- Email: [email protected]
Plant expressed Coccidial antigens as potential vaccine candidates in protecting chicken against Coccidiosis
Vaccine 30 (2012) 4460–4464
Contents lists available at SciVerse ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Plant expressed Coccidial antigens as potential vaccine candidates in protecting chicken against Coccidiosis Kota Sathish a , Rajan Sriraman a , B. Mohana Subramanian a , N. Hanumantha Rao a , Balaji Kasa a , Jagan Donikeni a , M. Lakshmi Narasu b , V.A. Srinivasan a,∗ a b
Research & Development Centre, Indian Immunologicals Limited, Rakshapuram, Gachibowli, Hyderabad 500032, Andhra Pradesh, India Institute of Science and Technology, Jawaharlal Nehru Technological University, Kukatpalli, Hyderabad 500072, Andhra Pradesh, India
a r t i c l e
i n f o
Article history: Received 10 March 2012 Received in revised form 14 April 2012 Accepted 21 April 2012 Available online 1 May 2012 Keywords: Plant expressed EtMIC1 and EtMIC2 Subunit vaccine Coccidial antigens Eimeria microneme proteins
a b s t r a c t Coccidiosis is a disease caused by intracellular parasites belonging to the genus Eimeria. In the present study, we transiently expressed two coccidial antigens EtMIC1 and EtMIC2 as poly histidine-tagged fusion proteins in tobacco. We have evaluated the protective efficacy of plant expressed EtMIC1 as monovalent and as well as bi-valent formulation where EtMIC1 and EtMIC2 were used in combination. The protective efficacy of these formulations was evaluated using homologous challenge in chickens. We observed better serum antibody response, weight gain and reduced oocyst shedding in birds immunized with EtMIC1 and EtMIC2 as bivalent formulation compared to monovalent formulation. However, IFN-␥ response was not significant in birds immunized with EtMIC1 compared to the birds immunized with EtMIC2. Our results indicate the potential use of these antigens as vaccine candidates. © 2012 Elsevier Ltd. All rights reserved.
1. Introduction Coccidiosis is a parasitic disease caused to the chicken by protozoan of genus Eimeria. The pathologic effects of virulent infection of the chicken coccidia vary according to the species, ranging from mild enteritis to severe hemorrhage and death [1]. Despite the use of coccidio-stats in the continuous medication programs, the economic loss due to coccidiosis remains high [2]. Ubiquitous use of anticoccidial drugs has also led to the development of resistance to anticoccidial drugs [3,4]. The European Parliament and Council decided to phase out the anti-coccidial drugs by 2012 [5]. Vaccinations could offer excellent alternatives to drugs as a means of controlling coccidiosis. Efforts to develop various types of vaccines have been relentless over the past several decades [6–8]. Recombinant Eimeria encoded proteins have been expressed in various host systems and their efficacy upon in-ovo immunization for protection against Eimeria infections determined [9–11] using virulent challenge. The use of microbial fermentation or cell culture systems for production of recombinant proteins has limitations such as cost, scalability and safety that have prompted research into alternatives. Plants allow the cost-effective production of recombinant proteins on large scale, while eliminating risks of product contamination with human pathogens [12]. A number of target
∗ Corresponding author. Tel.: +91 40 23000211; fax: +91 40 2300 5958. E-mail address: [email protected] (V.A. Srinivasan). 0264-410X/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.vaccine.2012.04.076
antigens expressed in plants were used as subunit vaccine candidates [13–15]. The efficacy studies on out-bred chicken population by administering plant produced Eimeria tenella microneme-2 (EtMIC2) protein as vaccine was reported earlier [11]. In the present study, we have evaluated the protective efficacy of plant expressed EtMIC1 as monovalent vaccine as well as a formulation in combination with EtMIC2 against homologous challenge in chickens. 2. Material and methods 2.1. Chicken White Leghorn day-old, coccidiosis free, male layer chickens (commercial breed-BV 300), were obtained from Sri Venkateswara Hatcheries (Hyderabad, India) and reared in clean brooder cages. 2.2. Coccidial oocysts Wild type E. tenella oocysts were isolated from an Eimeria infected farm in India. Oocysts were propagated in 3 weeks old birds by repeated passages [16]. Purity of oocyst suspension was assessed by species-specific nested-PCR for ribosomal Internal Transcribed Spacer I (ITS-I) region as described by us earlier [17]. 2.3. Tobacco plant Nicotiana tabacum, cultivar Petit Havana SR1, was cultivated in the greenhouse. Leaves from 3 to 6 weeks old plants were used for vacuum infiltration.
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
4461
Table 1 Treatment groups. Group
Immunogen (g/bird)
Immunization (days)
Bleeding (days)
Splenocyte isolation (days)
Group I (n = 34) Group II (n = 14) Group III (n = 14) Group IV (n = 22)
EtMIC1 (80) EtMIC1 (80) + EtMIC2 (50) PBS PBS
0, 7, 14, 21 0, 7, 14, 21 0, 7, 14, 21 0, 7, 14, 21
0, 7, 14, 21, 28 0, 7, 14, 21, 28 0, 7, 14, 21, 28 0, 7, 14, 21, 28
24, 27, 30, 33 24, 27, 30, 33 Not done 24, 27, 30, 33
2.4. Cloning of EtMIC1 gene into plant expression vector 2.4.1. Cloning E. tenella Microneme-1 (EtMIC1) gene was amplified from a plasmid clone containing the full-length gene sequence of EtMIC1 [16] using Proofstart polymerase (Qiagen, USA) and the following primers. EtMIC1 forward primer – 5 ATCGCCATGGAATGGCGCCCCTTCCTCGGCG 3 , EtMIC1 reverse primer – 5 GCGGCCGCGGATGCCCACATCTCTGATTGTT 3 . The amplified product was cloned into plant expression vector, pTRA ERH, downstream of the double 35S promoter using NcoI and NotI restriction enzyme sites. 2.4.2. Methods of Agrobacterium transformation Transient expression, qualitative assessment of m-RNA transcript using RT-PCR, and protein purification from infiltrated leaves were performed as described previously [11]. 2.5. SDS-PAGE analysis and immunoblotting Purified recombinant EtMIC1 protein was resolved on SDSPAGE; the protein was also electro-blotted on to PVDF membrane (Hybond-P; GE-Healthcare, USA). The blots were probed using either one of the following antibodies. (1) Anti-His5 monoclonal antibody conjugated to Horse-Radish peroxidase (1:3000 dilution; Qiagen, Germany); (2) rabbit polyclonal sera reactive against EtMIC1 protein; (3) chicken immune sera obtained by immunizing E. coli expressed recombinant EtMIC1 protein. Un-infiltrated tobacco leaves were used as negative control, while E. coli expressed recombinant EtMIC1 [16] proteins were used as positive control. 2.6. Immunization and efficacy study The immune efficacy study consisted of four treatment groups. Birds in Group I were immunized with 80 g of EtMIC1 protein as monovalent vaccine. Birds in Group II were immunized with 80 g of EtMIC1 and 50 g EtMIC2 in combination as bivalent vaccine. Whereas, Groups III and IV were sham-immunized with phosphate buffered saline (PBS). Antigens were administered via intramuscular route in thigh muscle. The immunization schedule consisted of a primary dose adjuvanted with Freund’s complete adjuvant on 7 days old birds and two booster doses adjuvanted with Freund’s incomplete adjuvant on 14th and 21st days. Number of birds in each group and treatment details are listed in Table 1. 2.6.1. Humoral immune response Birds were bled prior to each immunization and on 28th day post primary immunization. Serum antibody titers against immunized proteins were measured using an indirect ELISA using E. coli expressed recombinant EtMIC1 and EtMIC2 proteins to assess specific antibody titers.
