Phenotypic and genotypic analysis of rat liver epithelial cells infected with retroviral shuttle vectors

CANCER LETTERS

ELSEVIER

Cancer Letters

107 (1996)

19-2X

Phenotypic and genotypic analysis of rat liver epithelial cells infected with retroviral shuttle vectors1 C. Dees*, C. Travis h’lrk Ana1,v.v~Srttton, Molecular Toxicology Group. Health Sciences Research Division, Bldg. 45OOSIMS-6109. Oak Ridge National Lnhorotory, P-0. 2008, Oak Ridge, TN 37831-6109, USA

Received 10 May 1996; revision received 17 May 1996; accepted 30 May 1996

Abstract Rat liver epithelial cells (RLE) are suspected to be pluripotent hepatic stem cells that give rise to a diverse variety of liver tumors. The molecular events responsible for transformation of these cells and the diversity of the tumor phenotypes remains to be fully elucidated. We examined the genotype and phenotype of RLE cells infected with retroviral shuttle vectors carrying a neomycin resistance (neo’) Ha-ras or a 1acZ gene. WBneo”‘, WB”““’ and WB’a”‘Zcell lines were examined for evidence of a transformed phenotype by comparing their behavior with the parental strain (WB-344) and with WBnpn-C-”and WBras” cells. Confluent cultures of WBneo-C-”and WB”“’ cells were found to contain signilcantly higher nu’nbers of total cells than the other cell lines. The growth rate of WBnr”-C-” and WB”“” cells were faster than that of the parental cell line. Addition of epidermal growth factor (EGF) to the medium was found to stimulate the growth rate of WBneu-C-”cells and to induce anchorage independent growth (AIG). No cell line produced tumors in nude mice (nu/nu) except WBrUs” cells. Radioimmunoprecipitation studies and sequencing of the ~53 exons S-8 indicate WBneo-C-“,and WBras” cells produce a mutant ~53. Northern blot analysis showed an increased expression of c-myc mRNA in WB”eo-C-‘land WB’aS” cells. These results demonstrate that alterations in critical growth and differentiation controlling genes have occurred in WB”“’ cells which may, independent of or in conjunction with Y(ESinsertion, cause the transformed phenotype. Keywords:

Stem cells; ras; ~53; myc

1. Introduction

Some studies have suggested that pluripotent stem cells may exist in the liver and participate in the development of liver cancer [5,20]. WB-F344 rat liver epithelial (RLE) cell lines have been reputed to have stem cell-like properties [24]. Chemical treatment of RLE cells in vitro results in expression of a variety of * Corresponding author. Tel.: +I 423 5762128; fax: +I 423 2414284;e-mail: [email protected]

Published by Elsevier Science Ireland Ltd PII SO304-3835(96)04338-S

transformed phenotypes [21]. Transplantation of transformed RLE cells into rats produces a wide spectrum of divergent tumors [22,23]. RLE cells have also been used to study tumor phenotype control [ 5,9] and lineage switching using retroviral associated oncogenes [13]. The genetic events at the molecular level that are responsible for the transformation of RLE cells and the wide spectrum of tumor types that they produce remains to be fully elucidated. To determine the effects of gene expression on the phenotype of RLE

cells, many studies have introduced various genes using retroviral vectors. For example, a variety of retroviral-associated oncogenes have been inserted into RLE cells to determine the ability of each construct to transform RLE cells and the tumor lineage associated with gene expression [ 131. Insertion of a vHa-ras gene into RLE cells alone was reported to fully transform RLE cells [ 131.Reduction of gap-junctional communication in RLE cells has also been linked to the insertion of Ha-r-us into WB-F344 using a retroviral vector 191. RLE cells infected with the Ha-r-us gene alone (WB’N”’ cells) in this study also exhibited a transformed phenotype (9). Other studies have suggested that transformation of liver cells requires multiple genetic changes which might include the amplification of nzyc and r-us [6,16,17]. In previous studies, the RLE cell lines produced by retroviral gene insertion have not been fully examined for other genetic changes that might contribute to the transformation state and the phenotype expressed by the cells. For example, no studies have been reported on the possible contribution to tumorigenicity in RLE cells by a tumor suppressor gene. Deletion or mutation of the ~53 gene is the most highly reported genetic event associated with tumors [25]. Alterations in pS3 have been associated with hepatocellular carcinogenesis, chemical carcinogenesis, and radiation carcinogenesis [3,2.5]. In addition, transformation of some cells by mutant p53 has been reported to require Ha-/-us [ 151. Considering the relative importance that tumor suppressor genes are now known to have in tumorigenesis, a role for one in the transformation of RLE cells is not unlikely. Full transformation of cells is thought to be multistep process requiring many genetic changes. We hypothesized that a fully transformed phenotype of RLE cells should require additional genetic events besides expression of Ha-t-us. A series of mutational events independent of 1-0sinsertion might account for the transformed phenotype of these cells or in conjunction with ra.s might contribute to the transformed phenotype. We were especially interested in finding evidence that deletion or mutation in the ~53 tumor suppressor gene contributed to the full transformation of I-as-transfected WB-F344 cells. Therefore, we examined the phenotype and genotype expressed by RLE-derived cell lines, WB”aJ” cells and WBneo-C-l’ (established as a insertional mutagenesis control) [9]

