Plant expressed EtMIC2 is an effective immunogen in conferring protection against chicken coccidiosis

Vaccine 29 (2011) 9201–9208

Contents lists available at SciVerse ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Plant expressed EtMIC2 is an effective immunogen in conferring protection against chicken coccidiosis K. Sathish a , R. Sriraman a , B. Mohana Subramanian a , N. Hanumantha Rao a , K. Balaji a , M. Lakshmi Narasu b , V.A. Srinivasan a,∗ a b

Research & Development Centre, Indian Immunologicals Limited, Rakshapuram, Gachibowli, Hyderabad 500032, Andhra Pradesh, India Institute of Science and Technology, Jawaharlal Nehru Technological University, Kukatpally, Hyderabad 500085, Andhra Pradesh, India

a r t i c l e

i n f o

Article history: Received 22 July 2011 Received in revised form 24 September 2011 Accepted 27 September 2011 Available online 8 October 2011 Keywords: Eimeria Subunit vaccine Prophylactic vaccine Recombinant antigen Plant-derived antigen

a b s t r a c t Coccidiosis is an economically important disease affecting poultry industry and remains one of the major problems globally. Developing a cost effective sub-unit vaccine may help mitigate loss in the industry. Here, we report expressing one of the microneme proteins, EtMIC2 from Eimeria tenella in tobacco using Agrobacterium-mediated transient expression. The ability of plant expressed recombinant EtMIC2 in eliciting both humoral and cell-mediated immune responses were measured in the immunized birds. The protective efficacy in the vaccinated birds against a homologous challenge was also evaluated. Birds immunized with plant expressed EtMIC2 showed good sero-conversion, reduced oocyst output and increased weight gain when compared to control birds. Our data indicate that use of plant expressed recombinant EtMIC2 in birds was safe and had the potential in imparting partial protection in chickens against homologous challenge. © 2011 Elsevier Ltd. All rights reserved.

1. Introduction Avian coccidiosis is an economically important disease of poultry caused by protozoa of the genus Eimeria. Eimeria tenella is one of the seven different Eimeria species that infect chicken. The infection of Eimeria species causes damage to the intestinal epithelium with varying severity accompanied by reduction in body weight, reduced feed conversion efficiency and shedding of parasite oocysts in feces. Use of ‘coccidiostat’ and ‘coccidiocidal’ chemicals in poultry feed is the popular method of managing coccidiosis. However, the emergence of drug resistant Eimeria strains is of serious concern [1]. In order to contain the indiscriminate use of coccidiostat, European parliament has set a target of 2012 to phase out the use of coccidiostat in poultry feed [2]. Live vaccines containing either virulent or attenuated strains of Eimeria or affinity purified oocysts antigens are available as alternatives to chemo-prophylaxis. However, their use is restricted to Breeder and Layer stocks in the poultry industry as the vaccines are produced in very limited quantity [3]. Eimeria infection involves multiple stages of parasite invasion [4]. One of the approaches in developing a prophylactic vaccine, explored by many investigators, is to block the parasite invasion into gut epithelium. Microneme organelles are located at the apical

∗ Corresponding author. Tel.: +91 40 23000211; fax: +91 40 2300 5958. E-mail address: [email protected] (V.A. Srinivasan). 0264-410X/$ – see front matter © 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2011.09.117

tip of invading stage of all apicomplexan parasites and they harbor several proteins that are critical for motility of the parasite, identification and binding of the host cell-–surface proteins and invasion of host cells [5]. Thus, induction of neutralizing antibodies to one or several of these ‘invasion proteins’ presents a rational approach in developing a prophylactic vaccine. Earlier reports suggest that the recombinant microneme antigens might protect chickens against coccidiosis when used as vaccine [4,6]. Plants have been used to express a wide variety of proteins for therapeutic and diagnostic use. The plant expression platform has been particularly attractive because of the ease of transformation, low investment, high and controlled level of expression, easy scale up with no process optimization downtime, etc. Plants have the ability of performing post-translational modifications and complete absence of parasite/pathogens that may harm animals or humans makes plant particularly attractive expression host for therapeutic proteins [7–10]. We have explored the possibility of using plant expression system for production of prophylactic vaccine against poultry coccidiosis. Here, we report transient expression of one of the microneme proteins, EtMIC2 from E. tenella as His6 -tagged fusion protein, in tobacco using Agro-infiltration. Chicken were immunized using the plant expressed EtMIC2 protein and humoral and cell-mediated immune responses in the immunized birds were measured. Protective efficacy of the plant-expressed EtMIC2 antigen was also evaluated. The findings of our studies hold promise for developing

9202

K. Sathish et al. / Vaccine 29 (2011) 9201–9208

a low cost sub-unit coccidiosis vaccine for the poultry industry. 2. Materials and methods

0.5% (w/v) beef extract, 0.5% (w/v) sucrose, 0.1% (w/v) yeast extract, 2 mM MgSO4 , 1.5% agar, pH 7.4] containing 100 ␮g/ml carbenicillin and 25 ␮g/ml rifampacin and incubated for 72 h at 28 ◦ C. The Transformed Agrobacterium colonies were screened using gene-specific PCR to identify the recombinant clones.

