Physical and genetic chromosomal maps of Streptococcus agalactiae, serotypes II and III; rRNA operon organization

FEMS Microbiology Letters 167 (1998) 33^39

Physical and genetic chromosomal maps of Streptococcus agalactiae, serotypes II and III; rRNA operon organization Alexander Dmitriev, Alexander Suvorov *, Artem Totolian Institute of Experimental Medicine, Academy of the Medical Sciences, Pavlova street 12, St. Petersburg 197376, Russia Received 6 April 1998; revised 27 July 1998; accepted 29 July 1998

Abstract A detailed analysis of two Streptococcus agalactiae (group B streptococcus, GBS) strains was performed by pulsed field gel electrophoresis (PFGE). Digestion of the chromosomal DNA with SmaI and SgrAI endonucleases, followed by separation and analysis of fragments by PFGE was carried out. Physical chromosomal maps of serotype II/(K+L) and III/K strains of S. agalactiae were constructed. The GBS genome size was estimated to be 2200 kb. Sixteen GBS genes were used as probes and were located on the restriction maps of both strains by DNA-DNA hybridization. Six copies of ribosomal operons were found in the genome of the analyzed strains. Significant differences in the restriction patterns of chromosomal DNA and DNA-DNA hybridization between the two analyzed strains were detected so that DNA restriction patterns may be used to trace outbreaks of disease. The overall GBS chromosomal organization as determined is fairly conserved. z 1998 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Group B streptococcus ; Pulsed ¢eld gel electrophoresis; Ribosomal operon; Genome mapping

1. Introduction Streptococcus agalactiae (group B streptococci, GBS) is the major cause of newborn morbidity and mortality [1]. However, little is known regarding GBS genome structure and the relationship of strain peculiarities to the infectious process [2,3]. The polysaccharide capsule has been considered a major virulence factor, but other protein factors have also been considered to be potentially important in virulence [3^8]. Genes encoding CAMP factor, K and L antigens, and C5a peptidase have been cloned and sequenced in recent years [4^7]. The role of these * Corresponding author. Tel.: +7 (812) 234-93-19; Fax: +7 (812) 234-94-77; E-mail: [email protected]

proteins in pathogenicity, as well as the location of their respective genes on the chromosome, remains to be elucidated. The physical and genetic maps of approximately 100 microorganisms have been described in the past several years; the use of pulsed ¢eld gel electrophoresis (PFGE) has been a powerful tool in accomplishing these studies [9]. However, so far this approach has not been used for the analysis of the GBS genome [10^12]. Recently, however, it was found that restriction endonuclease digestion patterns among GBS strains of serotypes I and II in conventional electrophoresis were usually similar, but were di¡erent when compared with restriction patterns of strains of serotype III [13^15]. In order to investigate the relationship of GBS serotypes with

0378-1097 / 98 / $19.00 ß 1998 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 8 ) 0 0 3 6 4 - 4

FEMSLE 8369 25-9-98

34

A. Dmitriev et al. / FEMS Microbiology Letters 167 (1998) 33^39

Table 1 Primers for the ampli¢cation of the GBS genes Locus

Forward primer (5PC3P)

Reverse primer (5PC3P)

cfb bac bca ald polA valS

AAGAGCTCTAATCAAGCTCA(A/G)CA(A/G)ATGGC GCAGTTCATATTGGACGG CAGGAGGGGAAACAACAGTAC GGCAGTCATGTATCTCATGT GTTGAAGAAGTGACCATTCGT CGCTACGCAGGTGCCCTT

GTGGGCCCAGTATTCCAAATTTC(T/C)TT(A/G)TC CAACTACATTGCCAG GAACCGTTACTTCTACTGTATCC CAGATAGGCAACATCTAAAGA GGGTGGAAGGTACGCATGG CCGAATTCGAGTTCGGTACC

chromosomal location of genes more precisely, PFGE analysis of the genomes of two GBS strains, belonging to serotypes II and III, was performed.

