiffness for 72 h (hot map in Fig.3A, and fold changes in table S1). We then performed qPCR to confirm the gene changes at an earlier stage (48 h) (Fig. S4). At the protein level, we detected the changes of fibronectin (FBN11, Protein name abbreviation) by western blot (Fig.3B) and its quantification (Fig.3C). The changes of type I collagen detected at the gene level by qPCR (Fig.S2) and protein levels by western bolt (two subtypes, Fig.3B-C) were in accordance with the results of RNA sequencing (Fig.3A), although the changes were shown to be slightly weaker. To further characterize the expression of fibronectin in hSCAPs in response to substrate stiffness, we performed immunofluorescence assay (Fig.3D-H). At early stages of seeding (Fig.3D-24 h and 3E-60 h), the distribution of fibronectin was observed in the cytoplasm of single hSCAP. The expression of fibronectin was higher in the stiff group than that in the soft group (Fig.3E). Mature fibronectin was formed and distributed along the cytoskeleton (F-actin) indicated by the white and yellow arrows (Fig.3D and E). At 120 h after cell seeding, the cells had grown to full confluence, and the expression of fibronectin in hSCAPs in response to substrate stiffness was further detected (Fig.3F-H). It was found that more fibronectin accumulated in hSCAPs on the stiff substrate than that on the soft substrate. Furthermore, mature fibronectin had mainly formed in the gaps between two cells. This result was further demonstrated in Fig.3G and H. Finally, we quantified and analyzed the red fluorescence OD of approximately 200 hSCAPs in each group based on three independent experiments and we found that the fibronectin accumulation in the soft substrate group was reduced to 81.2% relative to that in the stiff substrate group (Fig.3I). 3.3. Substrate compliance induces changes in focal adhesion kinase (FAK) and paxillin in focal adhesion plaques.

Stiffness-induced changes in ECM connector, fibronectin, also triggered changes in integrin receptors (mainly integrin α5β1, α4β1 and αvβ3 [24]). In this study, the result of those changes could be detected for Itga1, Itga5, Itga7 and Itgb3 by RNA sequencing (Fig.3A). The qPCR results next confirmed the changes in the expression of Itgb3 but not Itgb1 (Fig.S4). Because integrin αvβ3 is the most important subtype of integrin receptors in terms of fibronectin in hSCAPs, we provided evidence to show the changes of integrin αvβ3 by IF satining (Fig.S5A-B) and by western blot (Fig.S5C-D). However, in the current study, the most interesting result concerned the direct interaction of fibronectin with FAK (Fig.4) and Paxillin (Fig.5), which demonstrated the interaction between the ECM-receptor pathway and the focal adhesion pathway. We first found that FAK in focal adhesion plaques had a strong interaction with fibronectin, a weak interaction with Col1α1, and no interaction with Col1α2 by Co-IP (Fig.4A). The interaction was stronger in the stiff group than in the soft group by Co-IP quantification (Fig.4B). Changes in the protein expression of FAK in hSCAPs by western blot (Fig.4C-D) further confirmed the above results (Fig.4A-B). We next examined the expression changes of FAK by IF staining (Fig.4E-F). IF results confirmed that FAK were higher expressed in the stiff group compared to that in the soft group (Fig.4F). We then found that paxillin, which is an adapter of focal adhesion (FA) that functions as a FAK partner and provides a molecular scaffold that allows for protein recruitment to FA [25], had a strong interaction with fibronectin, a weak interaction with Col1α1, and no interaction with Col1α2 by Co-IP (Fig.5A). This interaction was stronger in the stiff group than in the soft group in hSCAPs by Co-IP quantification (Fig.5B). Changes in the protein expression of paxillin in hSCAPs in response to substrate stiffness by western blot (Fig.5C-D) confirmed the above results (Fig.5A-B). Finally, by IF staining (Fig.5E-F), paxillin was confirmed to have a higher expression in the stiff group compared to that in the soft group. 3.4. Substrate compliance promotes a change in gap junction formation in hSCAPs and thereby influences cell-cell communication After analysis of RNA sequencing, we identified the top 9 genes in the gap junction pathways (hot map in Fig.7A, and fold changes in table S2). qPCR was performed to confirm the changes in these genes in hSCAPs in response to substrate stiffness (Fig.S6). Although there were four genes in the connexin family involved in the gap junction formation and its involved pathways (Fig.S6), the expression levels of Gja3 (Cx46), Gjb3 (Cx31) and Gjc3 (Cx29) were too low relative to that of Gja1 (Cx43) (Fig.6A). Thus, we focused on investigating the Cx43 in gap junction formation. We first

found that Cx43 had a direct interaction with FAK (Fig.6B) and paxillin (Fig.6D) by Co-IP. Quantification further confirmed that the interaction between FAK and Cx43 in the stiff substrate was stronger than that in the soft substrate (Fig.6C); meanwhile, the interaction between paxillin and Cx43 in the stiff substrate was also stronger than that in the soft substrate (Fig.6E). Changes in the protein expression of Cx43 in hSCAPs in response to substrate stiffness (Fig.6F-G) further validated the above results (Fig.6C and 6E). We further detected the distribution of Cx43 in hSCAPs in response to substrate stiffness by CLSM (Fig.6H). We found that Cx43 had a dot-like distribution in hSCAPs that was mainly scattered in the region of the nucleus and at the sites of junctions between the two cells (white arrows). Additionally, at the sites of gap junctions between the two cells, the expression and distribution of Cx43 were reduced in the soft group as compared to those in the stiff group, regardless of the presence of low, moderate, or higher confluence in hSCAPs seeded onto the PDMS substrates. At a lower cell confluence, the distribution of Cx43 was more dot-like at the gap junction sites between two cells in the stiff group (Fig.6H, white arrows in top right lane), while at a higher confluence, the dot-like distribution was replaced by a plaque-like distribution in the stiff group (Fig.6H, white arrows in the bottom right lane). However, in the soft group, even at a higher confluence, Cx43 exhibited an intense dot-like distribution (comparison shown in the boxed right lanes in Fig.6H). Finally, whether the stiffness-induced change in Cx43 could influence functional gap junctions in living cells and trigger differences in cell-cell communication was investigated (Fig. 7BG). By using scrape loading/dye transfer, we found that the Lucifer yellow molecular was transmitted faster among hSCAPs though functional gap junctions in the stiff group than in the soft group within 300 s after loading (Fig.7B). The number of fluorescent cells in the stiff substrate exhibiting by Lucifer yellow fluorescence along the direction of transmission was almost 4-fold greater than that in the soft substrate (Fig.7C). At the beginning of Lucifer yellow transmission, we measured the differences in transmission status in hSCAPs resulting from substrate stiffness at 90 s after loading (Fig.7D). The width between the yellow and white dotted lines showed that the transmission speed is greater in the stiff substrate than in the soft substrate. The number of fluorescent cells in this region of the stiff substrate was greater than that in the soft substrate. The fluorescent gap junctions were more integrated and brighter in the stiff group than in the soft group. After 630 s, we found that the transmission speed at the transmission terminal had decreased in both the stiff and soft substrates, but we also observed that the gap junctions exhibited greater fluorescence and were much greater in

number in the stiff group than in the soft group (Fig.7E, the right lanes). We recorded the response of the transmission widths in hSCAPs in both substrates every 90 s and compared the transmission distance in both the stiff and soft groups (Fig.7F). We found that the transmission speed in hSCAPs in the stiff substrate was faster than that in the soft substrate. In the saturated state, which occurred after transmission for 30 min, we found that more gap junctions were formed in the stiff substrate compared to the soft substrate (Fig.7G). The number of gap junctions that were formed was 1.56-fold greater in the stiff substrate than in the soft substrate (Fig.7H).