2.1. Chicken Day-old, coccidiosis free, male White Leghorn layer chickens (commercial breed—BV 300) were obtained from Sri Venkateswara Hatcheries (Hyderabad, India) and reared in clean brooder cages. The birds were provided with coccidiostat-free feed and water ad libidum. Birds were shifted to animal containment facility prior to challenge with E. tenella sporulated oocysts. 2.2. Coccidial oocysts Wild type E. tenella oocysts were isolated from an Eimeriainfected farm in India. Oocysts were propagated in 3 weeks old birds by repeated passages [4]. The purity of oocyst suspension was assessed using species-specific nested-PCR for ribosomal Internal Transcribed Spacer I (ITS-I) region as described by us earlier [11]. 2.3. Tobacco plant Nicotiana tabacum, cultivar Petit Havana SR1, was cultivated in the greenhouse using vermiculate peat moss mixture. Leaves from 3 to 6 weeks old plants (5–6 leaf stage) were used for vacuum infiltration. 2.4. Cloning of EtMIC2 gene into plant expression vector and creating Agrobacterium clone 2.4.1. Total RNA isolation from oocyst Birds inoculated with 10,000 E. tenella sporulated oocysts were sacrificed on day 7 post-inoculation and oocysts were isolated from the cecal content of infected birds. The cecal content was filtered through a sieve to remove coarse food material and the filtrate was overlaid on saturated NaCl solution and centrifuged at 1000 × g for 10 min. Pure oocysts were aspirated from the salt water interphase. The purified oocysts were decontaminated by treating them with 4% (v/v) hypochloride solution. These oocysts were sporulated in 2% potassium di-chromate solution by constant shaking (180 rpm) at 25 ◦ C overnight [12]. Total RNA was isolated from the sporocyst using Trizol® reagent (Invitrogen, USA). cDNA was synthesized from total RNA using Thermo-scriptTM reverse transcriptase (Invitrogen, USA) and gene specific reverse primers for EtMIC2. 2.4.2. Cloning into plant expression vector The EtMIC2 gene was PCR amplified from the cDNA using forward primer 5 AGCTCATGATGATGGCTCGAGCGTTGTCGCTGGT-3 and reverse primer 5 -GCGGCCGCTCAGGATGACTGTTGAGTGTCACTCTC-3 . The RT-PCR amplified EtMIC2 coding sequence was cloned into plant expression vector, pTRA ERH (provided by Prof. Rainer Fisher) [13], downstream of the double 35S promoter using NcoI and NotI restriction enzyme sites. Since the EtMIC2 gene contains an internal NcoI site, the insert was digested using BspHI, which creates a compatible overhang for the vector digested with NcoI. pTRAEtM2, was sequenced from vector back-bone using the following primers, forward primer 5 -AAGACCCTTCCTCTATAT AAG-3 and reverse primer 5 -GAGCGAAACCCTATAAGAACC-3 to confirm the cloning of EtMIC2. Agrobacterium tumefaciens strain GV3101 was electroporated with 5 ␮g of pTRA-ERH containing EtMIC2. The electroporation was performed using 2.5 kV, 200 ohms resistance and 25 ␮F capacitance in 2 mm cuvette (BTX, USA). Transformed Agrobacterium cells were plated on YEB plates [0.5% (w/v) peptone,

2.5. Agrobacterium mediated transient expression of EtMIC2 protein The recombinant Agrobacterium clone was grown overnight at 28 ◦ C in YEB broth containing 100 ␮g/ml carbenicillin and 25 ␮g/ml rifampacin. Bacterial cells were harvested by centrifuging the overnight grown culture at 6000 rpm. The Agrobacterium pellet was inoculated in induction medium (YEB medium adjusted to pH 5.6 supplemented with 20 ␮M acetosyringone, 10 mM 2-Nmorpholino-ethane-sulphonic acid) and incubated at 28 ◦ C for 16 h. Following which the bacterial cells were harvested by centrifugation and the cells were resuspended in MMA medium containing (4.6 g/l Murashige and Skoog (MS) basal medium, 2% (w/v) sucrose, 10 mM MES, pH 5.6) supplemented with 200 ␮M acetosyringone to induce vir genes of Agrobacterium. The optical density of the suspension was adjusted to OD600 2 using the MMA medium and the bacterial suspension was incubated for 2 h at room temperature (24 ± 4 ◦ C). Vacuum infiltration of the Agrobacterium culture was carried out as described by Kapila et al. [14]. The infiltrated leaves were incubated at 15 ◦ C for 64 h under 16 h light and 8 h dark photoperiod. The leaves were stored at −80 ◦ C until it was processed for protein extraction. 2.6. EtMIC2 gene expression in infiltrated tobacco leaves verified using RT-PCR Total RNA was extracted from the infiltrated tobacco leaves using RNEasy plant-mini kit (Qiagen, USA) and the transcription specific mRNA was verified by RT-PCR using EtMIC2 specific primers. The total RNA was digested using RNase free DNase I to remove any contaminating DNA. A control reaction devoid of reverse transcriptase was used to rule out the PCR amplification from any residual contaminating DNA. 2.7. Extraction and purification of recombinant EtMIC2 protein from infiltrated tobacco leaves The infiltrated tobacco leaves were ground into a fine powder after freezing the leaves in liquid nitrogen; the soluble proteins from the leaves were obtained by extracting in to two volumes of buffer containing (200 mM Tris–HCl, 5 mM EDTA, 0.1 mM DTT, 0.1% Tween20, pH 7.5). Cell debris from the leaf extract were removed by centrifugation at 20,000 × g for 30 min at 4 ◦ C. A Solution of NaCl (500 mM) was added to the supernatant to prevent any non-specific interaction with the affinity matrix and pH of the extract was adjusted to 8.0 to precipitate plant cell proteins. The extract was incubated at 4 ◦ C for 1–2 h and centrifuged at 15,000 × g for 30 min. The supernatant was filtered through Whatman filter paper (No-3) to trap any floating debris following which the extract was filtered through 0.45 ␮ filter and the filtrate was loaded to Hi-Trap metal chelating column with 0.5 ml/min linear flow rate using Akta prime plus (GE Healthcare, USA). Column was washed with 40 mM imidazole and protein was eluted using 500 mM imidazole. Six equal elution fractions of 0.5 column volume (2.5 ml) were collected. The purified protein was dialyzed extensively against PBS to remove imidazole. Yield of the purified protein was estimated using Bicinchoninic Acid kit (Sigma–Aldrich, USA). The purified EtMIC2 protein was stored in aliquots at −20 ◦ C until further use.