2. Materials and methods 2.1. Bacterial strains and growth conditions GBS strains 78/471 (IgA binding, serotype II/a+b) and 1/6586 (non IgA binding, serotype III/a) were obtained from collections of the Department of Laboratory Medicine and Pathology and Pediatrics, University of Minnesota, USA, and the Department of Microbiology and Immunology, Beijing Children's Hospital, China, respectively. Other GBS strains tested were obtained from collections of the Institute of Experimental Medicine, St. Petersburg, Russia, and Beijing Children's Hospital. The strains were grown either in Todd-Hewitt broth (THB) or on 1.5% horse blood agar at 37³C overnight. 2.2. DNA techniques Chromosomal DNA for PFGE was prepared as previously described [16]. PFGE was carried out in a Geneline apparatus, Beckman, USA, for 20^48 h. The pulse time varied from 8 to 150 s depending on the sizes of DNA fragments separated. DNA lambda concatemers were used as molecular mass markers. The sizes of DNA fragments were estimated by the SEQAID computer program. After PFGE, DNA was transferred onto nylon ¢lters as described [17]. Labeling of DNA, hybridization and immunological detection were accomplished using the Genius DNA Labeling and Detection kit, Boehringer Mannheim (Germany). The optical density of hybridized bands was measured by laser densitometry. DNA probes

used for mapping (Table 3) were prepared after labeling of the recombinant plasmids or polymerase chain reaction (PCR) products according to the known DNA sequences published in the GenBank database. The Express PCR procedure was performed as described [18]. Forward and reverse primers for ampli¢cation are listed in the Table 1. 2.3. Genome mapping techniques The rare cutting enzymes SmaI and SgrAI, which cleave DNA in sites with a high content of guanine and cytosine, were chosen for restriction analysis. Double SmaI-SgrAI digestions of the chromosomal DNA were also performed. The molecular size of the GBS chromosome was estimated by summing the sizes of restriction fragments. Additionally the order of restriction fragments on the physical map was determined by several techniques, including incomplete digestion of chromosomal DNA, followed by Southern hybridization with various DNA probes. Some of the large restriction fragments were cut from the agarose gel after PFGE. These fragments were puri¢ed with a Qiagen kit and labeled using a DNA Labeling and Detection Kit and applied as DNA probes. Genetic mapping was accomplished by hybridization of PFGE restriction fragments with the gene probes listed in Table 3.

3. Results and discussion 3.1. Pulsed ¢eld gel electrophoresis and DNA-DNA hybridization with restriction fragments GBS strains 78/471 (serotype II/a+b) and 1/6586 (serotype III/a) belonging to di¡erent genetic line-

FEMSLE 8369 25-9-98

A. Dmitriev et al. / FEMS Microbiology Letters 167 (1998) 33^39

ages as proposed [13] were chosen for the restriction and hybridization analyses. Rare cutting enzymes, such as NotI and S¢I, used for genome mapping of other Gram-positive cocci [19^26], did not cleave the GBS chromosomes. Genomic DNA from these strains was digested with restriction endonucleases SmaI and SgrAI. These enzymes generated 14 SmaI and eight SgrAI fragments for serotype II/a+b and 13 SmaI and seven SgrAI fragments for serotype III/a, ranging in size from 3.6 kb to 1900 kb (Table 2). The molecular sizes of all SmaI and SgrAI restriction fragments were calculated by the SEQAID program. Several intense DNA bands appeared after separation of SmaI and SgrAI restriction fragments by PFGE, and it appeared that these intense bands consisted of DNA fragments with the same molecular size (75 kb, 67 kb, 54 kb). The actual number of fragments with the same size was determined by laser densitometry. Comparison of the electrophoretic mobility of the restriction fragments showed a signi¢cant degree of heterogeneity between the restriction patterns of the analyzed strains. Only ¢ve out of 14 SmaI fragments (230 kb, 57 kb, 45 kb, 5.1 kb, 3.6 kb) and three out of eight SgrAI fragments (75 kb, 70 kb, 5.1 kb) were found in the restriction patterns of both strains. The molecular size of the entire chromosome for each Table 2 Sizes of GBS chromosomal restriction fragments separated by PFGE Strain 78/471, serotype II/K+L