4. Discussion The interaction between the cell and the matrix is of great importance in controlling cell fate and all kinds of cell behaviours [1, 2, 26]. Any changes in either ECM properties or intracellular events affect this interaction. In the current study, we generated PDMS substrates with different stiffnesses and investigated stiffness-induced mechanical cell-cell interactions. hSCAPs actively changed their cell morphology and cytoskeleton in response to substrate stiffness and secreted more fibronectin in the presence of the stiff substrate. The changes in the focal adhesion complex were examined by characterizing the variations in FAK and paxillin. The FAK and paxillin bound to connexin 43 and, as a result, changed the gap junction formation. By a Lucifer yellow transfer assay, changes in cell-cell communication were finally confirmed in living cells. Although cell-cell communication is considered almost exclusively to have a chemical or electrical origin [4, 11], the mechanical communication transmitted via extracellular stiffness that was observed in this study shows the great influence of the interaction between the cell and its external mechanical properties. The experimentations performed in the current study were based on hSCAPs, which is one of the attractive candidate cells from oral science for tissue engineering and regenerative medicine. Because of its odontogenic origin, hSCAPs is also considered to be an attractive seed cell for tooth development and regeneration [40, 41]. Among primary Human dental stem cells, hSCAPs owns great advantage over its counterparts, such as dental pulp stem cells (DPSCs), stem cells from human exfoliated deciduous teeth (SHEDs) and periodontal ligament stem cells (PDLSCs), due to the strong

cell viability, great proliferation potential and multiple differentiation capacities towards angiogenic, adipogenic, osteogenic, chondrogenic and odontogenic lineages [14, 42-44]. Besides, as hSCAPs is originated from neural crest cells in ectoderm, it can not only express mesenchymal stem cell markers, such as CD73, CD90, CD105 and STRO-1, but also express neural-derived stem cell markers, such as nestin, tubulin βIII, neurofilament M, NeuN and glial fibrillary acidic protein [45-47]. In a rat spinal cord injury model, Medberry and his colleagues found that hSCAPs could promote the outgrowth of the trigeminal nerve and repair in hind leg muscles [48]. These reports indicate the great potential of hSCAPs in the field of neural engineering. Although the use of hSCAPs shows great potential in the fields of bioengineering and tissue regeneration, to understand the mechanisms involved in the interaction between cell and bio-interface seems to be urgent. hSCAPs first sense the mechanical properties in the ECM and quickly respond to it by changing their ECM components. The ECM is primarily composed of two main kinds of macromolecules: fibrous proteins, such as collagens and elastins, and glycoproteins, such as fibronectin, proteoglycans, and laminin [22]. Fibrous proteins provide a supportive framework within which all extracellular small molecules can be maintained. Additional glycoproteins function as bridges between structural ECM molecules to improve the integrity of this network and to connect the ECM to cells and to extracellular soluble proteins [23, 27]. Via RNA sequencing (Fig.S5), we extracted and revealed the gene profile changes in the ECM-receptor interaction and focal adhesion pathways (Fig.3A). Fibronectin (FN1) was one of the genes that showed expression changes. Although the expression of the genes encoding the collagen type I alpha 1 (Col1α1) and collagen alpha-2(I) chain (Col1α2) were also changed, the relevant proteins showed less change (Fig.3B and C). Immunofluorescence further confirmed the changes in the distribution of mature fibronectin, which is located mainly in the gap between cells. It has been reported that, once synthesized, fibronectin assembled into an integrin-dependent fibrillar network [28]. The integrin receptors in fibronectin mainly include integrin α5β1, α4β1 and αvβ3 [24]. In our study, we showed the changes in the most abundant receptor of fibronectin, integrin αvβ3, during the early stage after cell seeding onto substrates (Fig.S3). The changes in fibronectin and its receptors, which act as a “molecular glue”, finally affected the integrity and functionality of the ECM in hSCAPs in response to substrate stiffness.

Recent progress has emphasized the role of two main adhesion complexes in cell mechanosensitive processes: focal adhesions (FAs) and adherens junctions (AJs), which are the two main protein complexes involved in cell adhesion [3]. FAs are mainly responsible for sensing the external forces exerted by the ECM [29] and triggering cellular responses that are directly linked to cytoskeletal reorganization and the initiation of signalling cascades [30]. FAs are anchored to the ECM through receptors, including integrins, and are attached to the cytoskeleton through a complex set of linkages; thus, they mediate direct binding between the ECM and the cytoskeleton [31]. hSCAPs modulate cytoskeletal changes in response to substrate stiffness through FAs (Fig.2). We next detected changes in an important regulator, focal adhesion kinase (FAK), and an adapter, paxillin, that are found in FAs (Fig. 3A, 4 & 5) and showed the same changes in these as those in fibronectin (Fig.4C&D, 5C&D). Furthermore, we demonstrated the direct binding of fibronectin with FAK/paxillin (Fig. 4A&B, 5A&B). These results reflect the direct interplay between the focal adhesion and the ECM-receptor interaction pathways. It has been noted that the cellular response to substrate stiffness cannot be regarded as a simple change in the focal adhesion system but rather should be understood as a signal that could be sensed, amplified, and, most importantly, transduced into intracellular events capable of remodeling the cell behaviors [4, 32]. We extracted the gene profiles involved in gap junction pathways from the total microarray data (Fig.S7) obtained from hSCAPs in response to substrate stiffness and found that Gja1 (connexin 43) was the most abundant and highest (Fig.6A and 7A). Most interestingly, we found that connexin 43 has a direct relationship with FAK and paxillin (Fig.6B-E). Furthermore, the changes in connexin 43 showed the same trend as those in FAK and paxillin in hSCAPs in response to substrate stiffness. The changes in connexin 43 altered gap junction formations in the living hSCAPs (Fig.7BH) and changed cell-cell communication in hSCAPs in response to substrate stiffness, although other aspects were also shown to influence on this cell-cell communication. For example, the interaction of a cell adhesion with the ECM also triggers intracellular signaling pathways [33-36], such as MAPK, wnt, Yap and PI3k-Akt, and ultimately affects cell survival, differentiation, and proliferation, and even the cell cycle (Fig.8). The current study aimed to explore the influence of substrate stiffness on the changes of cell-cell communication in hSCAPs. There is another import physical factor, surface roughness, which has a great impact on cell responses. Previous papers have been shown that the surface roughness can