to determine if genetic events independent of Ha-ras insertion were present. To determine if WB’““’ cells exhibited characteristics that might be attributed to genes other than /‘as, we also attempted to duplicate the efforts of De Feijter et al. [9] by transfecting WBF344 cells with the same shuttle vector containing Hapus. A WBndIl cell line was also created as an insertional mutagenesis control. WB-F344 RLE cells were also infected with a shuttle vector containing lur,Z which served as a non-ras-transfection control and also created a marked RLE cell line. We examined all the cell lines for a number of characteristics that have been associated with neoplastic transformation including growth in soft agar (with and without stimulation by EGF) and the formation of tumors in nude mice. RLE cell lines were also examined for a number of genetic events commonly associated with transformation (e.g., pS3 mutation, my. amplitication). 2. Materials and methods 2 .I. Cells

and

growth conditions

The WB-F344 RLE cell line, WBn”‘-‘-” cells, and WB”“’ cells were derived from normal rat liver by Dr. J.E. Trosko, University of Michigan [9]. Cells containing defective Molony’s murine leukemia virus, ?/-BAG, were obtained from the American Type Culture collection and used to generate 1acZ shuttle vectors. RLE cells were marked by the insertion of a 1acZ operon using a shuttle vector and techniques described previously [4]. RLE cells containing the lucZ operon were designated as RLE’““. RLE cells were grown in modified Richter’s medium (Hazleton Labs, Lanexa, KS, USA) with or without 10 rig/ml of EGF (Sigma, St. Louis, MO, USA) added to the medium. Fetal calf serum was added to the medium at a concentration of 5% v/v. Cells containing a neomycin resistance gene were maintained in Richter’s medium with 1 mg/ml of G 1487 (Geneticin) (Sigma, St. Louis, MO, USA). Cells containing a retroviral shuttle vector were selected by application of Richter’s medium with 5.0 mg/ml of G1487 for 2 weeks then switched to the maintenance medium. Cells were grown in a humidified incubator at 37°C with 5% CO?. -y-BAG cells were grown under similar

21

C. Dees, C. Travis I Cancer Letters 107 (1996) 19-28

conditions in Dulbecco’s modified minimum essential medium with 5% fetal bovine serum. 2.2. Retroviral vectors Retroviral shuttle vectors containing raslneo and aeo alone were obtained from Dr. C. Chang, Michigan State University, East Lansing, MI and used with the permission of Dr. P. Dotto, Yale University. Retroviral shuttle vectors carrying 1acZ and neo were produced by methods previously described [4,9, lo]. Retroviral vectors were used to introduce Heo and r-usineo into WB-F344 cells using procedures similar to the ones previously described [9] with the exception that cells were not selected for anchorage independent growth after selection with G1487 medium. Insertion of genetic elements into RLE cells was confirmed by the acquisition of G1487 resistance by the genetically manipulated cells. Cell staining with Xgal [7,1X] was used to confirm the expression of 1acZ. The cell line containing only neo was designated WB nm”‘. The cell line containing neo and r-as was designated WB”“” while cells containing 1acZ were designated WB”““. ’ 2.3. Phenotype analysis The phenotypic indicators of the transformation state of treated or untreated RLE cells was assessed by: the development of AIG, effects of EGF, tumorigenesis in nude mice, growth rate of cell lines, total cell numbers in confluent cultures, changes in enzymatic activity and radioimmunoprecipitation studies. AIG was determined by growth of the cells in soft agar using routine methods. Soft agar growth studies were performed with or without the addition of 10 ng/ ml of EGF to the agar medium. Percent of cells responding to EGF by demonstrating AIG was calculated. The growth rate of cells was evaluated by performing an abbreviated growth curve study. Cells (approximately 2.5 x 104) were added to tissue culture plates. The effects of EGF on cell growth rates were determined by adding 10 rig/ml EGF to the medium. Cells were incubated and removed from the culture plates at intervals by trypsinization and the cells counted using a Coulter cell counter. The total number of cells in totally confluent cell

