Plasmodium vivax: functional analysis of a highly conserved PvRBP-1 protein region

Molecular & Biochemical Parasitology 117 (2001) 229– 234 www.parasitology-online.com.

Short communication

Plasmodium 6i6ax: functional analysis of a highly conserved PvRBP-1 protein region Elvia M. Cantor a, Tania B. Lombo a, Alexandra Cepeda a, Ana M. Espinosa a, Carlos A. Barrero a,b, Fanny Guzma´n a, Marı´a L. Gunturiz a, Mauricio Urquiza a, Marisol Ocampo a, Manuel E. Patarroyo a,c, Manuel A. Patarroyo a,* a

Fundacio´n Instituto de Inmunologia de Colombia (FIDIC), Cra 50 c 26 -00, Bogota, Colombia b Facultad de Medicina, Uni6ersidad Nacional de Colombia, Bogota, Colombia c Facultad de Ciencias Para La Salud, Uni6ersidad de Caldas, Bogota, Colombia Received 11 May 2001; accepted in revised form 24 July 2001

Keywords: Malaria; Plasmodium 6i6ax; Reticulocyte binding protein 1; Baculovirus; Binding assays; Polymorphism

Plasmodium 6i6ax is one of the most prevalent malarial species around the world [1]. Two P. 6i6ax reticulocyte binding proteins (PvRBP-1 and PvRBP-2), expressed at the apical pole of this parasite, are considered to be the binding ligands involved in the specific selection of this younger red blood cell population [2]. The adhesion of the PvRBP complex, to an unknown receptor on the target cells, does not depend on the presence of the red blood cell Duffy glycoprotein, this being strictly a receptor for the PvDBP protein. Using 15-mer radio-labelled non-overlapping synthetic peptides, spanning the entire PvRBP-1 sequence, several highly specific reticulocyte binding peptides were found for which the affinity constants, Hill analysis, critical amino acids, biological functions and receptor molecules on the reticulocytes were identified (M. Urquiza et al., submitted for publication). This paper Abbre6iations: RBP, reticulocyte binding protein; aa, amino acid; ELISA, enzyme-linked immunosorbent assay; t-Boc, ter-butoxycarbonyl; HPLC, high-pressure liquid chromatography; Ig, immunoglobulin; PMSF, phenylmethylsulphonyl fluoride; kDa, kilodalton; PCR, polymerase chain reaction; RBC, red blood cells; HABP, high-affinity binding peptide; GST, glutathione S-transferase.  Note: Previously reported RBP-1 nucleotide and amino acid sequences from the Belem strain (GenBank™ accession numbers M88097 and AAA29743, respectively) were used as reference. * Corresponding author. Tel.: +57-1-220-7700x494; fax: +57-1280-3999. E-mail address: [email protected] (M.A. Patarroyo).

describes the identification of five high-affinity binding peptides to reticulocytes (HABPs) in a fragment of this protein named region I, located in the PvRBP-1 amino terminal portion (amino acids 658 –800). Region I cloning, expression, purification, characterisation and binding to reticulocytes by two different methods are shown. Based on the reported PvRBP-1 amino acid sequence [3], and the binding studies performed by Urquiza et al. (submitted for publication), nine 15-mer non-overlapping peptides from residues 665 to 794 were synthesised. Peptide sequences are shown in Fig. 1 in one-letter code. For those peptides lacking tyrosine residues in their native sequence, tyrosine was added at the carboxy-terminal in order to allow radio-iodination (Fig. 1a, bold letters). After giving verbal consent, a b-thalassaemia patient from the Haematology Unit at the San Juan de Dios Hospital provided the human reticulocytes; she had a ] 85% reticulocytes in her red blood cell population. More than 90% of the leukocytes were removed from the red blood cell sample by several passages through cotton columns [10]. Normal erythrocytes were obtained from healthy blood donors. The methodology described in Fig. 1a, previously used to recognise Plasmodium falciparum protein peptides having high specific binding to mature RBCs, was applied to identify high-affinity reticulocyte binding

0166-6851/01/$ - see front matter © 2001 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 6 8 5 1 ( 0 1 ) 0 0 3 5 5 - 3

230

E.M. Cantor et al. / Molecular & Biochemical Parasitology 117 (2001) 229–234

Fig. 1. (a) Binding profiles of the peptides included inside the recombinant PvRBP-1 region I and their amino acid sequences are in one-letter code. Tyrosines added for radio-iodination are shown in bold letters. HABPs are those with ] 2% binding activities. The only polymorphic amino acid (E/K) located inside peptide 3464 is underlined. Both the recombinant fragment and the 3464 peptide have glutamic acid (E) at position 753. Peptides were synthesised with N-atBoc amino acids (Bachem), using the solid phase multiple synthesis technique [4 – 6]. Radio-iodination was carried out by the chloramine T method described elsewhere [7 – 9]. Red blood cells (1 ×108), being reticulocytes or erythrocytes, were incubated in triplicate at various radio-iodinated peptide concentrations (4, 8, 14 and 20 pmol) in a 75 ml final volume. Suspension was mixed at room temperature for 1 h. After incubation, unbound radio-labelled peptide was removed by three washes in PBS and cell-bound peptide was measured in a g-counter. Non-specific binding was determined as being the radio-labelled bound peptide in the presence of 400 pmol unlabelled peptide (100× to 20 × cold peptide excess). Specific binding was calculated by subtracting the non-specific binding from the total binding. The slope×100 of the specific binding curve (specific binding peptide vs. added peptide) was taken as binding activity indicator [7 – 9]. (b) Saturation curves for peptides from PvRBP-1 region I displaying the highest reticulocyte binding activity in the initial screening (above 4%), were performed as described elsewhere [7 –9]. All peptides show saturation kinetics with Kds ranging from 130 to 380 nM. Each assay was performed in triplicate. Mean 9 SD is shown.