influence cell behaviors, such as migration [49], proliferation [50] and differentiation [51]. Additionally, the surface roughness was proven to be one of the essential factors governing osteointegration [52]. From this point, the roughness topography, as a physical cue on the bone surface, could induce the activity of osteoblasts in the process of bone resorption [53]. Whereas the surface roughness used above is limited to a range from the sub-micron to the micrometer (Ra, from at least 0.3 μm to 10 μm). Besides, for the surface roughness gradients, Tobias et al applied the surface roughness at ≥ 3 μ [54] and Faia-Torres et al employed the surface roughness at ≥ 500 nm [55]. In 2011, Bigerelle et al aimed to try to find out the threshold of surface roughness on influencing stem cells, and the range of roughnesses was limited to 1.2 μm ~ 21 μm (Ra) [56]. At nano scale, surface steps as small as 11 nm (Ra) could lead to contact guidance [57] and surface nanoposts as small as 13 nm (Ra) could increase cell spreading, proliferation and cytoskeletal formation [58]. But there has been no report involving in Ra below 10 nm (< 10 nm). It is deduced that the surface roughness as small as 10 nm could have very little effect on cell behaviors [18, 49, 59]. In our Fig. 1B, we showed the surface roughness was ~10 nm (Ra) in the petri dish and then found the surface roughness in soft and stiff PDMS substrates was smaller than that in the petri dish. This means that the impact of surface roughness in our study might be ignored. A long-term attention has been paid to cell differentiation triggered by matrix stiffness since Engler’s paper in 2006 [9]. This group found that exposure of BMSCs to substrates with low, intermediate and high stiffnesses could direct stem cells to adipogenic, myogenic and osteogenic differentiations, respectively. Later research studies went a step further to focus on the biomechanisms involved in stiffness-mediated cell differentiation. For osteogenic differentiation, Du et al elucidated the importance of Wnt signal in stiffness-mediated cell differentiation [60, 61]. Xie et al revealed that stiffness-induced osteogensis in stem cells was based on the β-catenin transduction from cytoplasm into nucleus and the promoter activation of Runx2 and Osx triggered by lef-1, the β-catenin downstream protein [10]. Bai et al reported the mechanical stiffness regulates the mineralization of dental papilla cells (DPCs) through fibronectin-paxillin-β-catenin axis [16]. For chondrogenic differentiation, Fernández-Muiños et al showed matrix stiffness could modulate spontaneous chondrogenic commitment of mouse embryonic fibroblasts [62]. Wang et al found the chondrogenic differentiation capacity of adipose-derived stromal cells greatly enhanced in hydrogels containing cartilage matrix proteins [63]. Zhan Xintang showed the chondrogenic differentiation of mesenchymal stem cells directly induced by matrix stiffness [64]. But the mechanism on stiffness-mediated

chondrogenic differentiation has been also poorly understood. For adipogenic differentiation, it was generally recognized that stiffness-induced adipogenesis of stem cells was dependent on the regulation of transcriptional factors, PPARγ and C/EBPα [10]. For angiogenic differentiation, Benayahu et al found that materials stiffness could modulate the expression of vascular endothelial growth factor (VEGFA), thus promotes angiogenesis [65]. Xie et al explored stiffness-mediated angiogenesis in adipose-derived stromal cells and revealed that angiogenesis is involved in the pathway of classical wnt/VEGF [18]. There has been some evidence to address the relationship between Cx43-mediated gap junction and cell differentiation. In osteogenesis, Talbot et al found that connexin43 intercellular communication could drive the early osteogenic differentiation of BMSCs [66]. Lin et al showed Cx43 could modulate osteogenic differentiation of bone marrow stromal cells through GSK3beta/beta-catenin signaling pathways [67]. In adipogenesis, connexin43 was dispensable for adipogenic differentiation due to its anti-senescence [68] and its phosphorylation level [69]. In angiogenesis, evidence was supported the positive correlation between Cx43 and angiogenic differentiation [70, 71]. In neurogenesis, Cx43 could modulate adult neurogenesis from neural progenitor cells due to its indispensable participation in establishment of neurogenic microenvironment [72, 73]. However, to our knowledge, there was only one paper mentioned the relevance between stiffness and Cx43 [74]. In our current study, we focused on the regulation of Cx43-medatied gap junction in hSCAPs in response to substrate stiffness and its intrinsic possible biomechanism. The research on the interaction between Cx43-mediated gap junction and cell differentiation will be conducted in future. There are some limitations of the current study. First, we isolated the hSCAPs from the immature third molar of 16~18 year-old patients without caries followed the procedure as previously described [75]. But we cannot guarantee the high purity of stem cells used in all experiments of the current study. Besides, although hSCAPs had been identified to express mesenchymal stem cell markers, such as STRO-1, CD73, CD90 and CD105 [45-47], we did not perform a detailed screen on stem cell markers in hSCAPs used in the current study. An urgent identification of mesenchymal stem cell markers is required in our future work. Second, we show the changes in hSCAPs in response to substrate stiffness, but this stiffness cannot represent a real alteration in the extracellular matrix. The microenvironment where cells reside is far more complicated than can be achieved by simple

mimicry. The different topographies and geometries formed by different molecular components, combined with chemical factors, are all important factors that determine the cell behaviors. Third, we extracted the most important pathway in the network that was involved in substrate complianceinduced cell-cell communication in gap junctions, and thereby elucidated the processes involved in mechanosensing, mechanotransduction, and ultimately gap junction-mediated cell-cell communication. However, there might be other pathways in the network that also have the potential to mediate substrate compliance-induced cell-cell communication in gap junction. These pathways must be considered when explaining the entire process.

Acknowledgements This study was supported by the National Natural Science Foundation of China (81600840, 81771047 to Jing Xie, 81901040 to Chenchen Zhou), China Postdoctoral Science Foundation (0040304153036) and Postdoctoral Foundation of Sichuan University Grant (20826041C4102). We acknowledged Dr. Chenghui Li in the Analytical and Testing Centre of Sichuan University for her excellent assistance in CLSM imaging. We also acknowledged Mr. Jiwei Li at Shanghai Lifegenes Biotechnology CO., Ltd (Shanghai, China) for his help in RNA sequencing analysis.

Contributions Chenchen Zhou and Jing Xie designed the study; Chenchen Zhou, Demao Zhang, and Jing Xie collected data; Wei Du, Jing Zou and Jing Xie analyzed and interpreted the data; Chenchen Zhou and Xiaobing Li drafted the manuscript; Jing Xie made a critical revision and final approved the manuscript.

Disclosure of potential conflicts of interest The authors declare that no competing interests exist.

Other supplementary materials

The supplementary figures are attached in Supplementary Information-I. The original key data are attached in Supplementary Information-II.