K. Sathish et al. / Vaccine 29 (2011) 9201–9208

9203

Table 1 Treatment groups. Group

Immunogen (␮g/bird)

Immunization (days)

Bleeding (days)

Splenocyte isolation (days)

Group-I (N = 34) Group-II (N = 14) Group-III (N = 22)

EtMIC2 (50) PBS PBS

0, 7, 14, 21 0, 7, 14, 21 0, 7, 14, 21

0, 7, 14, 21, 28 0, 7, 14, 21, 28 0, 7, 14, 21, 28

24, 27, 30, 33

2.8. SDS–PAGE analysis and immunobloting Purified recombinant EtMIC2 protein was resolved on 10% SDS–PAGE under reducing conditions and the protein was visualized after staining with Coomassie brilliant blue. The protein was also electro-blotted on to PVDF membrane (Hybond-P; GEHealthcare, USA) and the residual active sites on the membrane were blocked using 3% (w/v) skimmed milk powder dissolved in PBS. The blots were probed using either one of the following antibodies. (1) Anti-His5 monoclonal antibody conjugated to horseradish peroxidase (1:3000 dilution; Qiagen, Germany); (2) mouse monoclonal antibody reactive against EtMIC2 protein (kindly provided by Dr Hyun Lillehoj; USDA); (3) chicken immune sera obtained by immunizing E. coli expressed recombinant EtMIC2 protein. Un-infiltrated tobacco leaves were used as negative control, while E. coli expressed recombinant EtMIC2 proteins were used as positive control. 2.9. Immunization and efficacy study The study consisted of three treatment groups. Birds in Group-I were immunized with 50 ␮g of EtMIC2 protein, where as GroupsII and III were mock-immunized with PBS alone. Antigen was administered via intramuscular route. The immunization schedule consisted of a primary dose adjuvanted with Freund’s complete adjuvant on day 7 and two booster doses adjuvanted with Freund’s incomplete adjuvant on 14th and 21st days. Group-I contained 34 birds, of which 14 birds were used to determine the seroconversion, weight gain and oocyst output. The remaining 20 birds were splenectomized to determine the IFN-␥ response. Group-II contained 14 birds. Group-III contained 22 birds, of which 14 birds were used as control for efficacy studies and remaining 8 birds were used as control for IFN-␥ estimation. Birds in Group-II were mock immunized and challenged with virulent E. tenella oocyst. Birds in Group-III were mock immunized and remained unchallenged (Table 1). The birds in all groups were regularly screened for shedding of Emeria oocyst by salt floatation. 2.9.1. Humoral immune response For serum, peripheral blood was collected from each bird prior to each immunization and also on 28th day post-primary immunization. Serum antibody titers against EtMIC2 were measured using an indirect ELISA. Maxi-sorp ELISA plates were coated with E. coli expressed EtMIC2 proteins to assess specific antibody titers in immunized chicken sera. Titers in the serum was defined as maximum sera dilution showing OD450 greater than (mean + 3 × SD) of pre-immune sera [15]. 2.9.2. Evaluation of cell mediated immune response in EtMIC2 immunized birds Relative IFN-␥ expression was quantified and expressed as fold change with respect to uninduced naïve birds. Spleens were collected after euthanizing birds on days 3, 6 and 9 postfinal immunization and also on day 3 post-challenge. At each time point, speens from 5 immunized and 5 mock-immmunized birds were collected. Splenocytes from individual birds were cultured separately. The splenocytes were obtained by perfusing cell culture media (RPMI 1640; Invitrogen, USA) through the spleens. The cell