cultures was determined by counting trypsinized cells similar to procedure previously described. The effect of EGF on the total cell number was determined by adding 10 rig/ml EGF to the medium. 2.4. Enzymatic activity Enzymatic activity in RLE cells after the addition of retroviral shuttle vectors was semi-quantitatively assessed by standard histochemical techniques. The effects of EGF on the enzymatic profile of cells was determined by comparing the qualitative enzymatic levels of cells without EGF to those with EGF added to the medium. Insertion of the 1acZ operon was examined by staining cultured cells as previously described [7,18]. Gamma gutamyl transferase activity and alkaline phosphatase activity was determined by standard histochemical methods. 2.5. Tumorigenesis in mice Tumorigenesis in nude mice was assessedby injecting 1 x lo6 cells subcutaneously (s.c.) in C57BL/lOnulnu mice obtained from Dr. V.L. Godfrey, Biology Division, Oak Ridge National Laboratory. Mice were housed in a barrier colony and given food and water ad libitum. Mice were observed daily for tumor formation or for signs of distress that might indicate tumor formation at a site remote to the injection site. Mice with visible signs of tumor formation or any signs of distress were sacrificed and necropsied using standard procedures. 2.6. Radioimmunoprecipitation

techniques

Radioimmunoprecipitation studies and electrophoretic procedures were performed as described previously [8]. Briefly, RLE cells (.50-60% confluency) were radiolabeled using [35S]methionine, 30 &i/ml, in methionine-free medium. Cells were lysed with a standard lysis buffer consisting of 50 mM Tris, 0.5% v/v NP-40,150 mM NaCl, 1 mM PMSF and 50 pg/ml aprotinin, pH 8.0. Protein content of extracts was determined using a BCA protein assay (Pierce, Rockford, IL). Protein concentrations of the extracts were equalized before the immunoprecipitations were performed. Immunoprecipitations were performed on equal volume aliquots of the cell extracts using tech-

22

C. Dees. C. Travis I Cancer Letters 107 (1996) 19-28

niques described by Dees et al. [8]. Antibodies used were anti-p53 (ab-1) specific for mutant and wild type ~53; anti-p53 (ab-3) specific for mutant p53 [ 121; antihsp70 and anti-p21 pan-ras (ab-1) (Oncogene Sciences, Manhassett, NY, USA). Radioimmunoprecipitates were separated on 4- 15% or 4-20% continuous linear gradient polyacrylamide gels and visualized by fluorography (8). 2.7. Statistical procedures Analysts of variance (ANOVA) was performed on the total cell numbers followed by a Student’s t procedure that had been modified to account for the total variance among the groups. a.

Cells without

EGF m-.--m o-o l - -0

SE5 4E5

W&F344 Cells WBneo-C-II W&as-II

4E5 Y ti 3E5 IL 0 3E5 6m 2E5

0 b.

10

2E6 Y g

lE6

“0

lE6

B :

BE5

2

n - --¤ o-o l - -0

2E6

20

30

40

50

TIME (HOURS)