2.6.2. Evaluation of cell-mediated immune response in EtMIC1 immunized birds Relative IFN-␥ expression was quantified as fold increase in IFN-␥ mRNA with respect to uninduced naïve birds. Spleens were collected after euthanizing birds on 3rd, 6th and 9th days post final immunization and on 3rd day post challenge. Five birds immunized with plant expressed EtMIC1 were splenectomized on each day of sampling. Splenocytes from each bird were cultured separately as described previously [11]. The splenocytes obtained from the sham-immunized birds were employed as negative control. The splenocytes were stimulated using 20 g/ml of recombinant E. coli expressed EtMIC1 protein at the time of seeding. Twenty microgram per milliliter of E. coli expressed Heat shock protein (HSP) was used for mock stimulation while 15 g/ml of concanavalin A (Genie, India) was used as positive control for the evaluation of IFN-␥ response in the splenocytes. Primers and TaqMan probes to quantify the IFN␥ mRNA and 28S rRNA in the samples were designed as described previously [11]. Total RNA extraction from splenocytes, sequence of primers, probes and the method of Real Time PCR were described previously [11]. The Ct value of 28S was used to normalize the Ct value of IFN-␥ (Ct) as described by Leutenegger et al. [18]. The Ct value of sham-induced cells from each spleen was used as calibrator for other stimulated cells from the same spleen to calculate the value of Ct (Ct = Cttarget − Ctcalibrator ) using the comparative Ct method [19]. Statistical analysis was performed using the OriginPro (version-7.5) software and the difference in mean was subjected to a Student’s t-test. 2.6.3. Challenge experiment Nine days post final immunization; birds of Groups I–III were inoculated orally with 10,000 sporulated E. tenella oocysts. Birds were weighed prior to challenge and on 7th and 11th days post challenge to determine the weight gain. The average weight gain (percent) of birds and oocyst shed per gram of fecal matter was determined [16]. An average of three counts per group was taken to enumerate reduction in oocyst shedding. The percentage decrease in oocyst output compared with the sham-immunized but challenged birds was estimated [16]. 3. Results 3.1. Recombinant Agrobacterium clones containing EtMIC1 expression plasmid A 2.1 kb size EtMIC1 gene was obtained by amplifying with gene specific primers. Cloning of EtMIC1 gene into pTRA-ERH vector was confirmed by observing insert release upon digestion with NcoI and NotI restriction enzymes. Recombinant agrobacterium clones were also screened using PCR with gene specific primers for EtMIC1 sequence, agrobacterium clones harboring EtMIC1 gene produced a PCR amplification product of 2.1 kb size (data not shown). 3.2. Transient expression of EtMIC1 protein in Nicotiana tabacum using Agro-infiltration technique The full-length EtMIC1 coding sequence was amplified from the total RNA extracted from the infiltrated leaves. The amplification
4462
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
Fig. 1. (a) SDS–PAGE gel stained with coomassie blue showing EtMIC1 protein band at 100 kDa, (b) immunoblot demonstrating plant expressed EtMIC1 protein band showing at 100 kDa, (i) specific reactivity against Anti-His5 HRPO conjugate monoclonal antibody. (ii) reactivity with polyclonal sera raised against E. coli expressed EtMIC1 protein in chickens. (iii) Reactivity with peptide raised sera against EtMIC1 protein. Lanes 1, 2, and 5 are with plant expressed proteins, lanes 3, and 6 are with un-infiltrated leaves taken as negative controls and lanes 4 and 7 are with pre-stained marker (Fermentas).
reactions performed using RNA extracted from mock-infiltrated leaves and the reverse transcriptase negative control did not produce any PCR amplification (Supplementary Fig. 1), indicating specific amplification of EtMIC1 from the RNA samples. Upon confirming the presence of specific mRNA, infiltrated leaf samples were processed to purify the His6 tagged recombinant protein. The yield of the purified protein was found to be 25 mg/kg fresh biomass. The purified recombinant EtMIC1 protein was characterized using immunoblotting by probing the affinity-purified protein with either rabbit polyclonal antibodies against EtMIC1 protein or anti-His5 monoclonal antibody. A protein band of approximately 100 kDa, corresponding to the expected size of EtMIC1 protein, was detected in all the immuno-blots (Fig. 1). Protein extract from tobacco leaves infiltrated with un-transformed agrobacterium was used as negative control in all the above blots, which showed no reactivity to the antibodies used. Supplementary material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.vaccine.2012.04.076. 3.3. Serum antibody response in immunized birds The serum samples collected from the immunized birds on days 14, 21 and 28 were analyzed for the presence of the serum IgG antibodies. EtMIC1 and EtMIC2 expressed in E. coli was used to measure specific immune response in the immunized birds. Recombinant EtMIC1 protein induced serum IgG titers in immunized birds and exhibited an average serum antibody titers of 466.7 (±321.5) on 14th day, 541.6 (±469) on 21st day and 1131.3 (±920.8) on 28th day. Birds immunized in combination had induced an average serum antibody titer of 150 (±53.4) on 14th day, 500 (±185.1) on 21st day and 1700 (±667.6) on 28th day against EtMIC1 and 162.5 (±51.7) on 14th day, 525 (±237.5) on 21st day and 1900 (±848.5) on 28th day against EtMIC2 (Fig. 2). 3.4. Evaluation of cell-mediated immune response in EtMIC1 immunized birds The linear fit of the Ct curve obtained for IFN-␥ and 28S at different dilutions of the RNA had a slope value of −0.0045. The near zero slope values indicates similar PCR amplification efficiency of IFN-␥ and 28S mRNA therefore relative quantification method of 2−Ct was validated for comparing the mRNA expression levels using 28S as internal control. There was an average increase
Fig. 2. ELISA titers (mean ± SD) of sera from birds immunized with plant expressed EtMIC1 as monovalent vaccine and EtMIC1 and EtMIC2 in combination as bivalent vaccine. The assay was performed using indirect ELISA in a maxisorp plate coated with E. coli expressed EtMIC1 or EtMIC2 protein. Antibody titers in the serum were determined as maximum sera dilution showing OD450 greater than mean + 3 × SD of pre-immune sera (N = 14).