E.M. Cantor et al. / Molecular & Biochemical Parasitology 117 (2001) 229–234

peptides [7–9]. Peptides with slopes equal to or greater than 2% were considered to be high-binding activity peptides for target cells. Binding assays with reticulocytes from different b-thalassaemic patients were also performed to confirm these results. Region I contained nine non-overlapping peptides, five of which showed high reticulocyte binding affinity (Fig. 1a): 3459 (aa KEILDKMAKKVHYLK), 3463 (aa LYNSVYREDINALIE), 3464 (aa EVEKFVTENKESTLY), 3465 (aa EMLKDEEMEEKLQDY) and 3466 (aa AKETFAKLNFVSDDY). In simultaneous experiments, no significant binding to normal erythrocytes was observed with any of these peptides (Fig. 1a), showing their selective binding to reticulocytes. Saturation analysis was performed on those peptides displaying the highest binding activity (above 4%), as described elsewhere [7– 9]. The peptides showed a binding pattern characteristic of a single receptor– ligand interaction and their affinity constants were: 155 nM for peptide 3459, 380 nM for peptide 3464 and 130 nM for peptide 3465 (Fig. 1b). All three peptides’ reticulocyte binding affinity is very high, since their Kds are in the nanomolar range. Twenty P. 6i6ax-infected blood samples were collected from two different malaria-endemic areas of Colombia to determine the extent of genetic polymorphism found within the PvRBP-1 region I in native isolates. Parasite DNA was extracted as described elsewhere [11,12]. A 432 bp fragment spanning region 1 was amplified using standard PCR protocols according to manufacturer’s instructions and the primers RB-1 (5% GCGTCACAGAAATAAATCG 3%) and reverse RB-2 (5% TGTACACATCTGTCAGCTTG 3%), cloned and three clones from independent amplifications sequenced. All 20 P. 6i6ax Colombian isolates analysed showed a dimorphic pattern; of the ten samples collected from the Eastern (Villavicencio, P. 6i6ax prevalent — 64% of cases) and Southwestern Pacific (Tumaco, P. 6i6ax — 36% of cases) regions, four and one, respectively, showed a single non-synonymous nucleotide change from G to A at position 2488. This first base transition produced a non-conservative substitution of a glutamic acid for a lysine at amino acid position 753 (Fig. 1a, underlined), located in the N-terminal portion of peptide 3464. The effect of glutamate to lysine transition on the 3464 peptide’s binding ability was not assessed. Our previous polymorphism analysis of two other P. 6i6ax antigens (Pv200 and Duffy binding protein), in samples collected from the same geographical regions, showed a much greater extent of genetic polymorphism [13,14]; this contrasts with the present results, showing that polymorphism within the RBP-1 region I is very limited. The pAcGHLT-A transfer vector (Pharmingen) was used to clone the PvRBP-1 region I for the construction of the recombinant baculovirus [15,16]. The RBP-1

231

region I, previously cloned in pMOS Blue vector, was thus excised using this vector’s unique EcoRI and Pst I restriction sites and further cloned into pAcGHLT-A. This vector allowed PvRBP-1 region I expression as a fusion polypeptide with glutathione S-transferase (GST) and a 6× -Histidine tag at its amino-terminus, both being useful for purification procedures. The recombinant transfer plasmid was co-transfected with the linearised baculoviral DNA (BaculoGold™ Transfection Kit, Pharmingen) into the Spodoptera frugiperda (Sf9) insect cell line, according to manufacturer’s instructions [16–18]. Sf9 insect cell suspension and monolayer cultures were kept under standard conditions [18]. The greatest amounts of recombinant protein (during the scale-up process) were obtained by using a multiplicity of infection (MOI) of 16 and a time of infection (TOI) of 144 h [19]. The supernatant was collected and the pellet was lysed with 3% SDS; PMSF protease inhibitor was then added up to 10 mM final concentration. Both pellet and supernatant were monitored by SDS-PAGE or Tricine-PAGE [20]. Expressed product presence was verified by immunoblot, using an antipolyhistidine monoclonal antibody [21]. PvRBP-1 region I was purified by immobilised metalion affinity chromatography, as described elsewhere [22]. Only one band was observed in 12% SDS-PAGE, migrating at about 49 kDa (similar to the 47.7 kDa predicted size) determined by using GENE RUNNER v 3.00 (Hastings Software). This purified recombinant protein was recognised by a monoclonal antibody against the polyhistidine tag at 1:1500 dilution (data not shown). The selected expression system (Baculovirus) yielded approximately 220 mg protein per litre of culture medium as determined by the bicinchoninic acid method [23]. Two different methods were applied to test recombinant PvRBP-1 region I binding properties to both erythrocytes and reticulocytes. The first one (CellELISA) was performed as described by Ternynck and Avrameas [24]. Higher binding capacity to young red blood cells (reticulocytes) was observed. Nevertheless, the recombinant protein was also able to bind erythrocytes to a lesser extent (Fig. 2a). The binding pattern behaved in a concentration-dependent fashion without reaching saturation point at the protein concentrations tested, because the PvRBP-1 region I purified fragment tended to precipitate at higher concentrations, within the conditions of this assay. The possible participation of the recombinant protein’s GST moiety in the target cell binding was assessed in a competition assay using different GST excesses and also by studying the binding profile of the GST alone. As seen in Fig. 2b, the GST shows marginal binding to erythrocytes but does not bind reticulocytes or lymphocytes.