24, 27, 30, 33

counts were adjusted to 106 cells/ml using RPMI supplemented with 10% fetal bovine serum. One million cells were seeded per well in a 24 well tissue culture plate (Nunc, Denmark). The splenocytes were stimulated using 20 ␮g/ml of recombinant E. coli expressed EtMIC2 protein at the time of seeding. Twenty microgram per ml of E. coli expressed Heat shock protein (Hsp), was used a negative control while 15 ␮g/ml of concanavalin A (Genei, India) was used as positive control for the cytokine response in splenocytes. The splenocytes were incubated at 37 ◦ C with 5% CO2 for 48 h. Total RNA was extracted from these splenocytes 48 h post stimulation, using TRI-Reagent (Sigma, USA) and the total RNA was treated with RNase free DNase I to remove any contaminating genomic DNA. The total RNA were stored at −80 ◦ C till further use. Primers and TaqMan probes to quantify the IFN␥ mRNA and 28S rRNA in the samples were designed as described by Kaiser et al. [16]. The sequence of primers and probes used in the real-time PCR are provided in Table 2. Real-time RT-PCR was performed using Quantitect Probe RT-PCR kit (Qiagen, Germany) following the manufacturer’s instructions. Twenty picomoles of each primer and 10 pmol of the probe were used per reaction and they were run in the DNA engine 7300 Real Time PCR system (Applied Biosystems, USA) with the following temperature cycle: cDNA synthesis was performed at 48 ◦ C for 30 min; RT inactivation and Taq activation was accomplished by heating the reaction to following which 94 ◦ C for 15 min, 40 cycles of denaturation at 94 ◦ C for 15 s and anneal-extension at 60 ◦ C for 1 min was performed. A PCR reaction without reverse transcriptase was performed for every RNA sample to rule out amplification from containing genomic DNA. The samples were run in duplicates and the threshold temperature (Ct) values of IFN-␥ and 28S were determined for each sample using Applied Biosystems, 7300 systems software; version 1.3.1. The Ct value of 28S was used to normalize the Ct value of IFN-␥ (Ct = Ct28S-CtIFN␥) as described by Leutenegger et al. [17]. The Ct value of mockinduced cells from each spleen was used as calibrator for other stimulated cells from the same spleen to calculate the value of Ct (Ct = Cttarget −Ctcalibrator ). Real-time PCR results were expressed as fold change (2−Ct ) in IFN-␥ expression levels compared to the mock-induced cells, using the comparative Ct method [18]. Statistical analyses were performed using the OriginPro 7.5 software (Microcal Software Inc., USA) and the difference in mean was subjected to a Student’s t-test. Two means were considered significantly different when P value was <0.05. 2.9.3. Bird challenge experiment Nine days post-final immunization, birds of Groups I and II were inoculated orally with 10,000 sporulated E. tenella oocysts. Birds were weighed prior to challenge and on days 7 and 11 postchallenge to calculate the weight gain and expressed as percentage Table 2 Primers employed in the RT-PCR analysis of CMI response. S. no

Name

Sequence (5 → 3 )

1. 2. 3. 4. 5. 6.

Chick IFN-␥ forward Chick IFN-␥ reverse Chick IFN-␥ probe 28S forward 28S reverse 28S probe

GTGAAGAAGGTGAAAGATATCATGGA GCTTTGCGCTGGATTCTCA (FAM)-TGGCCAAGCTCCCGATGAACGA-(TAMRA) GGCGAAGCCAGAGGAAACT GACGACCGATTTGCACGTC (FAM)-AGGACCGCTACGGACCTCCACCA-(TAMRA)

9204

K. Sathish et al. / Vaccine 29 (2011) 9201–9208

increase in weight gain as described earlier [4]. Feces from each group were collected on days 5 and 11 post-challenge. The oocyst shedding per gram of fecal matter was determined using McMaster egg counting chamber as described earlier [19]. An average of three counts per group was taken to enumerate reduction in oocyst shedding. The percentage decrease in oocyst output compared with the mock-immunized but challenged birds was estimated [4]. 3. Results 3.1. Construction of Agrobacterium clones containing EtMIC2 expression plasmid The 1.2 kb full length cDNA of EtMIC2 coding sequence was amplified using RT-PCR from the excysted sporozoite RNA and cloned into plant expression vector pTRA vector. Recombinant clones of EtMIC2 produced a DNA fragment of 1.2 kb upon digestion of pTRAEtM2 with EcoRI and NotI restriction enzymes (Supplementary Fig. 1). Upon sequence comparison with the available EtMIC2 sequences of Houghton strain (GenBank accession number: Z71755) and Beijing strain (GenBank accession number: AF111839) we noticed three nucleotide differences between the EtMIC2 of Indian isolate and Houghton strain, at nucleotide positions 29 (C → T), 164 (A → T) and 733 (A → G). The Indian isolate had two nucleotide difference at 203 (C → T) and 733 (A → G) when compared to the Beijing strain. The Change at position 733 (A → G) was unique to the Indian isolate while the other two changes were present either in Houghton strain or Beijing strain of E. tenella (Supplementary Fig. 2a and b). Recombinant Agrobacterium clones were screened using specific primers for EtMIC2 sequence, Agrobacterium clones harboring EtMIC2 gene produced a PCR amplification product of 1.2 kb size. 3.2. Transient expression of EtMIC2 protein in N. tabacum using agro-infiltration technique The full-length EtMIC2 coding sequences could be amplified from the total RNA extracted from the infiltrated leaves. Whereas, the amplification reactions performed using RNA extracted from mock-infiltrated leaves and the reverse transcriptase negative control did not produce any PCR amplicon (Fig. 1), indicating specific amplification of EtMIC2 from the RNA samples. Upon confirming the presence of specific mRNA, infiltrated leaf samples were processed to extract the His6 tagged recombinant protein. The purified recombinant EtMIC2 protein was characterized using immuno blotting by probing the affinity purified protein using either monoclonal or polyclonal antibodies against EtMIC2

Fig. 1. RT-PCR amplified products resolved on 1% agarose gel, showing EtMIC2 coding sequence of 1.2 kb size in lane 1. RNA from Un-infiltrated leaves was used as control in Lane 2, Lane 3 contains 100 bp marker (Fermentas) and Lane 4 is reaction without reverse transcription control.

protein, as well as anti-His5 monoclonal antibody. A protein band of approximately 55 kDa, corresponding to the expected size of EtMIC2 protein, was detected in all the immuno-blots (Fig. 2). Protein extract from tobacco leaves infiltrated with un-transformed Agrobacterium served as negative control in all the above blots and the negative controls did not react with any of the antibodies used for immunoblotting.