Cells +EGF

WE-F344 Cells WBnao-C-II WBrosll

2.8. Nucleic acid procedures Total RNA from cell lines was extracted using a commercial guanidium-based procedure (TRI Inc, Cincinnati, OH, USA). Total RNA was quantitated using 260/280 nm absorbance and examined using standard agarose gel electrophoresis techniques. Coupled reverse transcriptase-polymerase chain reaction (RT/PCR) was used to copy cellular mRNAs primed by oligo dTz4. PCR was used to amplify an approximately 570 bp fragment corresponding to exons 5-8 in the rat ~53 gene. The left-hand 21mer primer, GCCAAGTCTGTTATGTGCACG, corresponds to the last 20 bases in the rat exon 4. The right hand 2 1mer primer, TCTCTTTGCACTCCC TGGCAG, is complementary to the 21 bases in exon 8. Direct sequencing of the plus sense strand using the left hand primer by standard dideoxy-PCR sequencing techniques was performed (New England Biolabs., Waverly, MA, USA). Northern blot procedures using standard protocols were performed on the total RNA isolated from all cell lines. Commercially available oncogene and tumor suppressor gene probes were used (Oncogene Sciences, Uniondale, NY; Oncor Inc., Gaithersburg, MD, USA). A plasmid containing the full rat ~53 gene was supplied by Dr. S. Lilleberg (Monsanto Environmental Health laboratory, St. Louis, MO, USA). The rat ~53 plasmid was created by Dr. T. Soussi (Unite d’Oncologie Moleculaire, Cedex, France) and used with his permission.

1

3. Results 3.1. Total cell numbers

5E5

0

10

%E

(HO”R3sc;

40

50

Fig. 1. The total number of WBne”-C~‘lcells removed from confluent cultures was significantly higher than the parental strain (WBF344) but was significantly less than from WBruS” cultures. The number of cells from cultures of WB”‘Z, WBneon’, and WB”‘“’ resembled the harvest from WB-F344. All bars represent the mean of three separate counts and the error bars represent the standard deviation. Asterisks identify significantly different means (P < LO-‘).

Our first indication .*of unexpected phenotypic alterations in WB nro-C-”cells was the observation that the number of cells harvested from confluent cell cultures of WB”eo-C-r’cells were significantly higher than uninfected WB-F344 cells (Fig. la). The total number of cells from WB-F344, WB’““, WBneo’rl, and WBrastl’ cells were not significantly different (Fig. 1a). Since WBneo-C-lrcells were produced as an insertional mutagenesis control by De Feijter et al. 191,we examined the behavior of WBne”-C-r’and WBrasr’cells more closely by observing the effects of EGF on growth of RLE cells.

73

C. Dees. C. Travis I Cancer Letters 107 (1996) 19-28

WE-344 Cells ~m?m-C-II WEmall WBlacZ

7.750 9 : 7.500 T % I- 7.250 z JB 7.000

WBneoRlll WBraslll

3.4. Enzyme analysis

Call Lims

Fig,

?,

WB”“‘.CIl

dence of a transformed phenotype was exhibited by WB’acZ, WBneolI1,or WBrasl” cells whose phenotype still more closely resembles that of WB-F344 cells (Table 1).

md

WBr”“Ll

cells were found to grow faster than the parental strain, WB-F344 (a). EGF stimulated the growth rate of WB”‘“~c~” cells but had no effect on WBF344 or WBraS’t cells (b). Each point represents the mean of three separate counts + standard deviation.

All cell lines were examined using a semi-quantitative technique for expression of two common liver enzymes and for the expression of 1acZ. All cell lines appeared to be strongly positive for alkaline phosphatase and weakly positive for GGT. Only the cell line infected with the retroviral vector carrying 1acZ stained positive for expression of this enzyme (Fig. 3). No other cells stained positive for this enzyme (not shown).

3.2. GroMjth rute

3.5. Radioimmunoprecipitation

The growth rate of WB-F344, WBne”-C-‘l, and WB’““” ceils, with and without EGF, is shown in Fig. 2. Fully transformed WB”“” cells, as expected, have the fastest rate of growth followed by WBnro-C-ll and then WB-F344 cells (Fig. 2a). All cells appear to increase there growth rate in response to EGF but WB nro-C~l’cells appear to be most responsive (Fig. 2b). WB’““z, WBnPoJu,and WBravl” cells’ response to EGF appears to resemble the parental WB-F344 cells.