Strain 1/6586, serotype III/K

SmaI

SgrAI

SmaI

600 470 450 230 75 75 60 57 54 54 45 7.7 5.1 3.6 2186.4

1800 100 75 75 70 67 65 5.1

945 325 275 230 72 67 67 63 57 52 45 5.1 3.6

1900 94 75 70 67 45 5.1

2257.1

2206.7

2256.1

SgrAI

35

Fig. 1. The ¢rst genetic map of the GBS chromosome.

strain appeared to be approximately 2200 kb (Table 2). As expected, the GBS genome is considerably smaller than the genome of Escherichia coli (4700 kb) [27], Bacillus subtilis (5700 kb) [27], or even Streptococcus mutans (2800 kb) [20], but a little larger than the genome of Streptococcus pyogenes, a group A streptococcus (1920 kb) [21]. In order to establish the exact order of SmaI and SgrAI restriction sites on the GBS chromosome, several strategies were employed. First, double SmaISgrAI digestions were carried out. This allowed an estimate of the relative location of several SmaI and SgrAI sites by comparison with SmaI, SgrAI and SmaI-SgrAI restriction patterns. Another approach was to cut out most of the SmaI, SgrAI and SmaI-SgrAI fragments from the agarose gel after PFGE. Use of these fragments as DNA probes in cross-hybridization clearly con¢rmed the data of double digestion and resulted in the construction of the restriction map. The resultant restriction map of the GBS chromosome is presented in Fig. 1. The order of the large SmaI restriction sites in the GBS map was determined by incomplete digestion of the GBS DNA followed by DNA hybridization. The additional high molecular mass fragments were analyzed by their molecular mass and hybridized with GBS gene probes, corresponding to the smaller DNA fragments. For example, a DNA fragment of 1150 kb hybridized the scpB, glnA and valS genes and a fragment of 680 kb hybridized only the glnA and valS genes. The most di¤cult part was to determine the order of rrn-carrying fragments in

FEMSLE 8369 25-9-98

36

A. Dmitriev et al. / FEMS Microbiology Letters 167 (1998) 33^39

the range between 94 and 54 kb, due to their number and small size, which created di¤culties in resolving these fragments in PFGE. In order to investigate the degree of chromosomal heterogeneity between the strains under investigation, hybridization experiments using various DNA probes were carried out. This allowed the localization of various GBS genes on PFGE restriction fragments. Gene probes and their location on PFGE fragments are presented in Table 3. Analysis of strains of the two di¡erent GBS serotypes (II and III) demonstrated signi¢cant di¡erences in hybridization with DNA probes chosen for the analysis. Only ¢ve of 14 SmaI fragments (230 kb, 57 kb, 45 kb, 5.1 kb and 3.6 kb) and three of eight SgrAI fragments (75 kb, 70 kb and 5.1 kb) were present in both restriction patterns and hybridized with the same gene probes (Tables 2 and 3). It is noteworthy that some gene probes hybridizing with group A streptococcal (GAS) DNA (e.g. scpB, glnA) [4,28] were also appropriate for mapping the GBS genome. Furthermore, housekeeping genes, such as polA, ald, valS, rrs and rrl, previously described for other bacteria were also found in GBS (Table 3). These ¢ndings demonstrate the high degree of homology between the genes of di¡erent microorganisms. However, some of the genes (e.g., emm, fbp54, hylP) encoding GAS proteins involved

Fig. 2. Preliminary genetic maps of two GBS chromosomes (strains 78/471 and 1/6586). Numbers on the maps represent the sizes of the fragments in kilobases.

in virulence did not hybridize with GBS chromosomal DNA. On the other hand, bac, bca and cfb genes encoding potential GBS virulence factors were not detected in GAS by DNA-DNA hybridization or by PCR (data not shown). Only C5a peptidase was found in both GAS and GBS and the homology between the respective genes appeared to be 98% [4]. 3.2. Location and the structure of rRNA operons The number and the location of the so called ribosomal (rRNA) operon genes on the chromosome has been determined for many bacterial species, including Gram-positive cocci. Because of the signi¢-