3.3. Serum antibody response in immunized birds The serum samples collected from the immunized birds on days 14, 21 and 28 were analyzed for the presence of the serum IgG antibodies. EtMIC2 expressed in E. coli was used to measure specific immune response in the immunized birds. Recombinant EtMIC2 protein induced high serum IgG titers in immunized birds and exhibited an average serum antibody titers of 460 (±189.7) on 14th day, 940 (±499.3) on 21st day and 1360 (±1001) on 28th day (Fig. 3).

Fig. 2. (4a) SDS–PAGE gel stained with coomassie blue showing EtMIC2 protein band at 55 kDa, (4b) immunoblot demonstrating plant expressed EtMIC2 protein band showing at 55 kDa, (i) specific reactivity against Anti-His5 HRPO conjugate monoclonal antibody. (ii) Reactivity with polyclonal sera raised against E. coli expressed EtMIC2 protein in chickens. (iii) Reactivity with monoclonals raised against EtMIC2 protein. Lanes 1, 2, and 5 are with plant expressed proteins, Lanes 3, and 6 are with un-infiltrated leaves taken as negative controls and Lanes 4, and 7 are with pre-stained marker (Fermentas).

K. Sathish et al. / Vaccine 29 (2011) 9201–9208

9205

Fig. 3. ELISA titers (mean ± SD) of sera from birds immunized with plant expressed EtMIC-2. The assay was performed using indirect ELISA in a maxisorp plate coated with E. coli expressed EtMIC-2 protein. Antibody titers in the serum were determined as maximum sera dilution showing OD450 greater than mean + 3 × SD of pre-immune sera (N = 14).

3.4. Evaluation of cell mediated immune response in EtMIC2 immunized birds The linear fit of the Ct curve obtained for IFN-␥ and 28S at different dilutions of the RNA had a slope value of −0.0045. The near zero slope values indicates similar PCR amplification efficiency of IFN-␥ and 28S mRNA there fore Relative quantification method of 2−Ct was validated for use to compare the mRNA expression levels using 28S as internal control. Our data indicated that there was a significant increase in IFN-␥ mRNA expression levels in the in vitro induced splenocytes cultured from spleens of birds on 3rd and 6th day post immunization. There was an average increase in IFN-␥ m-RNA expression levels in in vitro induced splenocytes on 3rd day post challenge (Fig. 4). These results suggest that the plant expressed EtMIC2 protein is capable of inducing specific IFN-␥ response upon in vitro stimulation.

3.5. Bird challenge experiment 3.5.1. Weight gain Birds in Groups I and II, were challenged with 10,000 virulent E. tenella oocysts. Weight gain was assessed on days 7 and 11 postchallenge. The percentage increase in weight gain in immunized birds compared to mock immunized-challenged birds (group II) was determined. The birds immunized with EtMIC2 had 52% (±55) and 21% (±36) increase in weight gain on days 7 and 11 postchallenge, respectively. The mean weight gain was significantly different in all immunized birds on day 7 post-challenge when compared with mock-immunized challenged group (*p < 0.05; N = 14) (Fig. 5).

3.5.2. Oocyst count The decrease in oocyst output was calculated by comparing the oocyst output of mock-immunized challenged birds (group II). Immunization of birds with EtMIC2 protein reduced the oocyst output by 66% (Fig. 6). Our results indicate that immunization of birds with the plant expressed recombinant EtMIC2 protein imparted partial protection in chicken against homologous challenge.

Fig. 4. IFN-␥ levels quantified using real time RT-PCR among vaccinated birds compared to unstimulated birds on days 3 (a) and 6 (b) post final immunization and on 3rd (c) day post challenge. The asterisks indicate significant change in fold increase compared to unstimulated birds (*p < 0.05; N = 5).

9206

K. Sathish et al. / Vaccine 29 (2011) 9201–9208

Fig. 5. Percentage change in weight gain of immunized birds compared to mock immunized unchallenged Birds. Weight gain was calculated on 7th and 11th day after challenge. Mean value for the group is indicated by a line. The asterisks indicate significant change in weight gain compared to mock immunized and challenged birds (*p < 0.05; **p < 0.01; N = 14).