We examined the proteins precipitated by anti-p53 (ab-1 and ab-3), anti-hsp70, and anti-pan-ras from WB-F344 cells, WBneo-‘-” cells, and WBras” cells. Fig. 4 (lane a) shows that anti-p53 (ab-I) appears to precipitate more ~53 from WB-F344 cells. Anti-pS3 (ab-3) precipitates little or no activity associated with p53 (Fig. 4, lane b). No predominant 70 kDa protein corresponding to hsp70 is found in the lane with antihsp70 immunoprecipitates (Fig. 4, lane c). Anti-p53 (ab-3) (Fig. 5, lane b) appeared to precipitate more protein from lysates of WBne”-‘-” cells, when compared to the results when anti-p53 (ab-1) was used (Fig. 5, lane a). Anti-p53 (ab-3) also preferentially

3.3. Trun~formation state The neoplastic transformation state of WBneo-C-” and WBrrrJ1’cells was compared to the parental cell line by determining the potential for growth on soft agar and tumorigenic capabilities in nude mice (Table 1). Most WB-F344 cells were unable to grow in soft agar but a few cells exhibited anchorage independent growth. Addition of EGF to the medium did not increase the number of cells responding to EGF by growing in soft agar. No tumors were formed in nude mice injected subcutaneously with WB-F344 cells. In contrast. the majority of WB”“” cells grew in soft agar and were tumorigenic. The majority of WBneo-C-llcells did not grow in soft agar without EGF added to the medium. However, with EGF added to the medium almost one-fourth of the cells responded by exhibiting AIG. WBflPO-C-II cells growth with or without EGF were unable to cause tumors in nude mice. No evi-

studies

Table 1 Transformation State analysis of rat liver epithelial cells Cell lines

WBF-344 WBne”-C-II wBroslI WB’“cz WBnr”lll WB”““t

Growth in soft agar

Plating efficiency in soft agar”

-EGF

EGF

+EGF

1.I 1.6 90%

1.6 24%> 88%

+ _ _ _

+EGF + + -

Tumor in nude mice + -

aPlating efficiency determined as the number of cells forming colonies in soft agar divided by the total number of cells in the soft agar.

24

C. Dees, C. Travis I Cancer Letters 107 (1996) 19-28

precipitated ~53 from WB”“” (Fig. 6, lane b) comPare:d to anti-p53 (ab-I) (Fig. 6, lane a). Results obtalined using anti-hsp70 on lysates from WBneo-C-*’

and WB”“” cells were again unremarkable (Fig. 5, lane c; Fig. 6, lane c). Immunoprecipitation of ~53 from WBIaCz, WBnpol”, or WB”asl’l cells using anti-

Fig. 3. WB”‘Z cells stain strongly positive for 1acZ expression. No other cell lines stained (not shown).

25

C. Dees, C. Travis I Cancer Letters 107 (1996) 19-28 0

b

parental WB-F344 RLE cells. The amount of ~21 ras precipitated from WB”“” cells using an excess of antipan rus monoclonal antibody was similar to all other cell lines (not shown).

C

3.6. Sequencing

-106

- 80 - 49.5

p53 +

- 32.5 - 27.5 - 18.5

Fig. 4. Gel electrophoretic analysis of the proteins precipitated from WB-F344 cell lysates using anti-p53 (ab-1) in lane a. Lane b contains proteins precipitated by anti-p53 (ab-3), and lane c contains proteins associated with complexes precipitated using anti-hsp70.

wild type or mutant p.53 antibodies gave results (not shown) that were not demonstrably different from the

a

b

of p53

Preliminary sequencing data on ~53 cDNA equivalent to the human exons 5-8 WB”“” shows that these cells have at least one mutation at codon 160. At this position thymidine has been replaced by guanosine in WB”“” cells which results in an isoleucine to a serine change in the amino acid code. At all other positions in exons 5-8, the sequence for the parental cell line and WB’“‘Z cells matches previously published rat ~53 sequence data [ 191.We have been unable to obtain an unambiguous sequence for the ~53 exons 5-8 in WB neo-C-”cells. Since approximately one-third of WB neo-C-”cells can grow in soft agar with added EGF, it may be that this cell line is composed of a heterogeneous population of cells. p53 may be wild type in one cell population and mutant in the other. Further studies are required to ascertain the status of ~53 in WBnro-C-”cells.

a

c

b

C

20510680-

106 80 49.5

P

32.5 27.5 18e5 Fig. 5. Gel electrophoretic analysis of the proteins precipitated from WB”“‘-C‘n cell lysates using anti-p53 (ab-I) in lane a. Lane b contains proteins precipitated by anti-p53 (ab-3), and lane c, contains proteins associated with complexes precipitated using anti-hsp70.