Table 3 DNA probes used and their location on restriction fragments Locus

Activity/function

Size of restriction fragments (kb) Strain 78/471

cfb bca bac glnA scpB polA ald valS rrn

CAMP factor Alpha antigen Beta antigen with IgA-binding capacity Glutamine synthetase C5a peptidase DNA polymerase Alanine dehydrogenase Valyl tRNA synthetase Ribosomal operon from E. hirae

rrs

16S rRNA

rrl

23S rRNA

Strain 1/6586

SmaI

SgrAI

SmaI

SgrAI

450 600 75 450 470 75 60 230 75; 75; 54; 45; 75; 60; 5.1 75; 75; 3.6

1800 70 80 1800 1800 80 65 1800 100; 75; 75 ; 70; 65; 5.1 100; 75; 75 ; 70; 65; 5.1 100; 75; 75 ; 70; 65; 5.1

945 275 ^ 945 945 67 63 230 72 ; 67; 52 ; 45; 72 ; 67; 45 72 ; 67; 3.6

1900 45 ^ 1900 1900 75 67 1900 94; 75; 70; 67 ; 45; 5.1 94; 75; 70; 67 ; 45; 5.1 94; 75; 70; 67 ; 45; 5.1

60; 57; 54; 7.7; 5.1; 3.6 54; 45; 7.7; 57; 54; 5.1;

FEMSLE 8369 25-9-98

67; 63 ; 57; 5.1; 3.6 67; 63 ; 57; 67; 52 ; 5.1;

A. Dmitriev et al. / FEMS Microbiology Letters 167 (1998) 33^39

cant degree of homology between rRNA operons of di¡erent bacteria, their number and exact location on the chromosome can vary in strains of the same serotype. Therefore, one of the goals of the present investigation was to carry out a detailed analysis of the number and exact location on the GBS chromosome of rRNA operons. Two analyzed strains, 78/471 and 1/6586, revealed di¡erent hybridization patterns with rRNA operon gene probes (rrn). SmaI restriction fragments had 10 and nine hybridizing bands detected, respectively. The number of SgrAI DNA fragments hybridizing with this probe was six (Table 3). This ¢nding could be explained by the presence of a SmaI site inside the rRNA operons of GBS as is also found in Enterococcus hirae and Lactococcus lactis [17,20]. To con¢rm this possibility, two DNA probes were constructed based on the recombinant plasmid pApa1,8 [29]. One encoded the 3P-end of the 6S rRNA gene (rrs) of E. hirae and the other the 5Pend of the 23S rRNA gene (rrl) separated by a SmaI site [29]. Hybridization of rrs and rrl probes with SmaI fragments revealed that both probes hybridized with six SmaI fragments (Table 3). These results con¢rmed the presence of SmaI sites within the GBS rRNA operons. To con¢rm the presence of six copies of rRNA operons in the GBS genome, chromosomal DNA from several strains was digested with PvuII, and subjected to conventional electrophoresis, followed by transfer onto nylon ¢lters. After hybridization of the DNA fragments with both rrl and rrs gene probes, six hybridizing PvuII fragments were visualized for all strains under investigation. Taken together, these results allowed us to conclude that the two GBS genomes analyzed each contained six rRNA operons. By comparison, there are 10 rRNA operons in Bacillus subtilis [27], seven in Escherichia coli and Salmonella typhi [30], four in Pseudomonas aeruginosa [31], two or one in Mycoplasma capricolum [32], six rRNA operons in Lactococcus lactis [24,25], Enterococcus faecalis [22], Streptococcus thermophilus [23], Streptococcus pyogenes [21] and Streptococcus pneumoniae [33]. Thus, it is likely that six copies of rRNA operons in the genome is a signi¢cant taxonomic characteristic of Gram-positive cocci.