Reference [1] B. Ladoux, R.M. Mège, Mechanobiology of collective cell behaviours, Nat Rev Mol Cell Biol. 18(2017) 743-757. [2] B. Chen, B. Ji, H Gao, Modeling Active Mechanosensing in Cell-Matrix Interactions, Annu. Rev. Biophys. 44(2015) 1-32. [3] M Bosch-Fortea, F. Martín-Belmonte, Mechanosensitive adhesion complexes in epithelial architecture and cancer onset, Curr. Opin. Cell. Biol. 50(2018) 42-49. [4] L. Sapir, S Tzlil, Talking over the extracellular matrix: How do cells communicate mechanically? Semin. Cell. Dev. Biol. 71(2017) 99-105. [5] J Li, W Tian, J Song, Proteomics Applications in Dental Derived Stem Cells, J. Cell. Physiol. 232(2017) 1602-1610. [6] J Liu, F Yu, Y Sun, B Jiang, W Zhang, J Yang, G.T. Xu, A Liang, S. Liu, Concise reviews: Characteristics and potential applications of human dental tissue-derived mesenchymal stem cells, Stem Cells. 33(2015) 627-638. [7] N.N.T. Le, S. Zorn, S.K. Schmitt, P. Gopalan, W.L. Murphy, Hydrogel arrays formed via differential wettability patterning enable combinatorial screening of stem cell behavior, Acta Biomater. 34(2016) 93-103. [8] Y.S. Pek, A.C. Wan, J.Y. Ying, The effect of matrix stiffness on mesenchymal stem cell differentiation in a 3D thixotropic gel, Biomaterials. 31(2010) 385-391. [9] A.J. Engler, S Sen, H.L. Sweeney, D.E. Discher, Matrix elasticity directs stem cell lineage specification, Cell. 126(2006) 677-689.

[10] J. Xie, D. Zhang, C. Zhou, Q. Yuan, L. Ye, X. Zhou, Substrate elasticity regulates adiposederived stromal cell differentiation towards osteogenesis and adipogenesis through β-catenin transduction, Acta Biomater. 79(2018) 83-95. [11] D. Voiry, R. Fullon, J. Yang, Castro E. Silva C. de Carvalho, R. Kappera, I. Bozkurt, D. Kaplan, M.J. Lagos, P.E. Batson, G. Gupta, A.D. Mohite, L. Dong, D. Er, V.B. Shenoy, T. Asefa, M. Chhowalla, The role of electronic coupling between substrate and 2D MoS2 nanosheets in electrocatalytic production of hydrogen, Nat. Mater. 15(2016) 1003-1009. [12]. J. Xie, Q. Zhang, T. Zhu, Y. Zhang, B. Liu, J. Xu, H. Zhao, Substrate stiffness-regulated matrix metalloproteinase output in myocardial cells and cardiac fibroblasts: implications for myocardial fibrosis, Acta Biomater. 10(2014) 2463-2472. [13] J. Xie, C. Zhou, D. Zhang, L. Cai, W. Du, X. Li, X. Zhou, Compliant Substratum Changes Osteocyte Functions: The Role of ITGB3/FAK/β-Catenin Signaling Matters, ACS Appl. Bio Mater. 1(2018) 792-801. [14] C. Zhou, D. Zhang, J. Zou, X. Li, S. Zou, J. Xie, Substrate Compliance Directs the Osteogenic Lineages of Stem Cells from the Human Apical Papilla via the Processes of Mechanosensing and Mechanotransduction, ACS. Appl. Mater. Interfaces. 11(2019) 26448-26459. [15] D. Zhang, C. Zhou, Q. Wang, L. Cai, W. Du, X. Li, X. Zhou, J. Xie, Extracellular Matrix Elasticity Regulates Osteocyte Gap Junction Elongation: Involvement of Paxillin in Intracellular Signal Transduction, Cell. Physiol. Biochem. 51(2018) 1013-1026. [16] M. Bai, J. Xie, X. Liu, X. Chen, W. Liu, F. Wu, D. Chen, Y. Sun, X. Li, C. Wang, L. Ye, Microenvironmental Stiffness Regulates Dental Papilla Cell Differentiation: Implications for the Importance of Fibronectin-Paxillin-β-Catenin Axis, ACS. Appl. Mater. Interfaces. 10(2018) 2691726927. [17] C. Zhou, Q. Wang, D. Zhang, L. Cai, W. Du, J. Xie, Compliant substratum modulates vinculin expression in focal adhesion plaques in skeletal cells, Int. J. Oral. Sci. 11(2019) 18. [18] J. Xie, D. Zhang, Y. Ling, Q. Yuan, Z. Chenchen, D. Wei, X. Zhou, Substrate elasticity regulates vascular endothelial growth factor A (VEGFA) expression in adipose-derived stromal cells: Implications for potential angiogenesis, Colloids. Surf. B. Biointerfaces. 175(2019) 576-585.

[19] Q Wang, C. Zhou, X. Li, L. Cai, J. Zou, D. Zhang, J. Xie, W. Lai, TGF-β1 promotes gap junctions formation in chondrocytes via Smad3/Smad4 signalling, Cell Prolif. 52(2019) e12544. [20] W. Liu, Y. Cui, J. Sun, L. Cai, J. Xie, X. Zhou, Transforming growth factor-β1 up-regulates connexin43 expression in osteocytes via canonical Smad-dependent signaling pathway, Biosci. Rep. 38(2018). pii: BSR20181678. [21] Q Wang, C. Zhou, D. Zhang, J. Zou, W. Liu, L. Cai, Y. Cui, W. Lai, J. Xie, The involvement of the ERK-MAPK pathway in TGF-β1-mediated connexin43-gap junction formation in chondrocytes, Connect. Tissue. Res. 60(2019) 477-486. [22] J.K. Mouw, G. Ou, V.M. Weaver, Extracellular matrix assembly: a multiscale deconstruction, Nat. Rev. Mol. Cell. Biol. 15(2014) 771-785. [23] R.P. Mecham, Overview of extracellular matrix, Curr. Protoc. Cell. Biol. 2012, 10, Unit 10.1. [24] P. Singh, J.E. Schwarzbauer, Fibronectin and stem cell differentiation - lessons from chondrogenesis, J. Cell. Sci. 125(2012): 3703-3712. [25] S. Tatsumi, K. Ishii, N. Amizuka, M. Li, T. Kobayashi, K. Kohno, M. Ito, S. Takeshita, K. Ikeda, Targeted Ablation of Osteocytes Induces Osteoporosis with Defective Mechanotransduction, Cell Metab. 5(2007) 464-675. [26] M. van Dijk, S.A. Göransson, S. Strömblad, Cell to extracellular matrix interactions and their reciprocal nature in cancer, Exp. Cell. Res. 319(2013) 1663-1670. [27] T. Rozario, D.W. DeSimone, The extracellular matrix in development and morphogenesis: a dynamic view, Dev. Biol. 341(2010) 126-140. [28] Y. Mao, J.E. Schwarzbauer, Fibronectin fibrillogenesis, a cell-mediated matrix assembly process, Matrix. Biol. 24(2005) 389-399. [29] W.E. Discher, P. Janmey, Y.L. Wang, Tissue cells feel and respond to the stiffness of their substrate. Science. 310(2005) 1139-1143. [30] B.D. Hoffman, C. Grashoff, M.A. Schwartz, Dynamic molecular processes mediate cellular mechanotransduction, Nature. 475(2011) 316-323.