in IFN-␥ mRNA expression levels in the in vitro induced splenocytes cultured from spleens of birds on 3rd day post-immunization (Fig. 3). IFN-␥ m-RNA could not be detected in the induced splenocytes. 3.5. Bird challenge experiment 3.5.1. Weight gain Birds in Groups I, II, and III were challenged with 10,000 virulent E. tenella oocysts. Weight gain was assessed on 7 and 11 days post-challenge (dpc). The percentage increase in weight in the immunized birds compared to sham immunized–challenged birds (Group III). It was observed that the birds immunized with EtMIC1 alone had 32% (±16) and 52% (±24) increase in weight on 7 and 11 dpc respectively. Birds immunized with combined EtMIC1 and EtMIC2 vaccine had 34% (±6.9) and 58% (±5.9) increase in weight gain on 7 and 11 dpc. The difference in the mean weight gain was subjected to Student’s t-test. The mean weight gain was significantly different in all immunized birds on 7 dpc when compared with sham-immunized and challenged group (p < 0.05*; N = 14) (Fig. 4).
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
Fig. 3. IFN-␥ levels quantified using real time RT-PCR among EtMIC1 vaccinated birds compared to unstimulated birds on day 3 post immunization (N = 5). Mean value for the group is indicated by a line.
Fig. 4. Percentage change in weight gain of immunized birds compared to shamimmunized unchallenged birds. Weight gain was calculated on 7th and 11th day after challenge. Mean value for the group is indicated by a line. The asterisks indicate significant change in weight gain compared to sham-immunized and challenged birds (*p < 0.05; **p < 0.01; N = 14).
3.5.2. Oocyst count The decrease in oocyst output was calculated by comparing the oocyst output of sham-immunized challenged birds (Group III). Immunization of birds with EtMIC1 protein reduced the oocyst output by 68% and in combination oocyst shedding was reduced by 72% (Fig. 5). Our results indicated that immunization of birds with the plant expressed recombinant proteins imparted significant protection to chicken against homologous challenge. 4. Discussion Coccidiosis vaccines could offer a promising alternative to drugs as a means of controlling coccidiosis. Numerous vaccination strategies have been attempted to manage avian coccidiosis [16,20–22]. Several recombinant sub unit coccidial antigens have been used
4463
Fig. 5. Oocyst output in immunized birds compared to mock immunized and challenged group. The oocyst shedding per gram of faces was determined using McMaster counting chamber. The bar represents an average of 3 counts per group. There was more than 60% reduction in oocyst output in the vaccinated groups compared to sham-immunized challenged birds.
in experimental immunizations with varying degree of success [16,23]. Sporozoites are the invading stage of the parasite, which harbors microneme organelles located at the apical tip. Several types of microneme proteins are secreted by sporozoite that play critical role in host invasion. Recombinant microneme antigens expressed in various expression systems have been shown to protect the chicken against virulent challenge when used as vaccine candidate [16]. Our earlier work suggested that plant expressed EtMIC2 protein imparts protection against homologous challenge in chicken [11]. We have assessed the protective efficacy of plant expressed EtMIC1 protein, which was administered either as monovalent formulation or in bivalent formulation with plant expressed EtMIC2 protein. The utility of combination of two E. tenella microneme proteins as potential vaccine candidate has not been explored so far. For the protozoan disease, it is important to develop multivalent vaccine to prevent immune evasion. Most of the microneme proteins are known to be associated with cell invasion or parasite motility upon attachment to the host cell. The multiplicity of these invasion proteins may indicate alternate invasion strategies adopted by the parasite. Therefore, neutralizing single major protein associated with invasion/motility may not protect birds against a virulent pathogen. Our results indicate that birds immunized with a bivalent formulation containing EtMIC1 and EtMIC2 imparted better protection to the birds. Plant expressed EtMIC1 was able to induce high serum antibody response in immunized birds. We observed that the serum antibody titers were higher for EtMIC2 protein [11] compared to EtMIC1 protein on 14th, 21st, and 28th days post-immunization. Birds immunized with bivalent vaccine had shown better antibody response against both the antigens compared to the birds immunized with either EtMIC1 or EtMIC2 as monovalent vaccine indicating co-operativity between the two antigens. There was an average increase of IFN-␥ response in birds immunized with EtMIC1 alone on 3rd day post-immunization, while no CMI response was obtained on 6th, 9th day post-immunization and 3rd day post challenge. Birds immunized with EtMIC2 alone [11] showed better CMI response when compared to the birds immunized with EtMIC1 alone. We do not yet know whether EtMIC1 harbors effective T-cell epitopes as indicated by poor CMI response in EtMIC1 immunized birds. Given that EtMIC1 immunized birds had better weight gain
4464
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
and oocyst reduction, our data suggests predominance of humoral immune response in conferring protective immunity in birds. Birds immunized with vaccine formulation containing both EtMIC1 and EtMIC2 showed increased weight gain compared to the birds immunized either with EtMIC1 or EtMIC2 separately [11]. The un-immunized birds challenged with sporulated oocysts showed marginal increase in weight. This phenomenon is not unusual given the fact that the disease is self-limiting in nature. It would be interesting to see if the combined vaccine formulation is also able to impart protection to the immunized birds in heterologous challenge. We found that the increase in percentage weight gain was significant on 7th and 11th days post-challenge in immunized birds compared to the sham-immunized challenged birds. We observed that there was reduction of up to 68% of oocyst output from birds immunized with EtMIC1 protein, 66% from EtMIC2 protein [11] and 72% from EtMIC1 and EtMIC2 proteins given in combination in comparison with unimmunized challenged birds. Clearly the percentage reduction in oocyst output was more in birds immunized with bivalent vaccine compared to the birds immunized with either EtMIC1 or EtMIC2 alone [11]. Reduced oocysts output would help reducing the disease burden on farm by lowering the number of birds exposed to the pathogen. Moreover, the sub-lethal dose of oocyst ingestion may help in establishing immunity in the birds. The serum antibody titers were high in birds immunized with EtMIC2 [11], while percentage increase in weight and reduction in oocyst output was higher in EtMIC1 vaccinated birds. As discussed previously humoral immune response in Eimeria infected bird seems to be important in conferring protection. In conclusion, plant expressed coccidial antigens were immunogenic and conferred protection against challenge with live oocysts. Vaccination with live or attenuated parasites to control coccidiosis has limitations such as difficulties in large-scale manufacturing and reversion to virulent form. Plants have the ability to express simultaneously several heterologous genes under control conditions, which may help to develop an effective multivalent vaccine for coccidiosis, thus offering an economically viable alternative to the conventional protein expression platforms. Our results are encouraging and hold promise in developing a cost effective sub-unit vaccine. Further work is required to optimize the dosage regimen and the antigen payloads and formulation that are most efficacious. References [1] Williams RB. Epidemiological aspects of the use of live anticoccidial vaccines for chickens. International Journal for Parasitology 1998;28:1089–98. [2] Williams RB. A compartmentalised model for the estimation of the cost of coccidiosis to the world’s chicken production industry. International Journal for Parasitology 1999;29:1209–29. [3] Chapman HD. Biochemical genetic and applied aspects of drug resistance in Eimeria parasites of the fowl. Avian Pathology 1997;26:221–4.