37

3.3. Occurrence of the small SmaI fragments in streptococcal genome DNA-DNA hybridization of SmaI restriction fragments with rRNA operon gene probes revealed the presence of several small hybridizing fragments, i.e., 7.7 kb, 5.1 kb, and 3.6 kb (Table 3). To investigate the occurrence of the smallest SmaI fragments in the genome, hybridization analysis of 12 GBS strains employing rRNA operon gene probes was performed. Our results showed that the smallest SmaI fragments obtained after PFGE (3.6 kb and 5.1 kb) are typical for all strains. However, the presence of the 7.7-kb SmaI fragment varied from strain to strain and was found only among the bac gene positive strains, capable of binding IgA. These data obtained by PFGE correlate with previous analyses based on the results of conventional electrophoresis which indicated that IgA binding GBS strains are di¡erent from the strains de¢cient in IgA binding by their restriction patterns [13,15]. It is possible that during evolution all GBS strains subdivided into two subpopulations di¡ering in their restriction patterns. Thus, the ability to bind human IgA might be used as a phenotypic marker which distinguishes GBS lineages. Additional new information about evolutionary relationships and linkages between GBS and others Gram-positive cocci will surely be found after the construction of the complete physical and genetic maps of the GBS chromosome. 3.4. Genetic chromosomal maps of two GBS strains Localization of the genes listed in Table 3 on the restriction map resulted in the ¢rst genetic map of the strain 78/471, serotype II/(a+b) (Fig. 1). This map shows that at least two rRNA operons are located close to each other and all rRNA operons are located within the region encompassing less than one ¢fth of the GBS genome. It is interesting to note that in other Gram-positive cocci, only ¢ve copies of rRNA operons are located on the same part of the chromosome and the last one was found to be located far from this region [21^26,33]. GBS genes encoding potential virulence factors such as scpB, bca, bac and cfb (Table 3) were located on di¡erent parts of the GBS genome. This ¢nding di¡ers from

FEMSLE 8369 25-9-98

38

A. Dmitriev et al. / FEMS Microbiology Letters 167 (1998) 33^39

the GAS genome where most of the pathogenicity factor genes were found in a rather small region of the chromosome [21]. Additional experiments (data not shown) were also performed for the serotype III strain 1/6586, to compare the genome organization of both strains under investigation. Analysis of molecular sizes of PFGE restriction fragments as a result of double SmaI and SgrAI digestions followed by DNA-DNA hybridization with di¡erent GBS probes (data not shown) allowed us to create a preliminary linear genome map for strain 1/6586 (Fig. 2). It is well recognized that adjacent SmaI fragments from strain 78/471 of 450 kb and 470 kb probably correspond to the 945-kb fragment from strain 1/ 6586. Additional proof comes from the location of the cfb, glnA and scpB genes on the 450-kb and 470kb fragments in strain 78/471 and the 945-kb fragment in strain 1/6586 (Table 3). Similarly, the 600-kb SmaI fragment from strain 78/471 hybridizing with the bca gene may correspond to two SmaI fragments (325 kb and 275 kb) from strain 1/6586 (Fig. 2). The location of the valS gene on the 230-kb SmaI fragment is characteristic of both strains. The location of housekeeping genes such as polA, ald, valS and six rRNA operons was also found to be on similar DNA fragments in both analyzed strains. All of these data taken together lead us to the conclusion that in spite of a signi¢cant degree of restriction fragment length polymorphism, the overall chromosomal organization of the GBS genetic map is fairly well conserved. The construction of the ¢rst physical and genetic maps of the GBS chromosome provides important preliminary insight into the organization of the entire GBS genome. It does not provide information concerning the role of genes possibly involved in pathogenicity, which will require a further detailed analysis. The results obtained in the present investigation can be considered a starting point for a detailed analysis of di¡erent group B streptococcal strains responsible for severe human diseases.

Acknowledgments We are grateful to Dr. J.J. Ferretti (Department of Microbiology and Immunology, University of Okla-

homa) who found time to read through the article and give important advice which helped to give it its present form. GBS strains 78/471 and 1/6586 were generously provided by Dr. P. Ferrieri (Department of Laboratory Medicine and Pathology and Pediatrics, University of Minnesota, USA) and Dr. Y. Yonghong (Department of Microbiology and Immunology, Beijing Children's Hospital, China), respectively. Also we grateful to Dr. L. Daneo-Moore (Temple University School of Medicine, Philadelphia, PA, USA), Dr. A. Podbielski (Department of Medical Microbiology, Technical University Hospital, Aachen, Germany) and Dr. V. Katerov (Institute of Molecular Microbiology, Institute of Experimental Medicine, St. Petersburg, Russia) who kindly provided the recombinant plasmids and sequence data of the genes.