4. Discussion In order to contain the loss due to coccidiosis, widespread reliance on the in-feed anti-coccidial drugs in poultry industry have created challenges such as the emergence of drug resistant parasites and presence of drug residues in meat and egg, etc. [1,20]. A number of governments have realized the impact of excessive use of the anti-coccidial drugs by the industry and have enacted legislations limiting/prohibiting the use of the drugs in poultry feed [2,21]. Thus, effective alternative strategies such as the use of vaccines to mitigate the economic loss have acquired some urgency [22]. Live vaccines for coccidiosis alone may not be able to meet the global requirement. Because of logistics issue in producing these vaccines,

Fig. 6. Oocyst output in immunized birds compared to mock immunized and challenged group. The oocyst shedding per gram of faces was determined using McMaster counting chamber. The bar represents an average of 3 counts per group. There was more than 60% reduction in oocyst output in the vaccinated groups compared to mock immunized challenged birds.

there is an unmet need to develop a vaccine that is simple and inexpensive to produce, a scalable technology to meet the global requirement and confer immunity to various Eimeria species. Recombinant sub-unit vaccine has been proposed as an alternative to the available live vaccines that are difficult to produce at large scale [23,24]. Expression of heterologous proteins in plants for the production of antigens and antibodies have been explored for various targets. Many investigators have begun to examine the utility of plants as vehicles for the expression of vaccine antigens and have proved that it is an alternative source for efficient and inexpensive recombinant protein production in large scale manufacturing [25–34]. Vaccine antigens expressed in plants elicit protective immune responses [35–40]. Plant expressed proteins, when formulated using appropriate adjuvants, could possibly be delivered orally. The oral delivery will facilitate easier and widespread vaccine administration and may help improve the flock immunity. In the present manuscript, we have explored the potential of plants as production platform in developing recombinant sub-unit coccidiosis vaccine for chicken. Microneme proteins are essential for parasite motility. Chemicals that interfere with their secretion are extremely effective in blocking parasite attachment and invasion in vitro and parasite infectivity in vivo [41], making them attractive targets for vaccination. Five different types of microneme proteins are described for E. tenella [5]. Microneme 2 of E. tenella is a 50 kDa acidic protein [42]. The protein is abundant within the microneme organelles and at the time of host cell invasion, it is copiously secreted onto the host cell surface. This suggests that the EtMIC2 protein might be one of the important components in host–parasite interaction [42,43]. The recombinant EtMIC2 protein has been shown to confer partial protection in birds [22]. In the present study, EtMIC2 coding sequence was amplified from sporozoite mRNA. Upon comparison with available EtMIC2 sequences from the GenBank, we found four changes in the nucleotide sequence when compared to Houghton and Beijing strains of which three changes led to changes in the predicted amino acid sequence. It is not clear whether these changes reflect polymorphism in the strains due to random mutations or due to strain differences specific for a particular geographical region. Nevertheless, the similarity between various sequences of EtMIC2 was more than 99%, which indicates that the EtMIC2 sequence might be conserved [44]. In the present study, EtMIC2 protein was expressed in N. tabacum petit Havana var SR1 leaves and purified using IMAC. After affinity purification of EtMIC2, the yield of protein was 40 mg/kg fresh weight. The protein was verified for its reactivity with EtMIC2 specific monoclonal antibody as well as polyclonal sera raised against E. coli expressed EtMIC2. The plant expressed EtMIC2 had a similar reactivity against these antibodies like the E. coli expressed EtMIC2 protein. There was significant improvement in serum antibody response against the recombinant antigens in the vaccinated birds after booster immunization, indicating that plant expressed recombinant EtMIC2 protein was immunogenic in birds. A homologous challenge experiment was performed in chickens after recombinant EtMIC2 vaccination. The average weight gain in vaccinated birds was higher both on days 7 and 11 post-challenge, compared to unvaccinated birds. The increase in weight gain was statistically significant on day 7 post-challenge. The oocyst output upon challenge had considerably reduced in the vaccinated birds. Although the reduction in oocyst output is significantly high (66%), like many other sub unit vaccines, the EtMIC2 failed to induce sterile immunity. Levels of protection observed in the present study were similar to other sub-unit coccidiosis vaccines tested by various investigators [22,45]. Reducing the disease burden in a poultry farm will have a considerable economic impact, ranging from increased weight gain in the vaccinated birds and better productivity per