[4] Shirley MW, Bushell AC, Bushell JE, McDonald V, Roberts B. A live attenuated vaccine for the control of avian coccidiosis: trials in broiler breeders and replacement layer flocks in the United Kingdom. Veterinary Record 1995;137:453–7. [5] Regulation (EC) No.1831/2003 of the European Parliament and of the council of 22 September 2003 on additives for use in animal nutrition. Official Journal of the European Union 2003;L268:29–43. [6] Tomley FM, Bumstead JM, Billington KJ, Dunn PPJ. Molecular cloning and characterization of a novel acidic microneme protein (EtMIC2) from the apicomplexan protozoan parasite Eimeria tenella. Molecular and Biochemical Parasitology 1996;79:195–206. [7] Lillehoj HS, Trout JM. Coccidia: a review of recent advances on immunity and vaccine development. Avian Pathology 1993;22:3–21. [8] Lillehoj HS, Lillehoj EP. Avian coccidiosis: a review of acquired intestinal immunity and vaccination strategies. Avian Diseases 2000;44:408–25. [9] Lillehoj HS, Ding X, Dalloul RA, Sato T, Yasuda A, Lillehoj EP. Embryo vaccination against Eimeria tenella and E. acervulina infections using recombinant proteins and cytokine adjuvants. Journal of Parasitology 2005;91:666–73. [10] Ding X, Lillehoj HS, Dalloul RA, Min W, Sato T, Yasuda A, et al. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis. Vaccine 2005;23(28):3733–40. [11] Sathish K, Sriraman R, Mohana Subramanian B, Hanumantha Rao N, Balaji K, Lakshmi Narasu M, et al. Plant expressed EtMIC2 is an effective immunogen in conferring protection against chicken Coccidiosis. Vaccine 2011;29:9201–8. [12] Twyman RM, Stoger E, Schillberg S, Christou P, Fischer R. Molecular farming in plants: host systems and expression technology. Trends in Biotechnology 2003;21:570–8. [13] Biemelt S, Sonnewald U, Galmbacher P, Willmitzer L, Muller M. Production of human papillomavirus type 16 virus-like particles in transgenic plants. Journal of Virology 2003;77:9211–20. [14] Marˇııa JDS, Andrés W, Karina T, Raúl DR, Pascual MF, Felix G, et al. A novel methodology to develop a foot and mouth disease virus (FMDV) peptide-based vaccine in transgenic plants. Vaccine 2002;20:1141–7. [15] Yusibov V, Hooper DC, Spitsin SV, Fleysh N, Kean RB, Mikheeva T, et al. Expression in plants and immunogenicity of plant virus-based experimental rabies vaccine. Vaccine 2002;20:3155–64. [16] Mohana Subramanian B, Sriraman R, Hanumantha Rao N, Raghul J, Thiagarajan D, Srinivasan VA. Cloning, expression and evaluation of the efficacy of a recombinant Eimeria tenella sporozoite antigen in birds. Vaccine 2008;26:3489–96. [17] Bhaskaran MS, Venkatesan L, Aadimoolam R, Tirunelveli JH, Sriraman R. Sequence diversity of internal transcribed spacer-1(ITS-1) region of Eimeria infecting chicken and its relevance in species identification from Indian field samples. Parasitology Research 2010;106(2):513–21. [18] Leutenegger CM, Alluwaimi AM, Smith WL, Perani L, Cullor JS. Quantitation of bovine cytokine mRNA in milk cells of healthy cattle by realtime TaqMan polymerase chain reaction. Veterinary Immunology and Immunopathology 2000;77:275–87. [19] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2−Ct method. Methods 2001;25:402–8. [20] Kim KS, Jenkins MC, Lillehoj HS. Immunization of chickens with live Escherichia coli expressing Eimeria acervulina merozoite recombinant antigen induces partial protection against coccidiosis. Infection and Immunity 1989;57(8):2434–40. [21] Williams RB. Anticoccidial vaccines for broiler chickens: pathways to success. Avian Pathology 2002;31(4):317–53. [22] Seung Jang I, Hyun Lillehoj I, Sung Lee H, Kyung Lee W, Myeong Park S, James Cha S, et al. Eimeria maxima recombinant Gam82 gametocyte antigen vaccine protects against coccidiosis and augments humoral and cell-mediated immunity. Vaccine 2010;28:2980–5. [23] Lillehoj HS, Chai KD, Jenkins MC, Vakharia VN, Song KD, Han JY, et al. A recombinant Eimeria protein inducing Interferon-(productions; comparison of different Gene expression systems and immunization strategies for vaccination against coccidiosis. Avian Diseases 2000;49:379–89.