References [1] Christensen, K.K., Christensen, P. and Ferrieri, P. (Eds.) (1985) Neonatal Group B Streptococcal Infection, Vol. 35. [2] Baker, C.J. and Edwards, M.S. (1990) Group B streptococcal infections. In: Infectious Diseases of the Fetus and Newborn Infant (Remington, J.S. and Klein, J.O., Eds.), pp. 742^811. Saunders, Philadelphia, PA. [3] Ferrieri, P. (1988) Surface-localized protein antigens of group B streptococci. Rev. Infect. Dis. 10, 363^366. [4] Chmouryguina, I.I., Suvorov, A.N., Ferrieri, P. and Cleary, P.P. (1996) Conservation of the C5a peptidase genes in group A and B streptococci. Infect. Immun. 64, 2387^2390. [5] Heden, L.O., Frithz, E. and Lindahl, G. (1991) Molecular characterization of an IgA receptor from group B streptococci: sequence of the gene, identi¢cation of a proline-rich region with unique structure and isolation of N-terminal fragments with IgA-binding capacity. Eur. J. Immunol. 21, 1481^1490. [6] Jerlstrom, P.J., Chhatwal, G.S. and Timmis, K.N. (1991) The IgA binding b antigen of the c protein complex of group B streptococci : sequence determination of its gene and detection of two binding regions. Mol. Microbiol. 5, 843^849. [7] Michel, J.L., Mado¡, L.C., Olson, K., Kling, D.E. and Kasper, D.L. (1993) Large, identical, tandem repeating units in the C protein alpha antigen gene, bca, of group B streptococci. Proc. Natl. Acad. Sci. USA 89, 10060^10064. [8] Stalhammar-Carlemalm, M., Stenberg, L. and Lindahl, G. (1993) Protein Rib : A novel group B streptococcal cell surface protein that confers protective immunity and is expressed by most strains causing invasive infections. J. Exp. Med. 177, 1593^1603. [9] Fonstein, M. and Haselkorn, R. (1995) Physical mapping of bacterial genomes. J. Bacteriol. 177, 3361^3369. [10] Chun, J.W., Olken, S.K., Ausubel, D.L., Kasper, D.L. and

FEMSLE 8369 25-9-98

A. Dmitriev et al. / FEMS Microbiology Letters 167 (1998) 33^39

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

Michel, J.L. (1994) Molecular analysis of genome DNAs of group B. Abstracts of 4th International ASM Conference on Streptococcal Genetics, Santa Fe, New Mexico, USA, p. 34. Dmitriev, A.V., Pak, J.V., Suvorov, A.N. and Totolian, A.A. (1997) Analysis of pathogenic group B streptococci by pulsed ¢eld gel electrophoresis. Adv. Exp. Med. Biol. 418, 351^353. Tanaka, D., Gyobu, Y. and Kodama, H. (1995) Typing of group B streptococci by pulsed-¢eld gel electrophoresis. Kansenshogaku Zasshi 69, 455^460. Dmitriev, A.V., Suvorov, A.N. and Totolian, A.A. (1997) Heterogeneity of the group B streptococcal genome. Folia Vet. 41, 77^80. Hauge, M., Jespersgaard, C., Poulsen, K. and Kilian, M. (1996) Population structure of Streptococcus agalactiae reveals an association between speci¢c evolutionary lineages and putative virulence factors but not disease. Infect. Immun. 64, 919^925. Suvorov, A., Dmitriev, A., Ustinovitch, I., Schalen, C. and Totolian, A. (1997) Molecular analysis of clinical group B streptococcal strains by use of a and b gene probes. FEMS Immunol. Med. Microbiol. 17, 149^154. Suvorov, A.N. and Ferretti, J.J. (1991) Genetic analysis of Streptococcus pyogenes M49 chromosomal DNA. In: Genetics and Molecular Biology of Streptococci, Lactococci and Enterococci (Dunny, G.M., Cleary, P.P. and McKay, L.L., Eds.), pp. 233^236. American Society for Microbiology, Washington, DC. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Suvorov, A.N., Sverdlova, A., Totolian, A.A. and Ferretti, J.J. (1995) Rapid gene analysis of streptococci by PCR. Med. Microbiol. Lett. 4, 341^345. Davidson, B.E., Kordias, N., Bassegio, N., Lim, A., Dobos, M. and Hillier, A.J. (1994) Genomic organization of Lactococci. In: International Association of Biological Standardization, Genetics of Streptococci, Lactococci and Enterococci (Ferretti, J.J., Gilmore, M.S., Klaenhammer, T.R. and Brown, F., Eds.), pp. 411^422. Hantman, M.J., Sun, S., Piggot, P.J. and Daneo-Moore, L. (1995) Chromosome organization of Streptococcus mutans GS-5. J. Gen. Microbiol. 139, 67^77. Suvorov, A.N. and Ferretti, J.J. (1996) Physical and genetic map of an M 1 type strain of Streptococcus pyogenes. J. Bacteriol. 178, 5546^5549.