49.5-

P53

32.527.5’

Fig. 6. Gel electrophoretic analysis of the proteins precipitated from WP cell lysates using anti-p53 (ab-1) in lane a. Lane b contains proteins precipitated by anti-p53 (ab-3) and lane c contains proteins associated with immune complexes precipitated using anti-hsp70.

‘6

C. Dees. C. Travis I Cancer Letters 107 (1996) 19-28

3.7. Northern blot analysis

4. Discussion

Northern blot analysis shows that only a very slight, if any, increased expression of ras is found in WB”eO-C” and WB”“” cells over that of the parental line (Fig. 7). Similar results have been obtained by examining the amount of p21 rus immunoprecipitated from these cell lines (Dees and Travis, 1991, International Conference on the Molecular Mechanisms of Carcinogenesis in Humans and Rodents). ras expression in WB’““’ cells resembles the parental cell line (Fig. 7). The lack of increased ras expression in WB”“” cells was not expected. However, increased expression of a transforming oncogene like Ha-ras is not required. Only the presence of the activated ras may be required for transformation in conjunction with other genetic events or proliferative processes (16). In contrast, expression of c-myc mRNA in both WBnen-C-i’and WB”“” cells is greatly elevated over the expression of this gene in the parental WB-F344 cells (Fig. 7). cmyr expression in WB’“‘Z cells again resembles the parental cell line (Fig. 7a). No differences in the amount of tubulin, ~53, erbA, erbB, or src mRNA expressed were noted in any of the cell lines tested (data not shown). The effects of EGF on the expression of various oncogenes and tumor suppressor genes is currently being examined.

The existence of a hepatic stem cell is a highly controversial topic [ 1,2]. However, epithelial cell lines derived from rat liver have been said to exhibit stem-cell like abilities [5]. Recent in vivo studies have been reported using a RLE cell line marked with a /3-galactosidase gene to confirm stem cell-like behavior [5]. The reporter gene was inserted using a retroviral shuttle vector [5]. These ‘marked’ RLE cells were capable of producing a tumor when injected subcutaneously, but not when transplanted into rat liver [5]. Genes inserted by retroviral vectors have also been used to study the transformation of RLE cells [9] and to investigate the lineage-switching

Fig. 7. Northern blot analysis of mRNA extracted from the cell lines shows that little or no increase in the expression of ras is found in WB”““-C-l’ (lane b) or WB’““’ cells (lane c). The expression of mgc in WB”‘“(“’ (lane b) or WBruS” cells (lane c) is greatly increased. my“ and ras mRNA expression in WB’O’” cells (lane a) resembles that of the parental cells (lane d).

[131.

A less transformed RLE cell line that contains a reporter would be useful in examining the molecular events responsible for transformation, tumor lineageswitching, and in investigating the ability of the cells to exhibit stem-cell like behavior in vivo. In this study, we have produced an RLE cell line containing a 1acZ reporter for future in vivo studies. The phenotypic behavior of WB’“‘Z cells was always similar to that exhibited by the parental cell lines (Table 1) with the exception that it stained strongly for expression of the reporter gene (Fig. 3). In contrast, to ‘marked’ RLE cells lines used previously to examine stem cell-like differentiation [5], this cell line does not cause tumors in nude mice by subcutaneous injection (Table I). The genotype of WB’“” cells also most closely resembled that expressed by the parental WB-F344 RLE cells. Radioimmunoprecipitation studies suggest that wild type ~53 is produced by WB’““’ cells which was confirmed by sequence analysis of the rat ~53 exons 5-8. In contrast to the less-transformed phenotype and genotype expressed by WB’“” cells, two other cell lines were more closely associated with partial and complete transformation. For example, confluent cultures of WBnpo-C-rlcells always had significantly higher numbers of cells when compared to confluent cultures of the WB-F344 parental strain (Fig. 1). WB nuo-C~il cells grow faster than WB-F344 cells, but less rapidly than WB”“” cells (Fig. 2), and exhibited anchorage independent growth when EGF is present (Table 1). The spontaneous acquisition of a partially transformed phenotype, characterized by AIG, has