Contents lists available at SciVerse ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Plant expressed Coccidial antigens as potential vaccine candidates in protecting chicken against Coccidiosis Kota Sathish a , Rajan Sriraman a , B. Mohana Subramanian a , N. Hanumantha Rao a , Balaji Kasa a , Jagan Donikeni a , M. Lakshmi Narasu b , V.A. Srinivasan a,∗ a b
Research & Development Centre, Indian Immunologicals Limited, Rakshapuram, Gachibowli, Hyderabad 500032, Andhra Pradesh, India Institute of Science and Technology, Jawaharlal Nehru Technological University, Kukatpalli, Hyderabad 500072, Andhra Pradesh, India
a r t i c l e
i n f o
Article history: Received 10 March 2012 Received in revised form 14 April 2012 Accepted 21 April 2012 Available online 1 May 2012 Keywords: Plant expressed EtMIC1 and EtMIC2 Subunit vaccine Coccidial antigens Eimeria microneme proteins
a b s t r a c t Coccidiosis is a disease caused by intracellular parasites belonging to the genus Eimeria. In the present study, we transiently expressed two coccidial antigens EtMIC1 and EtMIC2 as poly histidine-tagged fusion proteins in tobacco. We have evaluated the protective efficacy of plant expressed EtMIC1 as monovalent and as well as bi-valent formulation where EtMIC1 and EtMIC2 were used in combination. The protective efficacy of these formulations was evaluated using homologous challenge in chickens. We observed better serum antibody response, weight gain and reduced oocyst shedding in birds immunized with EtMIC1 and EtMIC2 as bivalent formulation compared to monovalent formulation. However, IFN-␥ response was not significant in birds immunized with EtMIC1 compared to the birds immunized with EtMIC2. Our results indicate the potential use of these antigens as vaccine candidates. © 2012 Elsevier Ltd. All rights reserved.
1. Introduction Coccidiosis is a parasitic disease caused to the chicken by protozoan of genus Eimeria. The pathologic effects of virulent infection of the chicken coccidia vary according to the species, ranging from mild enteritis to severe hemorrhage and death [1]. Despite the use of coccidio-stats in the continuous medication programs, the economic loss due to coccidiosis remains high [2]. Ubiquitous use of anticoccidial drugs has also led to the development of resistance to anticoccidial drugs [3,4]. The European Parliament and Council decided to phase out the anti-coccidial drugs by 2012 [5]. Vaccinations could offer excellent alternatives to drugs as a means of controlling coccidiosis. Efforts to develop various types of vaccines have been relentless over the past several decades [6–8]. Recombinant Eimeria encoded proteins have been expressed in various host systems and their efficacy upon in-ovo immunization for protection against Eimeria infections determined [9–11] using virulent challenge. The use of microbial fermentation or cell culture systems for production of recombinant proteins has limitations such as cost, scalability and safety that have prompted research into alternatives. Plants allow the cost-effective production of recombinant proteins on large scale, while eliminating risks of product contamination with human pathogens [12]. A number of target
∗ Corresponding author. Tel.: +91 40 23000211; fax: +91 40 2300 5958. E-mail address: [email protected] (V.A. Srinivasan). 0264-410X/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.vaccine.2012.04.076
antigens expressed in plants were used as subunit vaccine candidates [13–15]. The efficacy studies on out-bred chicken population by administering plant produced Eimeria tenella microneme-2 (EtMIC2) protein as vaccine was reported earlier [11]. In the present study, we have evaluated the protective efficacy of plant expressed EtMIC1 as monovalent vaccine as well as a formulation in combination with EtMIC2 against homologous challenge in chickens. 2. Material and methods 2.1. Chicken White Leghorn day-old, coccidiosis free, male layer chickens (commercial breed-BV 300), were obtained from Sri Venkateswara Hatcheries (Hyderabad, India) and reared in clean brooder cages. 2.2. Coccidial oocysts Wild type E. tenella oocysts were isolated from an Eimeria infected farm in India. Oocysts were propagated in 3 weeks old birds by repeated passages [16]. Purity of oocyst suspension was assessed by species-specific nested-PCR for ribosomal Internal Transcribed Spacer I (ITS-I) region as described by us earlier [17]. 2.3. Tobacco plant Nicotiana tabacum, cultivar Petit Havana SR1, was cultivated in the greenhouse. Leaves from 3 to 6 weeks old plants were used for vacuum infiltration.
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
4461
Table 1 Treatment groups. Group
Immunogen (g/bird)
Immunization (days)
Bleeding (days)
Splenocyte isolation (days)
Group I (n = 34) Group II (n = 14) Group III (n = 14) Group IV (n = 22)
EtMIC1 (80) EtMIC1 (80) + EtMIC2 (50) PBS PBS
0, 7, 14, 21 0, 7, 14, 21 0, 7, 14, 21 0, 7, 14, 21
0, 7, 14, 21, 28 0, 7, 14, 21, 28 0, 7, 14, 21, 28 0, 7, 14, 21, 28
24, 27, 30, 33 24, 27, 30, 33 Not done 24, 27, 30, 33
2.4. Cloning of EtMIC1 gene into plant expression vector 2.4.1. Cloning E. tenella Microneme-1 (EtMIC1) gene was amplified from a plasmid clone containing the full-length gene sequence of EtMIC1 [16] using Proofstart polymerase (Qiagen, USA) and the following primers. EtMIC1 forward primer – 5 ATCGCCATGGAATGGCGCCCCTTCCTCGGCG 3 , EtMIC1 reverse primer – 5 GCGGCCGCGGATGCCCACATCTCTGATTGTT 3 . The amplified product was cloned into plant expression vector, pTRA ERH, downstream of the double 35S promoter using NcoI and NotI restriction enzyme sites. 2.4.2. Methods of Agrobacterium transformation Transient expression, qualitative assessment of m-RNA transcript using RT-PCR, and protein purification from infiltrated leaves were performed as described previously [11]. 2.5. SDS-PAGE analysis and immunoblotting Purified recombinant EtMIC1 protein was resolved on SDSPAGE; the protein was also electro-blotted on to PVDF membrane (Hybond-P; GE-Healthcare, USA). The blots were probed using either one of the following antibodies. (1) Anti-His5 monoclonal antibody conjugated to Horse-Radish peroxidase (1:3000 dilution; Qiagen, Germany); (2) rabbit polyclonal sera reactive against EtMIC1 protein; (3) chicken immune sera obtained by immunizing E. coli expressed recombinant EtMIC1 protein. Un-infiltrated tobacco leaves were used as negative control, while E. coli expressed recombinant EtMIC1 [16] proteins were used as positive control. 2.6. Immunization and efficacy study The immune efficacy study consisted of four treatment groups. Birds in Group I were immunized with 80 g of EtMIC1 protein as monovalent vaccine. Birds in Group II were immunized with 80 g of EtMIC1 and 50 g EtMIC2 in combination as bivalent vaccine. Whereas, Groups III and IV were sham-immunized with phosphate buffered saline (PBS). Antigens were administered via intramuscular route in thigh muscle. The immunization schedule consisted of a primary dose adjuvanted with Freund’s complete adjuvant on 7 days old birds and two booster doses adjuvanted with Freund’s incomplete adjuvant on 14th and 21st days. Number of birds in each group and treatment details are listed in Table 1. 2.6.1. Humoral immune response Birds were bled prior to each immunization and on 28th day post primary immunization. Serum antibody titers against immunized proteins were measured using an indirect ELISA using E. coli expressed recombinant EtMIC1 and EtMIC2 proteins to assess specific antibody titers.