[31] P. Kanchanawong, G. Shtengel, A.M. Pasapera, E.B. Ramko, M.W. Davidson, H.F. Hess, C.M. Waterman, Nanoscale architecture of integrin-based cell adhesions, Nature. 468(2010) 580-584. [32] B. Geiger, J.P. Spatz, A.D. Bershadsky, Environmental sensing through focal adhesions, Nat. Rev. Mol. Cell. Biol. 10(2019) 21-33. [33] L. Hoffman, C.C. Jensen, M. Yoshigi, M. Beckerle, Mechanical signals activate p38 MAPK pathway-dependent reinforcement of actin via mechanosensitive HspB1, Mol. Biol. Cell. 28(2017) 2661-2675. [34] L.H. Brunt, K. Begg, E. Kague, S. Cross, C.L. Hammond, Wnt signalling controls the response to mechanical loading during zebrafish joint development, Development. 144(2017) 2798-2809. [35] Z. Meng, Y. Qiu, K.C. Lin, A. Kumar, J.K. Placone, C. Fang, K.C. Wang, S. Lu, M. Pan, A.W. Hong, T. Moroishi, M. Luo, S.W. Plouffe, Y. Diao, Z. Ye, H.W. Park, X. Wang, F.X. Yu, S. Chien, C.Y. Wang, B. Ren, A.J. Engler, K.L. Guan, RAP2 mediates mechanoresponses of the Hippo pathway, Nature. 560(2018) 655-660. [36] T. Wang, C. Thien, C. Wang, M. Ni, J. Gao, A. Wang, Q. Jiang, R.S. Tuan, Q. Zheng, M.H. Zheng, 3D uniaxial mechanical stimulation induces tenogenic differentiation of tendon-derived stem cells through a PI3K/AKT signaling pathway, FASEB J. 32(2018) 4804-4814. [37] T. Zhang, T. Gong, J. Xie, S. Lin, Y. Liu, T. Zhou, Y. Lin, Softening substrates promote chondrocytes phenotype via RhoA/ROCK pathway, ACS Appl Mater Interfaces. 8(2016) 2288422891. [38] J. Xie, C.L. Wang, W. Yang, J. Wang, C. Chen, L. Zheng, K.L.P. Sung, X. Zhou. Modulation of MMP-2 and MMP-9 through connected pathways and growth factors is critical for extracellular matrix balance of intra-articular ligaments, J. Tissue Eng. Regen. Med. 12(2018) e550-e565. [39] J. Xie, C. Wang, D.Y. Huang, Y. Zhang, J. Xu, S.S. Kolesnikov, K.L. Sung, H. Zhao. TGF-beta1 induces the different expressions of lysyl oxidases and matrix metalloproteinases in anterior cruciate ligament and medial collateral ligament fibroblasts after mechanical injury, J. Biomech. 46(2013) 890-898.

[40] P. De Berdt, P. Bottemanne, J. Bianco, M. Alhouayek, A. Diogenes, Lloyd, Llyod A, J. GerardoNava, G. A. Brook, V. Miron, G.G. Muccioli, A.D. Rieux. Stem cells from human apical papilla decrease neuro-inflammation and stimulate oligodendrocyte progenitor differentiation via activin-A secretion, Cell Mol. Life Sci. 75(2018) 2843-2856. [41] S. Hong, W. Chen, B. Jiang, A comparative evaluation of concentrated growth factor and platelet-rich fibrin on the proliferation, migration, and differentiation of human stem cells of the apical papilla, J. Endod. 44(2018) 977-983. [42] S. Na, H. Zhang, F. Huang, W. Wang, Y. Ding, D. Li, Y. Jin, Regeneration of dental pulp/dentine complex with a three-dimensional and scaffold-free stem-cell sheet-derived pellet, J. Tissue Eng. Regen. Med. 10(2016) 261-270. [43] J. Xu, B. Yu, C. Hong, C.Y. Wang, KDM6B epigenetically regulates odontogenic differentiation of dental mesenchymal stem cells, Int. J. Oral Sci. 5(2013) 200-205. [44] L. Peng, L. Ye, X.D. Zhou, Mesenchymal stem cells and tooth engineering, Int. J. Oral Sci. 1(2009):6-12. [45] A. Giuliani, A. Manescu, M. Langer, F. Rustichelli, V. Desiderio, F. Paino, A. De Rosa, L. Laino, R. d'Aquino, V. Tirino, G. Papaccio, Three years after transplants in human mandibles, histological and in-line holotomography revealed that stem cells regenerated a compact rather than a spongy bone: biological and clinical implications. Stem Cells Transl. Med. 2(2013) 316-324. [46] G.T. Huang, S. Gronthos, S. Shi, Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine, J. Dent. Res. 88(2009) 792-806. [47] A. Viswanath, J. Vanacker, L. Germain, J.G. Leprince, A. Diogenes, K.M. Shakesheff, L.J. White, A. des Rieux, Extracellular matrix-derived hydrogels for dental stem cell delivery, J. Biomed. Mater. Res. A. 105(2017) 319-328.

[48] C.J. Medberry, P.M. Crapo, B.F. Siu, C.A. Carruthers, M.T. Wolf, S.P. Nagarkar, V. Agrawal, K.E. Jones, J. Kelly, S.A. Johnson, S.S. Velankar, S.C. Watkins, M. Modo, S.F. Badylak, Hydrogels derived from central nervous system extracellular matrix, Biomaterials. 34(2013) 1033-1040. [49] W.L. Murphy, T.C. McDevitt, A.J. Engler, Materials as stem cell regulators, Nat. Mater. 13(2014) 547-557. [50] T.P. Kunzler, T. Drobek, M. Schuler, N.D. Spencer, Systematic study of osteoblast and fibroblast response to roughness by means of surface-morphology gradients, Biomaterials. 28(2007) 2175-2182. [51] A. Martins, M.L. Alves da Silva, S. Faria, A.P. Marques, R.L. Reis, N.M. Neves, The influence of patterned nanofiber meshes on human mesenchymal stem cell osteogenesis, Macromol Biosci. 11(2011) 978-987. [52] C.N. Elias, Y. Oshida, J.H. Lima, C.A. Muller, Relationship between surface properties (roughness, wettability and morphology) of titanium and dental implant removal torque, J. Mech. Behav. Biomed. Mater. 1(2008) 234-242. [53] T. Hefti, M. Frischherz, N.D. Spencer, H. Hall, F. Schlottig, A comparison of osteoclast resorption pits on bone with titanium and zirconia surfaces, Biomaterials. 31(2010) 7321-7331. [54] P.K. Tobias, D. Tanja, M.S. Christoph, S. Martin, D.S. Nicholas, Fabrication of materialindependent morphology gradients for high-throughput applications, Appl. Surf. Sci. 253 (2006) 2148-2153. [55] A.B. Faia-Torres, S. Guimond-Lischer, M. Rottmar, M. Charnley, T. Goren, K. Maniura-Weber, N.D. Spencer, R.L. Reis, M. Textor, N.M. Neves, Differential regulation of osteogenic differentiation of stem cells on surface roughness gradients, Biomaterials. 35(2014) 9023-9032. [56] M. Bigerelle, S. Giljean, K. Anselme, Existence of a typical threshold in the response of human mesenchymal stem cells to a peak and valley topography, Acta Biomater. 7(2011) 3302-3311.