K. Sathish et al. / Vaccine 29 (2011) 9201–9208

flock. The lesser number of re-circulating oocysts will further help increasing immune response against Eimeria sp. Finding a single target antigen that could elicit sterile immunity against a protozoan parasite is difficult. Therefore, a mixture of antigens, which can act synergistically needs to be explored to completely reduce the oocyst output [46]. Cell-mediated immune response plays a major role in conferring protective immunity against coccidiosis. The selective elimination of CD8+ cells by anti-CD8+ monoclonal antibody resulted in aggravation of disease as evidenced by increased oocyst shedding after infection with E. tenella [47]. Splenocytes from E. tenella immune chicken inhibited intra-cellular development of E. tenella in chicken kidney cells in vitro [48]. We estimated the IFN-␥ expression levels using Real Time PCR. Plant expressed recombinant EtMIC2 antigen could induce higher mean IFN-␥ response in vitro in splenocytes obtained from spleens collected on days 3 and 6 post-final vaccination. However, statistically significant IFN-␥ response was observed only on day 3 post-final vaccination. Though there was a mean increase in the IFN-␥ response on day 3 post-challenge compared to control birds, the difference was not statistically significant. The IFN-␥ response was measured only one time post-challenge and we do not know whether the response may be significant in the earlier or later days. Our data suggest that the plant-expressed recombinant EtMIC2 protein is immunogenic and induces T-cell response in birds, which is important for conferring protective immunity against Eimeria infection. In conclusion, the plant expressed EtMIC2 protein was found to be safe and immunogenic in chicken and reduces oocyst output by 66%. These data may pave way to explore the possibility of producing a multivalent subunit vaccine expressed in plants that is capable of conferring sterile immunity against cocciodiosis for poultry industry. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.vaccine.2011.09.117. References [1] Chapman HD. Biochemical genetic and applied aspects of drug resistance in Eimeria parasites of the fowl. Avian Pathol 1997;26:221–4. [2] Regulation (EC) No.1831/2003 of the European Parliament and of the council of 22 September 2003 on additives for use in animal nutrition. Official journal of the European Union 2003; L268: 29–43. [3] Lillehoj HS, Lillehoj EP. Avian coccidiosis. A review of acquired intestinal immunity and vaccination strategies. Avian Dis 2000;44:408–25. [4] Mohana Subramanian B, Sriraman R, Hanumantha Rao N, Raghul J, Thiagarajan D, Srinivasan VA. Cloning, expression and evaluation of the efficacy of a recombinant Eimeria tenella sporozoite antigen in birds. Vaccine 2008;26:3489–96. [5] Ryan R, Shirley M, Tomley F. Mapping and expression of microneme genes in Eimeria tenella. Int J Parasitol 2000;30:1493–9. [6] Seung Jang I, Hyun Lillehoj I, Sung Lee H, Kyung Lee W, Myeong Park S, James Cha S, et al. Eimeria maxima recombinant Gam82 gametocyte antigen vaccine protects against coccidiosis and augments humoral and cell-mediated immunity. Vaccine 2010;28:2980–5. [7] Fischer R, Stronger E, Schillberg S, Christon P, Richard Twyman M. Plant based production of biopharmaceuticals. Curr Opin Plant Biol 2004;7: 152–8. [8] Richard Twyman M, Stronger E, Schillberg S, Christon P, Fischer R. Molecular farming in plants: host systems and expression technology. Trends Biotechnol 2003;21:570–8. [9] Vadim M, Christine Farrance E, Brian Green J, Vidadi Y. Plants as biofactories. Biologicals 2008;36:354e358. [10] Gleba Y, Klimyuk V, Marillonnet S. Viral vectors for the expression of proteins in plants. Curr Opin Biotechnol 2007;18:134e41. [11] Bhaskaran MS, Venkatesan L, Aadimoolam R, Tirunelveli Jayagopal H, Sriraman R. Sequence diversity of internal transcribed spacer-1(ITS1) region of Eimeria infecting chicken and its relevance in species identification from Indian field samples. Parasitol Res 2010;106(2): 513–21. [12] Chapman HD, Shirley MW. The Houghton strain of Eimeria tenella: a review of the type strain selected for genome sequencing. Avian Pathol 2003;32:115–27.