2.6.2. Evaluation of cell-mediated immune response in EtMIC1 immunized birds Relative IFN-␥ expression was quantified as fold increase in IFN-␥ mRNA with respect to uninduced naïve birds. Spleens were collected after euthanizing birds on 3rd, 6th and 9th days post final immunization and on 3rd day post challenge. Five birds immunized with plant expressed EtMIC1 were splenectomized on each day of sampling. Splenocytes from each bird were cultured separately as described previously [11]. The splenocytes obtained from the sham-immunized birds were employed as negative control. The splenocytes were stimulated using 20 g/ml of recombinant E. coli expressed EtMIC1 protein at the time of seeding. Twenty microgram per milliliter of E. coli expressed Heat shock protein (HSP) was used for mock stimulation while 15 g/ml of concanavalin A (Genie, India) was used as positive control for the evaluation of IFN-␥ response in the splenocytes. Primers and TaqMan probes to quantify the IFN␥ mRNA and 28S rRNA in the samples were designed as described previously [11]. Total RNA extraction from splenocytes, sequence of primers, probes and the method of Real Time PCR were described previously [11]. The Ct value of 28S was used to normalize the Ct value of IFN-␥ (Ct) as described by Leutenegger et al. [18]. The Ct value of sham-induced cells from each spleen was used as calibrator for other stimulated cells from the same spleen to calculate the value of Ct (Ct = Cttarget − Ctcalibrator ) using the comparative Ct method [19]. Statistical analysis was performed using the OriginPro (version-7.5) software and the difference in mean was subjected to a Student’s t-test. 2.6.3. Challenge experiment Nine days post final immunization; birds of Groups I–III were inoculated orally with 10,000 sporulated E. tenella oocysts. Birds were weighed prior to challenge and on 7th and 11th days post challenge to determine the weight gain. The average weight gain (percent) of birds and oocyst shed per gram of fecal matter was determined [16]. An average of three counts per group was taken to enumerate reduction in oocyst shedding. The percentage decrease in oocyst output compared with the sham-immunized but challenged birds was estimated [16]. 3. Results 3.1. Recombinant Agrobacterium clones containing EtMIC1 expression plasmid A 2.1 kb size EtMIC1 gene was obtained by amplifying with gene specific primers. Cloning of EtMIC1 gene into pTRA-ERH vector was confirmed by observing insert release upon digestion with NcoI and NotI restriction enzymes. Recombinant agrobacterium clones were also screened using PCR with gene specific primers for EtMIC1 sequence, agrobacterium clones harboring EtMIC1 gene produced a PCR amplification product of 2.1 kb size (data not shown). 3.2. Transient expression of EtMIC1 protein in Nicotiana tabacum using Agro-infiltration technique The full-length EtMIC1 coding sequence was amplified from the total RNA extracted from the infiltrated leaves. The amplification
4462
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
Fig. 1. (a) SDS–PAGE gel stained with coomassie blue showing EtMIC1 protein band at 100 kDa, (b) immunoblot demonstrating plant expressed EtMIC1 protein band showing at 100 kDa, (i) specific reactivity against Anti-His5 HRPO conjugate monoclonal antibody. (ii) reactivity with polyclonal sera raised against E. coli expressed EtMIC1 protein in chickens. (iii) Reactivity with peptide raised sera against EtMIC1 protein. Lanes 1, 2, and 5 are with plant expressed proteins, lanes 3, and 6 are with un-infiltrated leaves taken as negative controls and lanes 4 and 7 are with pre-stained marker (Fermentas).
reactions performed using RNA extracted from mock-infiltrated leaves and the reverse transcriptase negative control did not produce any PCR amplification (Supplementary Fig. 1), indicating specific amplification of EtMIC1 from the RNA samples. Upon confirming the presence of specific mRNA, infiltrated leaf samples were processed to purify the His6 tagged recombinant protein. The yield of the purified protein was found to be 25 mg/kg fresh biomass. The purified recombinant EtMIC1 protein was characterized using immunoblotting by probing the affinity-purified protein with either rabbit polyclonal antibodies against EtMIC1 protein or anti-His5 monoclonal antibody. A protein band of approximately 100 kDa, corresponding to the expected size of EtMIC1 protein, was detected in all the immuno-blots (Fig. 1). Protein extract from tobacco leaves infiltrated with un-transformed agrobacterium was used as negative control in all the above blots, which showed no reactivity to the antibodies used. Supplementary material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.vaccine.2012.04.076. 3.3. Serum antibody response in immunized birds The serum samples collected from the immunized birds on days 14, 21 and 28 were analyzed for the presence of the serum IgG antibodies. EtMIC1 and EtMIC2 expressed in E. coli was used to measure specific immune response in the immunized birds. Recombinant EtMIC1 protein induced serum IgG titers in immunized birds and exhibited an average serum antibody titers of 466.7 (±321.5) on 14th day, 541.6 (±469) on 21st day and 1131.3 (±920.8) on 28th day. Birds immunized in combination had induced an average serum antibody titer of 150 (±53.4) on 14th day, 500 (±185.1) on 21st day and 1700 (±667.6) on 28th day against EtMIC1 and 162.5 (±51.7) on 14th day, 525 (±237.5) on 21st day and 1900 (±848.5) on 28th day against EtMIC2 (Fig. 2). 3.4. Evaluation of cell-mediated immune response in EtMIC1 immunized birds The linear fit of the Ct curve obtained for IFN-␥ and 28S at different dilutions of the RNA had a slope value of −0.0045. The near zero slope values indicates similar PCR amplification efficiency of IFN-␥ and 28S mRNA therefore relative quantification method of 2−Ct was validated for comparing the mRNA expression levels using 28S as internal control. There was an average increase
Fig. 2. ELISA titers (mean ± SD) of sera from birds immunized with plant expressed EtMIC1 as monovalent vaccine and EtMIC1 and EtMIC2 in combination as bivalent vaccine. The assay was performed using indirect ELISA in a maxisorp plate coated with E. coli expressed EtMIC1 or EtMIC2 protein. Antibody titers in the serum were determined as maximum sera dilution showing OD450 greater than mean + 3 × SD of pre-immune sera (N = 14).