[57] M.J. Dalby, M.O. Riehle, D.S. Sutherland, H. Agheli, A.S. Curtis, Use of nanotopography to study mechanotransduction in fibroblasts-methods and perspectives, Eur. J. Cell. Biol. 83(2004) 159169. [58] V. Vogel, M. Sheetz, Local force and geometry sensing regulate cell functions, Nat. Rev. Mol. Cell. Biol. 7(2006) 265–275. [59] C.C. Dupont-Gillain, I. Jacquemart, P.G. Rouxhet, Influence of the aggregation state in solution on the supramolecular organization of adsorbed type I collagen layers, Colloids Surf. B Biointerfaces. 43(2005) 179-186. [60] J. Du, X. Chen, X. Liang, G. Zhang, J. Xu, L. He, Q. Zhan, X.Q. Feng, S. Chien, C. Yang, Integrin activation and internalization on soft ECM as a mechanism of induction of stem cell differentiation by ECM elasticity, Proc. Natl. Acad. Sci. U S A. 108(2011) 9466-9671. [61] J. Du, Y. Zu, J. Li, S. Du, Y. Xu, L. Zhang, L. Jiang, Z. Wang, S. Chien, C. Yang, Extracellular matrix stiffness dictates Wnt expression through integrin pathway, Sci. Rep. 6(2016) 20395. [62] T. Fernández-Muiños, M. Suárez-Muñoz, M. Sanmartí-Espinal, C.E. Semino, Matrix dimensions, stiffness, and structural properties modulate spontaneous chondrogenic commitment of mouse embryonic fibroblasts, Tissue Eng. Part A. 20(2014) 1145-1155. [63] T. Wang, J.H. Lai, L.H. Han, X. Tong, F. Yang, Chondrogenic differentiation of adipose-derived stromal cells in combinatorial hydrogels containing cartilage matrix proteins with decoupled mechanical stiffness, Tissue Eng. Part A. 20(2014) 2131-2139. [64] X. Zhan, Effect of matrix stiffness and adhesion ligand density on chondrogenic differentiation of mesenchymal stem cells, J. Biomed. Mater. Res. A. 2019, doi: 10.1002/jbm.a.36847. [65] D. Benayahu, Y. Wiesenfeld, R. Sapir-Koren, How is mechanobiology involved in mesenchymal stem cell differentiation toward the osteoblastic or adipogenic fate? J. Cell Physiol. 234(2019) 1213312141.

[66] J. Talbot, R. Brion, A. Lamora, M. Mullard, S. Morice, D. Heymann, F. Verrecchia, Connexin43 intercellular communication drives the early differentiation of human bone marrow stromal cells into osteoblasts, J. Cell Physiol. 233(2018) 946-957. [67] F.X. Lin, G.Z. Zheng, B. Chang, R.C. Chen, Q.H. Zhang, P. Xie, D. Xie, G.Y. Yu, Q.X. Hu, D.Z. Liu, S.X. Du, X.D. Li, Connexin 43 Modulates Osteogenic Differentiation of Bone Marrow Stromal Cells Through GSK-3beta/Beta-Catenin Signaling Pathways, Cell Physiol. Biochem. 47(2018) 161175. [68] Q. Shao, J.L. Esseltine, T. Huang, N. Novielli-Kuntz, J.E. Ching, J. Sampson, D.W. Laird, Connexin43 is dispensable for early stage human mesenchymal stem cell adipogenic differentiation but is protective against cell senescence, Biomolecules. 9(2019) pii: E474. [69] A. Yeganeh, G.L. Stelmack, R.R. Fandrich, A.J. Halayko, E. Kardami, P. Zahradka, Connexin 43 phosphorylation and degradation are required for adipogenesis, Biochim. Biophys. Acta. 1823(2012) 1731-1744. [70] L. Li, H. Liu, C. Xu, M. Deng, M. Song, X. Yu, S. Xu, X. Zhao, VEGF promotes endothelial progenitor cell differentiation and vascular repair through connexin 43, Stem Cell Res. Ther. 8(2017) 237. [71] X. Fan, Y. Teng, Z. Ye, Y. Zhou, W.S. Tan, The effect of gap junction-mediated transfer of miR200b on osteogenesis and angiogenesis in a co-culture of MSCs and HUVECs, J. Cell Sci. 131(2018) pii: jcs216135. [72] M. Liebmann, A. Stahr, M. Guenther, O.W. Witte, C. Frahm, Astrocytic Cx43 and Cx30 differentially modulate adult neurogenesis in mice, Neurosci. Lett. 545(2013) 40-45. [73] A.B. Salmina, A.V. Morgun, N.V. Kuvacheva, O.L. Lopatina, Y.K. Komleva, N.A. Malinovskaya, E.A. Pozhilenkova, Establishment of neurogenic microenvironment in the neurovascular unit: the connexin 43 story. Rev. Neurosci. 25(2014) 97-111. [74] Y. Xu, S. Patnaik, X. Guo, Z. Li, W. Lo, R. Butler, A. Claude, Z. Liu, G. Zhang, J. Liao, P.M. Anderson, J. Guan, Cardiac differentiation of cardiosphere-derived cells in scaffolds mimicking morphology of the cardiac extracellular matrix, Acta. Biomater. 10(2014) 3449-3462.

[75] W. Sonoyama, Y. Liu, D. Fang, T. Yamaza, B.M. Seo, C. Zhang, H. Liu, S. Gronthos, C.Y. Wang, S. Wang, S. Shi. Mesenchymal stem cell-mediated functional tooth regeneration in swine. PLoS One. 1(2006) e79.

Figure legends Figure 1. Cell morphology changes in hSCAPs in response to stiff and soft PDMS substrates. (A) Representative AFM images showing the topological surfaces of stiff and soft PDMS substrates. “Petri dish” denotes the topological surface of a conventional single-well dish made of polystyrene. “Stiff substrate” denotes the topological surfaces generated by 1:5 PDMS (curing agent vs. oligomeric base). “Soft substrate” denotes the topological surfaces generated by 1:45 PDMS. The representative topographic image was based on those obtained from six independent experiments (n = 6). (B) Histogram showing the surface roughness, characterized by the Ra parameter, in the stiff and soft PDMS substrates groups relative to the Petri dish group. The statistics were based on the results obtained from six independent experiments (n = 6). *, p < 0.05. (C) Histogram showing the changes in Young’s modulus in stiff and soft PDMS substrates. The data shown were obtained from three independent experiments (n = 3). *, p < 0.05. (D) Representative SEM images showing the cell morphological changes in hSCAPs in response to PDMS substrates with different stiffnesses. The cells were seeded onto the substrates for 48 h. The SEM images were obtained from six independent experiments (n = 6). (E) Cell spreading areas were calculated and quantified. The cell numbers used in the calculations were ranged up to 200 in each group, and the statistics were generated based on the indiscriminate cells on the PDMS substrates. *Significant difference between the two groups: p = 0.00578.

Figure 2. The cell cytoskeletal changes in response to stiff and soft substrates. (A) Representative immunofluorescent staining showing the variations in microfilaments characterized via F-actin staining in hSCAPs in response to stiff and soft substrates. F-actin staining was accompanied by cell background staining during the entire study. The white arrow in the right lane shows the orientation of the molding microfilament. (B) The total F-actin fluorescent intensities per cell area were shown on the stiff and soft PDMS substrates. The statistics was based on three independent experiments (n = 3), *, p < 0.05. (C) Representative immunofluorescent staining showing the variations in microtubules characterized by α- and β-tubulin staining in hSCAPs in response to stiff and soft substrates. The representative IF images were obtained from three independent experiments (n = 3).