9207

[13] Kathuria S, Sriraman R, Nath R, Sack M, Pal R, Artsaenko O, et al. Efficacy of plant-produced recombinant antibodies against HCG. Hum Reprod 2002;17:2054–61. [14] Kapila J, De Rycke R, Van Montagu M, Angenon G. An Agrobacterium mediated transient gene expression system for intact leaves. Plant Sci 1997;122: 101e8. [15] Nardelli-Haefliger D, Roden RBS, Benyacoub J, Sahli R, Kraehenbuhl JP, Schiller JT, et al. Human papillomavirus type 16 virus-like particles expressed in attenuated Salmonella typhimurium elicit mucosal and systemic neutralizing antibodies in mice. Infect Immun 1997;65:3328–36. [16] Kaiser P, Underwood G, Davison F. Differential cytokine responses following Marek’s disease virus infection of chickens differing in resistance to Marek’s disease. J Virol 2003;77:762–8. [17] Leutenegger CM, Alluwaimi AM, Smith WL, Perani L, Cullor JS. Quantitation of bovine cytokine mRNA in milk cells of healthy cattle by realtime TaqMan polymerase chain reaction. Vet Immunol Immunopathol 2000;77: 275–87. [18] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2−Ct method. Methods 2001;25:402–8. [19] Lillehoj HS, Ruff MD. Comparison of disease susceptibility and subclass-specific antibody response in SC and FP chickens experimentally inoculated with Eimeria tenella, E. acervulina or E. maxima. Avian Dis 1987;31:112–9. [20] Williams RB. Sustainable coccidiosis control in poultry production: the role of live vaccines. Int J Parasitol 2002;32:617–29. [21] Shirley MW, Smith AL, Blake DP. Challenges in successful control of the avian coccidia. Vaccine 2007;25(30):5540–7. [22] Chapman HD, Cherry TE, Danforth HD, Richards G, Shirley MW, Williams RB. Sustainable coccidiosis control in poultry production: the role of live vaccines. Int J Parasitol 2002;32:617–29. [23] Lillehoj HS, Ding X, Dalloul RA, Sato T, Yasuda A, Lillehoj EP. Embryo vaccination against Eimeria tenella and E. acervulina infections using recombinant proteins and cytokine adjuvants. J Parasitol 2005;91:666–73. [24] Wallach MG, Ashash U, Michael A, Smith NC. Field application of a subunit vaccine against an enteric protozoan disease. PLoS ONE 2008;3(12) :e3948. [25] Mason HS, Lam DM-K, Arntzen CJ. Expression of hepatitis B surface antigen in transgenic plants. Proc Natl Acad Sci U S A 1992;89:11745–9. [26] Haq TA, Mason H, Clements JD, Arntzen CJ. Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 1995;268:714–6. [27] McGarvey PB, Hammond J, Dienelt MM, Hooper DC, Fu ZF, Dietzschold B, et al. Expression of the rabies virus glycoprotein in transgenic tomatoes. Biotechnology 1995;13:1484–7. [28] Mason HS, Ball JM, Shi JJ, Jiang X, Estes MK, Arntzen CJ, et al. Expression of Norwalk virus capsid protein in transgenic tobacco and potato and its oral immunogenicity in mice. Proc Natl Acad Sci U S A 1996;93: 5335–40. [29] Hiatt A, Cafferkey R, Bowdish K. Production of antibodies in transgenic plants. Nature 1989;342(6245):76–8. [30] Ma JK, Hiatt A, Hein M, Vine ND, Wang F, Stabila P, et al. Generation and assembly of secretory antibodies in plants. Science 1995;268:716–9. [31] Kapusta J, Modelska A, Figlerowicz M, Pniewski T, Letellier M, Lisowa O, et al. A plant derived edible vaccine against hepatitis B virus. FASEB J 1999;13:1796–9. [32] Tacket CO, Mason HS, Losonsky G, Clements JD, Levine MM, Arntzen CJ. Immunogenicity in humans of a recombinant bacterial antigen delivered in a transgenic potato. Nat Med 1998;4:607–9. [33] Fischer R, Stoger E, Schillberg S, Christou P, Twyman RM. Plant based production of biopharmaceuticals. Curr Opin Plant Biol 2004;7:152–8. [34] Mason HS, Warzecha H, Mor T, Arntzen CJ. Edible plant vaccines: applications for prophylactic and therapeutic molecular medicine. Trends Mol Med 2002;8:324–9. [35] Davoodi-Semiromi A, Samson N, Daniell H. The green vaccine: a global strategy to combat infectious and autoimmune diseases. Human Vaccine 2009;5(7):488–93. [36] José Dus Santos M, Wigdorovitz A. Transgenic plants for the production of veterinary vaccines. Immunol Cell Biol 2005;83:229–38. [37] Wigdorovitz A, Carrillo C, Dus Santos MJ, Trono K, Peralta A, Gómez MC, et al. Induction of a protective antibody response to foot and mouth disease virus in mice following oral or parenteral immunization with alfalfa transgenic plants expressing the viral structural protein VP1. Virol 1999;255:347–53. [38] Carrillo C, Wigdorovitz A, Oliveros JC, Zamorano PI, Sadir AM, Gómez N, et al. Protective immune response to foot-and-mouth disease virus with VP1 expressed in transgenic plants. J Virol 1998;72:1688–90. ˜ [39] Wigdorovitz A, Carrillo C, Trono K, Dus Santos MJ, Castanón S, Sadir AM, et al. Induction of a virus-specific antibody response to foot and mouth disease virus using the structural protein VP1 expressed in transgenic potato plants. Viral Immunol 2001;14:49–57. [40] Tacket CO, Mason HS, Losonsky G, Estes MK, Levin MM, Arntzen CJ. Human immune responses to a novel Norwalk virus vaccine delivered in transgenic potatoes. J Infect Dis 2000;182:302–5. [41] Wiersma HI, Galuska SE, Tomley FM, Sibley LD, Liberator PA, Donald RG. A role for coccidian cGMP-dependent protein kinase in motility and invasion. Int J Parasitol 2004;34(3):369–80. [42] Tomley FM, Bumstead JM, Billington KJ, Dunn PPJ. Molecular cloning and characterization of a novel acidic microneme protein (EtMIC2) from the apicomplexan protozoan parasite Eimeria tenella. Mol Biochem Parasitol 1996;79:195–206.

9208

K. Sathish et al. / Vaccine 29 (2011) 9201–9208

[43] Ding X, Lillehoj HS, Dalloul RA, Min W, Sato T, Yasuda A, et al. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against Coccidiosis. Vaccine 2005;23(28):3733–40. [44] Bashar AE, Jian Ping C, Ming Quan X, Guo Qing L, Zong Hua Q, Hui Xian W, et al. Characterization of Microneme-2 (EtMIC2) gene of Eimeria tenella Guangdong strain. Int J Poultry Sci 2003;2(2):133–8. [45] Jenkins MC. Progress on developing a recombinant coccidiosis vaccine. Int J Parasitol 1998;28(7):1111–9.

[46] Klotz C, Gehre F, Lucius R, Pogonka T. Identification of Eimeria tenella genes encoding for secretory proteins and evaluation of candidates by DNA immunization studies in chickens. Vaccine 2007;25(36):6625–34. [47] Trout JM, Lillehoj HS. T lymphocyte roles during Eimeria acervulina and Eimeria tenella infections. Vet Immunol Immunopathol 1996;53:163–72. [48] Miller TK, Bowman DD, Schat KA. Inhibition of the in vitro development of Eimeria tenella in chick kidney cells by immune chicken splenocytes. Avian Dis 1994;38:418–27.