C. Dees. C. Travis I Cancer Letters 107 (1996) 19-28

been reported previously [2]. Chemical transformation of RLE cells has also been reported to induce sequential changes in the EGF receptor/ligand function [ 141.Therefore, the loss of AIG by WBne”-c-llcells along with increased growth rates represents phenotypic and genotypic alterations representative of a partial neoplastic transformation state that is not demonstrated by the parental cell line. Two other lines WBneonl and WBrasr’i were established, attempting to create a new fully transformed line by inserting rus into RLE cells. However, WBneo’*’ nor WB”osl’l cells have not shown any characteristics that might be associated with transformation. The growth rate (Fig. 2), cell number (Fig. l), AIG and a lack of tumors in nude mice (Table 1) suggest that these cells are essentially unaffected by transfection with the retroviral shuttle vectors. Our inability to transform RLE cells by insertion of Ha-rus alone differs from the results reported from previous work [9]. We did not select for clones using soft agar as did the previous study [9]. The use of soft agar growth for clonal selection may have also selected for transformed characteristics independent of the inserted Ha-r-us gene. A small number of soft agar growth positive cells can be found in the parental RLE WB-F344 cells (Table l), which would suggest that this hypothesis is possible. Cells selected by the ability to grow in soft agar could have acquired traits through additional genetic events that are independent of Ha-rus gene insertion. Radioimmunoprecipitation and sequencing studies support this conjecture by demonstrating the expression of a mutated ~53 gene (Fig. 6) in WBneo-C-l’and WBrrrsil cells. Mutated ~53 may contribute to the full transformation of RLE cells as previously described [ 151.The spontaneous acquisition of other genetic changes may contribute to or be solely responsible for the transformed phenotype of these cells which includes a reduction in gap-junctional communication. Alternatively, Ha-r-us may act in conjunction with the other genetic alterations (e.g., mutation in p53) [11,15]. This finding would be in the agreement with previously published studies [15-171. Further research is required to fully establish the molecular events that are responsible for transformation, differentiation, and tumor lineage-switching RLE cells. The WB’““” cells produced in this study whose phenotype and genotype more closely resem-

21

bles the parental RLE strain may prove useful in this effort. Acknowledgements We appreciate the materials supplied by C. Chang that were created by Dr. P. Dotto and his kind permission to use them. The help of E.J. Miller, Health Sciences Research division of the Oak Ridge National Laboratory, for growing and maintaining cell lines is very much appreciated We appreciate the help of Dr. S. Lilleberg in supplying the rat ~53 plasmid created by T. Soussi and Dr. Soussi’s permission to use it. These studies were sponsored by a Laboratory Directed Research and Development Funds. U.S. Department of Energy. Oak Ridge National Laboratory managed by Lockheed Martin Energy Research Corp. for the U.S. Department of Energy under contract no. DEAC05-960R22464. References Ill Alterman. K. (1992) The stem cells of the liver - a selective review, J. Can. Res Clin. Oncol., 118, 87- 1 15.

[21 Baun, L., Goyette. M., Yawen, P., Thompson, N.L. and Fausto, N. (1987) Growth in culture and tumorigenicity after transfection with ras-oncogene of liver cpithelial cells from carcinogen-treated rats, Can. Res., 47, 41 16-4124. 1% Buetow, K.H., Murry, J.C., Israel. J.L., London, W.T., Sminth, M., Kew, M., Blanquet. V.. Brechot. C., Kedeker, A. and Govindarajah. S. (1989) Loss of heterozygosity suggests a tumor suppressor gene responsible for primary hepatocellular carcinoma, Proc. Natl. Acad. Sci. USA, 86. 88522 8856. [41 Cepko, C.L., Roberts, B.E. and Mulligan.

R.C. (1984) Construction and applications of a highly transmissible murine retrovirus shuttle vector, Cell, 37, 1053- 1062. 151Coleman. W.B., Wennerberg, A.E., Smith. G.J. and Grisham, J.W. (1993) Regulation of the differentiation of diploid and some aneuploid rat liver epithelial (stemlike) cells in the hepatic microenvironment, Am. J. Pathol., 142, 1373-1382. [f4 Cote, G.J., Lastra, B.A., Cook, J.R., Huang, D. and Chiu. J. (1985) Oncogene expression in rat hepatomas and during hepatocarcinogenesis, Cancer Lett., 26, 12 1~ 127. [71 Danneberg. A.M. and Suga, M. ( 198 1) Methods for Studying Mononuclear Phagocytes, pp. 375-395. Editors: D.O. Adams, P.J. Edelson and H.S. Koren. Academic Press. New York. 181Dees, C., Godfrey, V.L., Foster, J.S., Schultz, R.D. and Travis, C. (1994) Stabilization of the p53 gene product in two bovine leukemia virus infected cell lines, Cancer Len., 86, 33-40.