(D) The total tubulin fluorescent intensities per cell area were shown on the stiff and soft PDMS substrate. The statistics was based on three independent experiments (n = 3), *, p < 0.05. (E) High-low model in CLSM showing the distribution and orientation of microfilaments and microtubules in hSCAPs in response to stiff and soft substrates. (F) Changes of cell populations based on the cell shape. The cells seeded on substrates were classified as one of three kinds: elongated, spread and unrounded, and spread and rounded cells. (G) Histogram showing ratio changes of cell populations based on (F). The statistics was based on 200 cells in the stiff group and 160 cells in the soft group from three independent experiments (n = 3), *, p < 0.05.

Figure3. Substrate compliance changes the enrichment of fibronectin in hSCAPs. (A) RNA sequencing results indicated the changes in the top 30 genes in the focal adhesion and ECMreceptor interaction pathways (KEGG) between the soft and stiff PDMS substrates. Whole cell lysates from soft and stiff substrates were analyzed by characterizing the mRNA transcripts. Cell samples were collected after stabilization for 72 h on substrates. The data were presented as log2(1+FPKM) and formatted by the online R-package. FPKM: Fragments Per Kilobase of transcript per Million fragments mapped. Three pairs of lysate samples, i.e., Sample 1 and 1’, Sample 2 and 2’, and Sample3 and 3’, were obtained from three independent cell isolates (n = 3). Each pair was obtained from the same mother cells. (B) Western blotting showing the decrease of fibronectin and collagen I in the soft substrate group compared to the stiff group. The three lysate samples in both the stiff and soft groups originated from three independent experiments. (C) Histogram showing the quantification of fibronectin and collagen I in hSCAPs in response to stiff and soft substrates. The statistics were based on the results of three independent experiments (n = 3). *, p < 0.05. (D-F) Representative immunofluorescent staining showing the accumulation of fibronectin (FBN11) in hSCAPs in response to stiff and soft substrates. D, Fibronectin expression at 24 h after seeding onto stiff and soft PDMS substrates. E, Fibronectin expression at 60 h after seeding onto stiff and soft PDMS substrates. F, Fibronectin expression at 120 h after seeding onto stiff and soft PDMS substrates. Counterstaining with F-actin was used for the cytoskeleton, and counterstaining with DAPI was used for the nucleus. The results in D-F are based on those from three independent experiments (n = 3). (G-H) Location and distribution of FBN11 in highly confluent hSCAPs in response to stiff and soft substrates (boxed in F). The white arrow indicates mature FBN11 was located in the gaps between two cells (G). The yellow arrow indicates mature FBN11 was distributed along the orientation of the cytoskeleton (H). (I) Total fluorescence emitted by mature FBN11 was quantified. The quantification data from three independent experiments was analyzed and the statistics were based on data from 200 indiscriminate cells in each group. *Significant difference between the two groups: p = 0.00834.

Figure 4. Substrate compliance triggers changes in focal adhesion kinase (FAK) in the focal adhesion system. (A) Co-IP showing the interaction between FAK and FBN11/Col1α in response to stiff and soft substrates. FAK antibody was used for Co-IP assay as the bait protein (15 μl / sample, ab219363, Abcam, Cambridge, UK). The interaction between FAK and FBN11/Col1α was shown. Antibodies, FBN11, Col1α1 and Col1α2, were used for detection as the prey proteins. Secreted MMP2 protein was used as a negative protein control. β-actin was used as an internal protein control. Cell lysates were collected from the stiff and soft substrates; The IgG control was from the representative stiff group. (B) Histogram showing the quantification of the amounts of FBN11 and Col1α prey bound by FAK in response to stiff and soft substrates. The statistics were based on the results of three independent experiments (n = 3). *, p < 0.05. (C) Western blotting showing the changes in FAK in response to stiff and soft substrates. The three pairs of lysate samples, i.e., Sample1 (S1) and S1’, Sample 2 and S2’, and Sample 3 and S3’, in both

the stiff and soft groups originated from three independent experiments (n = 3). Each pair was obtained from the same mother cells. (D) Histogram showing the quantification of changes in FAK protein in hSCAPs in response to stiff and soft substrates. The statistics were based on the results of three independent experiments (n = 3). *, p < 0.05. (E-F) Representative immunofluorescent staining of FAK in response to stiff and soft substrates. E, panoramic image taken from CLSM at 40 ×. F, images from E showing the distribution of FAK in a single cell in response to stiff and soft substrates. The cells were collected and analyzed after stabilization for 72 h after seeding. F-actin (cytoskeleton) and Dapi (nucleus) were used for counterstaining. The IF images were obtained from three independent experiments (n = 3).

Figure5. Substrate compliance changes the expression of paxillin in the focal adhesion and cytomembrane systems. (A) Co-IP showing the interaction between paxillin and FBN11/Col1α in response to stiff and soft substrates. Paxillin antibody was used for Co-IP assay as the bait protein (15 μl / sample, ab32084, Abcam, Cambridge, UK). The interaction between paxillin and FBN11/Col1α is presented. Antibodies, FBN11, Col1α1 and Col1α2, were used for detection as the prey proteins. Secreted MMP2 protein was used as a negative protein control. β-actin was used as an internal protein control. Cell lysates were obtained from the stiff and soft substrates; The IgG control was obtained from the representative stiff group. (B) Histogram showing the quantification of the amount of FBN11 and Col1α prey bound by paxillin in response to stiff and soft substrates. The statistics were based on the results of three independent experiments (n = 3). *, p < 0.05. (C) Western blotting showing the changes in paxillin in response to stiff and soft substrates. The three pairs of lysate samples, i.e., Sample1 (S1) and S1’, Sample 2 and S2’, and Sample 3 and S3’, in both the stiff and soft groups originated from three independent experiments (n = 3). Each pair was obtained from the same mother cells. (D) Histogram showing the quantification of the changes in paxillin protein in hSCAPs in response to stiff and soft substrates. The statistics were based on the results of three independent experiments (n = 3). *, p < 0.05. (E-F) Representative immunofluorescent staining of paxillin in response to stiff and soft substrates. E, panoramic image taken by CLSM at 40 ×. F, images from E showing the distribution of paxillin in a single cell in response to stiff and soft substrates. The cells were collected and analyzed after stabilization for 72 h after seeding. F-actin (cytoskeleton) and Dapi (nucleus) were used for counterstaining. The IF images were taken from three independent experiments (N = 3).

Figure6. Substrate compliance changes the expression of connexin43 in hSCAPs. (A) RNA sequencing results showing the basal gene expression of members of connexin family in hSCAPs. The increases in the connexin transcripts are presented as the fold change ratio in comparison to the internal GAPDH control. The data is based on the results of three independent experiments (n = 3). (B) Co-IP showing the interaction between Cx43 and FAK in response to stiff and soft substrates. FAK antibody was used as the bait protein. Secreted MMP2 protein was used as a negative protein control. β-actin was used as an internal protein control. Cell lysates were obtained from the stiff and soft substrates. The IgG control (rabbit) was obtained from the representative stiff group. (C) Histogram showing the quantification of the amounts of Cx43 by FAK prey in (B) in response to stiff and soft substrates. The statistics were based on the results of three independent experiments (n = 3). *, p < 0.05. (D) Co-IP showing the interaction between Cx43 and paxillin in response to stiff and soft substrates. Paxillin antibody was used as the bait protein. Secreted MMP2 protein was used as the negative protein control. β-actin was used as an internal protein control. Cell lysates were obtained from the stiff and soft substrates. The IgG control (rabbit) was obtained from the representative stiff group. (E) Histogram showing the quantification of the amount of Cx43 prey bound by paxillin in response to stiff and soft substrates. The statistics were based on the results of three independent experiments (n = 3). *, p < 0.05.