in IFN-␥ mRNA expression levels in the in vitro induced splenocytes cultured from spleens of birds on 3rd day post-immunization (Fig. 3). IFN-␥ m-RNA could not be detected in the induced splenocytes. 3.5. Bird challenge experiment 3.5.1. Weight gain Birds in Groups I, II, and III were challenged with 10,000 virulent E. tenella oocysts. Weight gain was assessed on 7 and 11 days post-challenge (dpc). The percentage increase in weight in the immunized birds compared to sham immunized–challenged birds (Group III). It was observed that the birds immunized with EtMIC1 alone had 32% (±16) and 52% (±24) increase in weight on 7 and 11 dpc respectively. Birds immunized with combined EtMIC1 and EtMIC2 vaccine had 34% (±6.9) and 58% (±5.9) increase in weight gain on 7 and 11 dpc. The difference in the mean weight gain was subjected to Student’s t-test. The mean weight gain was significantly different in all immunized birds on 7 dpc when compared with sham-immunized and challenged group (p < 0.05*; N = 14) (Fig. 4).
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
Fig. 3. IFN-␥ levels quantified using real time RT-PCR among EtMIC1 vaccinated birds compared to unstimulated birds on day 3 post immunization (N = 5). Mean value for the group is indicated by a line.
Fig. 4. Percentage change in weight gain of immunized birds compared to shamimmunized unchallenged birds. Weight gain was calculated on 7th and 11th day after challenge. Mean value for the group is indicated by a line. The asterisks indicate significant change in weight gain compared to sham-immunized and challenged birds (*p < 0.05; **p < 0.01; N = 14).
3.5.2. Oocyst count The decrease in oocyst output was calculated by comparing the oocyst output of sham-immunized challenged birds (Group III). Immunization of birds with EtMIC1 protein reduced the oocyst output by 68% and in combination oocyst shedding was reduced by 72% (Fig. 5). Our results indicated that immunization of birds with the plant expressed recombinant proteins imparted significant protection to chicken against homologous challenge. 4. Discussion Coccidiosis vaccines could offer a promising alternative to drugs as a means of controlling coccidiosis. Numerous vaccination strategies have been attempted to manage avian coccidiosis [16,20–22]. Several recombinant sub unit coccidial antigens have been used
4463
Fig. 5. Oocyst output in immunized birds compared to mock immunized and challenged group. The oocyst shedding per gram of faces was determined using McMaster counting chamber. The bar represents an average of 3 counts per group. There was more than 60% reduction in oocyst output in the vaccinated groups compared to sham-immunized challenged birds.
in experimental immunizations with varying degree of success [16,23]. Sporozoites are the invading stage of the parasite, which harbors microneme organelles located at the apical tip. Several types of microneme proteins are secreted by sporozoite that play critical role in host invasion. Recombinant microneme antigens expressed in various expression systems have been shown to protect the chicken against virulent challenge when used as vaccine candidate [16]. Our earlier work suggested that plant expressed EtMIC2 protein imparts protection against homologous challenge in chicken [11]. We have assessed the protective efficacy of plant expressed EtMIC1 protein, which was administered either as monovalent formulation or in bivalent formulation with plant expressed EtMIC2 protein. The utility of combination of two E. tenella microneme proteins as potential vaccine candidate has not been explored so far. For the protozoan disease, it is important to develop multivalent vaccine to prevent immune evasion. Most of the microneme proteins are known to be associated with cell invasion or parasite motility upon attachment to the host cell. The multiplicity of these invasion proteins may indicate alternate invasion strategies adopted by the parasite. Therefore, neutralizing single major protein associated with invasion/motility may not protect birds against a virulent pathogen. Our results indicate that birds immunized with a bivalent formulation containing EtMIC1 and EtMIC2 imparted better protection to the birds. Plant expressed EtMIC1 was able to induce high serum antibody response in immunized birds. We observed that the serum antibody titers were higher for EtMIC2 protein [11] compared to EtMIC1 protein on 14th, 21st, and 28th days post-immunization. Birds immunized with bivalent vaccine had shown better antibody response against both the antigens compared to the birds immunized with either EtMIC1 or EtMIC2 as monovalent vaccine indicating co-operativity between the two antigens. There was an average increase of IFN-␥ response in birds immunized with EtMIC1 alone on 3rd day post-immunization, while no CMI response was obtained on 6th, 9th day post-immunization and 3rd day post challenge. Birds immunized with EtMIC2 alone [11] showed better CMI response when compared to the birds immunized with EtMIC1 alone. We do not yet know whether EtMIC1 harbors effective T-cell epitopes as indicated by poor CMI response in EtMIC1 immunized birds. Given that EtMIC1 immunized birds had better weight gain
4464
K. Sathish et al. / Vaccine 30 (2012) 4460–4464
and oocyst reduction, our data suggests predominance of humoral immune response in conferring protective immunity in birds. Birds immunized with vaccine formulation containing both EtMIC1 and EtMIC2 showed increased weight gain compared to the birds immunized either with EtMIC1 or EtMIC2 separately [11]. The un-immunized birds challenged with sporulated oocysts showed marginal increase in weight. This phenomenon is not unusual given the fact that the disease is self-limiting in nature. It would be interesting to see if the combined vaccine formulation is also able to impart protection to the immunized birds in heterologous challenge. We found that the increase in percentage weight gain was significant on 7th and 11th days post-challenge in immunized birds compared to the sham-immunized challenged birds. We observed that there was reduction of up to 68% of oocyst output from birds immunized with EtMIC1 protein, 66% from EtMIC2 protein [11] and 72% from EtMIC1 and EtMIC2 proteins given in combination in comparison with unimmunized challenged birds. Clearly the percentage reduction in oocyst output was more in birds immunized with bivalent vaccine compared to the birds immunized with either EtMIC1 or EtMIC2 alone [11]. Reduced oocysts output would help reducing the disease burden on farm by lowering the number of birds exposed to the pathogen. Moreover, the sub-lethal dose of oocyst ingestion may help in establishing immunity in the birds. The serum antibody titers were high in birds immunized with EtMIC2 [11], while percentage increase in weight and reduction in oocyst output was higher in EtMIC1 vaccinated birds. As discussed previously humoral immune response in Eimeria infected bird seems to be important in conferring protection. In conclusion, plant expressed coccidial antigens were immunogenic and conferred protection against challenge with live oocysts. Vaccination with live or attenuated parasites to control coccidiosis has limitations such as difficulties in large-scale manufacturing and reversion to virulent form. Plants have the ability to express simultaneously several heterologous genes under control conditions, which may help to develop an effective multivalent vaccine for coccidiosis, thus offering an economically viable alternative to the conventional protein expression platforms. Our results are encouraging and hold promise in developing a cost effective sub-unit vaccine. Further work is required to optimize the dosage regimen and the antigen payloads and formulation that are most efficacious. References [1] Williams RB. Epidemiological aspects of the use of live anticoccidial vaccines for chickens. International Journal for Parasitology 1998;28:1089–98. [2] Williams RB. A compartmentalised model for the estimation of the cost of coccidiosis to the world’s chicken production industry. International Journal for Parasitology 1999;29:1209–29. [3] Chapman HD. Biochemical genetic and applied aspects of drug resistance in Eimeria parasites of the fowl. Avian Pathology 1997;26:221–4.