2x

C. Dees, C. Travis I Cancer Letters 107 (1996) 19-28

[Y] De Feijter, A.W., Ray, J.S., Weghorst, CM., Klaunig, J.E., Goodman, J.L., Chang, C.C., Ruth, R.J. and Trosko, J.E. (19901 Infection of rat liver epithelial cell with v-Ha-ras: correlation between oncogene expression, gap junctional communication, and tumorigenicity, Mol. Carcinogen., 3, 19-27. [ 101 Dotto, G.P., Parada, L.F. and Weinberg, R.A. (1985) Specific growth response of ras-transformed embryo fibroblasts to tumor promoters, Nature, 318, 472-475. ( 1 I] Findlay, C.A.. Hinds, P.W., Tan, T.H., Eliyahu, D., Oren, M. and Levine, A.J. (1988) Activating mutations for transformation by p53 produce a gene product that forms a hsc70 ~53 complex with an altered half life, Mol. Cell. Biol., 8, 531539. [12] Gannon, J.V., Greaves, R., Iggo, R. and Lane, D.P. (1990) Activating mutations in ~53 produce a common effect: a monoclonal antibody specific for the mutant form, EMBO J., 9, 1595-1602. 1131 Garfield, S.. Huber, B.E., Nagy, P., Cordingley, M.G. and Thorgcirsson, S.S. (lY88) Neoplastic transformation a lineage switching of rat liver epithelial cells by retrovirus-associated oncogenes, Mol. Carcinogen., 1, 189-195. (141 Grisham, J.W., Tsao, M.S., Lee, D.C. and Harp, H.S. (1990) Sequential changes in the epidennal growth factor receptor/ ligand function in cultured liver epithelial cells transformed chemically in taitro, Pathobiology, 58, 3-14. [IS] Hinds. P., Findlay, C. and Levine, A.J. (1989) Mutation is required to activate the ~53 gene for cooperation with the ras oncogcne and transformation, J. Viral., 63, 739-746. [ 161 Kumar, R., Sukumar, S. and Barbacid, M. (1990) Activation

[17]

[18]

[19] [20] [21]

[22]

[23]

[24]

[2S]

of ras oncogenes preceding the onset of neoplasia. Science, 248, 1101-1104. Makino, R.. Hayashi, K., Sato, S. and Sugimura, T. (1984) Expressions of the c-Ha-ras and c-myc genes in rat liver tumors, Biochem. Biophys. Res. Commun., 119, IO96- I 101, Sanes, J.R., Rubenstein, L.R. and Nicolas, J.F. (1986) Use of a recombinant retrovirus to study post-implantation cell lineage in mouse embryos, EMBO J., 5. 3133-3142. Soussi, T. (1990) Structural aspects of the ~53 protein in relation to gene evolution, Oncogene. 5, 945-952. Sell, S. (1990) Is there a liver stem cell?. Cancer Rcs., SO. 3811-3815. Tsao. M.-S., Grisham, J.W. and Nelson, K.G. (1985) Clonal analysis of tumorigenicity and paratumorigenic phenotype in rat liver epithelial cells chemically transformed in \‘itrcj, Cancer Res., 45, 5139-5144. Tsao, M.-S. and Grisham, J.W. (1987) Phenotypic modulation during tumorigenesis by clones of transformed rat liver epithelial cells, Cancer Res., 47, 1282- 1286. Tsao, M.-S. and Grisham, J.W. (1987) Hepatocarcinomas. cholangiocarcinomas and hepatoblastomas produced by chemically transformed cultured rat liver epithelial cell5, Am. J. Pathol., 127. 168-181. Tsao, M.-S.. Smith, J.D.. Nelson, K.G. and Grisham. J.W. (1984) A diploid epithelial ceil line form normal adull rat liver with phenotypic properties of oval cells, Exp. Cell. Res., 154, 38-52. Weinberg, R.A. (I 99 1) Tumor suppressor gcne5. Science. 245. 1138-l 146.