(F) Western blotting showing the changes of Cx43 in response to stiff and soft substrates. The three pairs of lysate samples, i.e., Sample1 (S1) and S1’, Sample 2 and S2’, and Sample 3 and S3’, in both the stiff and soft groups originated from three independent experiments (n = 3). Each pair was obtained from the same mother cells. The lysate samples were collected after stabilization on PDMS substrates for 72 h. (H) Location and distribution of Cx43 in hSCAPs at low, moderate and high cell confluence in response to stiff and soft substrates. CLSM panoramic images were obtained at 40 ×. The boxed areas show the detailed distribution of Cx43 between two cells (white arrow). F-actin (cytoskeleton) and Dapi (nucleus) were counterstained. The IF images were taken from three independent experiments (n = 3).

Figure7. Substrate compliance changes the formation of gap junction tunnels in living hSCAPs. (A) RNA sequencing results showing the changes in top 9 genes involved in gap-junction pathways (KEGG) between the soft and stiff PDMS substrates. Whole cell lysates from soft and stiff substrates were analyzed by characterizing the mRNA transcripts. Cell samples were collected after stabilization for 72 h on the substrates. The data are presented as log2(1+FPKM) and were formatted by an online R-package. Three pairs of lysate samples, i.e., Sample 1 and 1’, Sample 2 and 2’, and Sample3 and 3’,

were obtained from three independent cell isolates (n = 3). Each pair was obtained from the same mother cells. (B) Representative scrape loading/dye transfer (SL/DT) assay showing the effects of substrate stiffness on gap junction formation via the characterization of Lucifer yellow (LY) transfer in living hSCAPs within 500 s after loading. (C) Histogram showing the quantification of LY transfer speeds in hSCAPs in response to stiff and soft substrates within 500 s. The statistics were based on the results of six independent experiments (n = 6). *, p < 0.05. (D) Images obtained from a live cell imaging system showing the initial stage of LY transfer at 90 s in living hSCAPs. The yellow arrows to the left of yellow dotted line denote the starting sites of LY loading. The width between the yellow and white dotted lines indicates the LY transfer distance within 90 s in living hSCAPs. The white arrows denote the lightened intracellular channels by LY in hSCAPs. The captured images were taken from at least ten independent, repeated experiments (n > 10). (E) The live cell imaging system captured the LY transfer potential in hSCAPs at 600 s in response to stiff and soft substrates. The LY transfer speed decreased as the transmission distance was increased. To the left of the white dotted lines, the cell and its gap junctions were illuminated by LY molecules, while on the right side of the white dotted lines the cells were not illuminated but the gap junctions were illuminated earlier in the stiff substrate than in the soft substrate. The captured images were taken from at least five independent, repeated experiments (n > 5). (F) The diagram showing the changes in the LY transmission distance over time. The data were obtained from a group of LY transmissions in hSCAPs that were recorded every 90 s in response to substrate stiffness. The experiments were repeated three times (n = 3). *Significant difference presents between the two groups, * p < 0.05. (G) The fluorescent images showing the changes in stably formed gap junctions in hSCAPs in response to stiff and soft substrates during saturation of LY transfer after 30 min.

(H) The numbers of gap junctions were quantified. The quantification data was analysed from three independent experiments (n = 3), and the statistics were based on data from 50 indiscriminate cells in each group. **Significant difference between the two groups: p = 0.005.

Figure 8. The schematic diagram showing how substrate compliance modulates the FBN11/FAK(Pax)/Cx43(GJs) axis. The red areas represent stiffness-modulated cell-cell communication that was observed during the study. The gray areas represent the potential involvements in the cytoskeletal rearrangements and gap junction formations that were not shown in this study.

Graphical abstract

Table 1. Primer pairs designed in the present study Protein name

Gene name/gene ID

Primer pairs

Glyceraldehyde-3phosphate dehydrogenase

GAPDH (104bp)

Forward: GACAGTCAGCCGCATCTTCT

(NM_002046.7)

Reverse: GCGCCCAATACGACCAAATC

Fibronectin 1

FN1 (118bp)

Forward: CTGGCCAGTCCTACAACCAG

(NM_212482.3)

Reverse: CGGGAATCTTCTCTGTCAGCC

ITGB1 (167bp)

Forward: GCCGCGCGGAAAAGATG

(NM_002211.4)

Reverse: TGAATTTGTGCACCACCCAC

ITGB3 (172bp)

Forward: ATTCCACACCCTCACTGCTG

(NM_000212.3)

Reverse: GAAGCATAGGGCCAGACCTC

Col1a1 (164bp)

Forward: TTTGGATGGTGCCAAGGGAG

(NM_000088.4)

Reverse: CACCATCATTTCCACGAGCA

Gja1(198bp)

Forward: GACTGTTTCCTCTCTCGCCC

(NM_000165.5)

Reverse: AGACCCACAGTCTTTGGCAG

Integrin subunit beta 1

Integrin subunit beta 3

Collagen type I alpha 1 chain

Connexin 43

Connexin 46

Gja3 (186bp)

Forward: CAGCACCGCACGTGTGAAAG

(NM_021954.4)

Reverse: AGCCAAACCTTGCCGATGA

Gjb3 (136bp)

Forward: CCTTCCCGCTGTGGGTACAA

(NM_024009.3)

Reverse: GACCTTGACCGTGCGTGG

Gjc3 (188bp)

Forward: CCTCCCGTGCCATCAATACA

(XM_005080494.3)

Reverse: GGAGCCAAAAGGAACCCTCA

Htr2b (113bp)

Forward: GCAGCAAGCAAGTCTAGTGA

(NM_000867.5)

Reverse: GCAGCAAGCAAGTCTAGTGA

Pdgfb (124bp)

Forward: CCGCCAGCGCCCATTTTTC

(NM_002608.4)

Reverse: GGTTTTCTCTTTGCAGCGAGGC

Mitogen-activated protein kinase 7

Mapk7 (83bp)

Forward: ACACGACAACATCATCGCCA

(NM_139033.2)

Reverse: CCAGGACCACGTAGACAGAT

Lysophosphatidic acid receptor 1

Lpar1 (192bp)

Forward: GCCAGTGAGAGTGTGGGTG

(NM_001401.5)

Reverse: AGAAGCTGTGTACCTGGCG

G protein subunit alpha 11

Gna11 (194bp)

Forward: GAGACGGACGTTTTTCCCCT

(NM_002067.5)

Reverse: CCTGTGAGTCAGGCGTTCTT

Connexin 31

Connexin 29

5-hydroxytryptamine receptor 2B

Platelet-derived growth factor subunit B