[4] Shirley MW, Bushell AC, Bushell JE, McDonald V, Roberts B. A live attenuated vaccine for the control of avian coccidiosis: trials in broiler breeders and replacement layer flocks in the United Kingdom. Veterinary Record 1995;137:453–7. [5] Regulation (EC) No.1831/2003 of the European Parliament and of the council of 22 September 2003 on additives for use in animal nutrition. Official Journal of the European Union 2003;L268:29–43. [6] Tomley FM, Bumstead JM, Billington KJ, Dunn PPJ. Molecular cloning and characterization of a novel acidic microneme protein (EtMIC2) from the apicomplexan protozoan parasite Eimeria tenella. Molecular and Biochemical Parasitology 1996;79:195–206. [7] Lillehoj HS, Trout JM. Coccidia: a review of recent advances on immunity and vaccine development. Avian Pathology 1993;22:3–21. [8] Lillehoj HS, Lillehoj EP. Avian coccidiosis: a review of acquired intestinal immunity and vaccination strategies. Avian Diseases 2000;44:408–25. [9] Lillehoj HS, Ding X, Dalloul RA, Sato T, Yasuda A, Lillehoj EP. Embryo vaccination against Eimeria tenella and E. acervulina infections using recombinant proteins and cytokine adjuvants. Journal of Parasitology 2005;91:666–73. [10] Ding X, Lillehoj HS, Dalloul RA, Min W, Sato T, Yasuda A, et al. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis. Vaccine 2005;23(28):3733–40. [11] Sathish K, Sriraman R, Mohana Subramanian B, Hanumantha Rao N, Balaji K, Lakshmi Narasu M, et al. Plant expressed EtMIC2 is an effective immunogen in conferring protection against chicken Coccidiosis. Vaccine 2011;29:9201–8. [12] Twyman RM, Stoger E, Schillberg S, Christou P, Fischer R. Molecular farming in plants: host systems and expression technology. Trends in Biotechnology 2003;21:570–8. [13] Biemelt S, Sonnewald U, Galmbacher P, Willmitzer L, Muller M. Production of human papillomavirus type 16 virus-like particles in transgenic plants. Journal of Virology 2003;77:9211–20. [14] Marˇııa JDS, Andrés W, Karina T, Raúl DR, Pascual MF, Felix G, et al. A novel methodology to develop a foot and mouth disease virus (FMDV) peptide-based vaccine in transgenic plants. Vaccine 2002;20:1141–7. [15] Yusibov V, Hooper DC, Spitsin SV, Fleysh N, Kean RB, Mikheeva T, et al. Expression in plants and immunogenicity of plant virus-based experimental rabies vaccine. Vaccine 2002;20:3155–64. [16] Mohana Subramanian B, Sriraman R, Hanumantha Rao N, Raghul J, Thiagarajan D, Srinivasan VA. Cloning, expression and evaluation of the efficacy of a recombinant Eimeria tenella sporozoite antigen in birds. Vaccine 2008;26:3489–96. [17] Bhaskaran MS, Venkatesan L, Aadimoolam R, Tirunelveli JH, Sriraman R. Sequence diversity of internal transcribed spacer-1(ITS-1) region of Eimeria infecting chicken and its relevance in species identification from Indian field samples. Parasitology Research 2010;106(2):513–21. [18] Leutenegger CM, Alluwaimi AM, Smith WL, Perani L, Cullor JS. Quantitation of bovine cytokine mRNA in milk cells of healthy cattle by realtime TaqMan polymerase chain reaction. Veterinary Immunology and Immunopathology 2000;77:275–87. [19] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2−Ct method. Methods 2001;25:402–8. [20] Kim KS, Jenkins MC, Lillehoj HS. Immunization of chickens with live Escherichia coli expressing Eimeria acervulina merozoite recombinant antigen induces partial protection against coccidiosis. Infection and Immunity 1989;57(8):2434–40. [21] Williams RB. Anticoccidial vaccines for broiler chickens: pathways to success. Avian Pathology 2002;31(4):317–53. [22] Seung Jang I, Hyun Lillehoj I, Sung Lee H, Kyung Lee W, Myeong Park S, James Cha S, et al. Eimeria maxima recombinant Gam82 gametocyte antigen vaccine protects against coccidiosis and augments humoral and cell-mediated immunity. Vaccine 2010;28:2980–5. [23] Lillehoj HS, Chai KD, Jenkins MC, Vakharia VN, Song KD, Han JY, et al. A recombinant Eimeria protein inducing Interferon-(productions; comparison of different Gene expression systems and immunization strategies for vaccination against coccidiosis. Avian Diseases 2000;49:379–89.