39

[22] Murray, B.F., Singh, K.V., Ross, R.P., Heath, J.P., Dunny, G.M. and Weinstock, G.M. (1993) Generation of restriction map of Enterococcus faecalis OG1 and investigation of growth requirements and regions encoding biosynthetic function. J. Bacteriol. 175, 5216^5223. [23] Roussel, Y., Pebay, M., Guedon, G., Simonet, J.M. and Decaris. (1994) Physical and genetic map of Streptococcus thermophilus A054. J. Bacteriol. 176, 7413^7422. [24] Tulloch, D.L., Finch, L.R., Hillier, A.J. and Davidson, B.E. (1991) Physical map of the chromosome of Lactococcus lactis subsp. lactis DL11 and localization of six putative rRNA operons. J. Bacteriol. 173, 2768^2775. [25] Le Bourgeois, P., Lautier, M., Mata, M. and Ritzenthaler, P. (1992) Physical and genetic map of the chromosome of Lactococcus lactis subsp. lactis IL 1403. J. Bacteriol. 174, 6752^ 6762. [26] Le Bourgeois, P., Lautier, M., Van Der Berghe, L., Serin, G., Nedjari, H. and Ritzenthaler, P. (1995) Physical and genetic maps of the chromosome of the Lactococcus lactis subsp. lactis strain IL 1403 and Lactococcus lactis subsp. cremoris strain MG 1363. In: International Association of Biological Standardization. Genetics of Streptococci, Lactococci and Enterococci (Ferretti, J.J., Gilmore, M.S., Klaenhammer, T.R. and Brown, F., Eds.), pp. 597^603. [27] Kraweic, S. and Riley, M. (1990) Organization of the bacterial chromosome. Microbiol. Rev. 54, 502^539. [28] Suvorov, A.N., Flores, A.E. and Ferrieri, P. (1997) Cloning of the glutamine synthetase gene from group B streptococci. Infect. Immun. 65, 191^196. [29] Sechi, L. and Daneo-Moore, L. (1993) Characterization of intergenic spacers in two rrn operons. J. Bacteriol. 175, 3213^3219. [30] Liu, S.-L. and Sanderson, K.E. (1995) Rearrangements in the genome of the bacterium Salmonella typhi. Proc. Natl. Acad. Sci. USA 92, 1018^1022. [31] Romling, U., Greipel, J. and Tummler, B. (1995) Gradient of genomic diversity in the Pseudomonas aeruginosa chromosome. Mol. Microbiol. 17, 323^332. [32] Sawada, M., Osawa, S., Kobayashi, H., Hori, H. and Muto, A. (1981) The number of ribosomal RNA genes in Mycoplasma capricolum. Mol. Gen. Genet. 182, 502^504. [33] Gasc, A.M., Kauc, L., Barraille, P., Sicard, M. and Goodgal, S. (1991) Gene localization, size, and physical map of the chromosome of Streptococcus pneumoniae. J. Bacteriol. 173, 7361^7367.

FEMSLE 8369 25-9-98