232

E.M. Cantor et al. / Molecular & Biochemical Parasitology 117 (2001) 229–234

Fig. 2.

E.M. Cantor et al. / Molecular & Biochemical Parasitology 117 (2001) 229–234

In the GST competition assay (Fig. 2c), reticulocyte and erythrocyte binding at 100 mg ml − 1 of recombinant RBP-1 region I with a 1× GST amount is very similar. Nevertheless, when the GST excess is increased to 10× at the same PvRBP-1 region I concentration, erythrocyte binding drops. Both results (Fig. 2b and c) suggest that the GST moiety of the RBP-1 region I could be contributing to a certain extent to the binding to erythrocytes but not to reticulocytes. Meanwhile, RBP-1 region I binding remains similar using both 1× and 10 × GST excesses, suggesting that the binding is occurring due to the RBP-1 moiety. In the second method applied (the agglutination assay), recombinant PvRBP-1 region I was used to cover Talon Metal Affinity Resin (Clontech), taking advantage of the protein’s 6 ×-Histidine tag. As these beads are about 20 times bigger than the reticulocytes, binding can be assessed by the cell agglutination around the beads’ surface as detected by optical microscopy. Positive reticulocyte (Fig. 2d), but not erythrocyte (data not shown), binding to the beads covered with the recombinant protein was seen. Observation of the recombinant protein attached to the beads by fluorescence microscopy showed a patchy distribution (Fig. 2e). Reticulocyte agglutination around the beads, as observed by light microscopy, followed the recombinant protein’s exact location pattern as seen by fluorescence. Negative controls, using non-covered beads, displayed neither binding (Fig. 2f) nor fluorescence (data not shown). As already implied, the effect of GST competition on reticulocyte binding with the PvRBP-1 fragment was determined by Cell-ELISA assay as it was more quantitative. The preference for reticulocytes was in agree-

233

ment with the binding assays, as previously reported using the whole PvRBP-1 protein [2,3]. Differences in erythrocyte binding between the two methods are attributable to the more thorough washes in the agglutination assay, eliminating loose binding interactions. Both, the PvRBP-1 region I functional importance conferred by its reticulocyte binding properties, and the limited genetic polymorphism found, are in accordance with previous reports, showing that those regions critical for host cell invasion process are kept conserved by the parasite [25]. As shown in this paper, both the specific reticulocyte binding, exhibited by the expressed PvRBP-1 region I and the five HABPs, as well as this region’s limited genetic variability, are consistent with this protein’s role in one of the initial steps of reticulocyte invasion by the parasite.

Acknowledgements This work was supported by the Colombian Ministry of Public Health. We are greatly indebted to Manuel Carlos Lo´ pez and Maricarmen Thomas at the Instituto de Parasitologı´a y Biomedicina Lo´ pez-Neyra (Granada, Spain) for their valuable help with the Baculovirus expression system, Estela Buitrago from the Malaria Eradication Service (Servicio de Erradicacio´ n de Malaria) and Yolanda Silva at our Institute for providing the P. 6i6ax-infected samples and Vladimir Corredor, Jason Garry, Yago Pico de Coan˜ a Sua´ rez and Edward Fabia´ n Carrillo for patiently reviewing this manuscript. We would also like to thank Jimena Corte´ s

Fig. 2. (a) Binding assay (Cell-ELISA): PvRBP-1 region I binds to reticulocytes and, to a lesser extent, to erythrocytes in a concentration-dependent fashion. The binding to lymphocytes was used as a negative control. Experiments were performed in triplicate. Mean 9 SD is shown. Red cells (2 × 106) (erythrocytes or reticulocytes) were attached to a 96-well plate and, after extensive PBS washing and blocking, incubated for 4 h at 37 °C with 100 ml of PvRBP-1 region I in increasing concentrations (0, 0.3, 0.6, 1.25, 2.25, 5, 10 and 15 mg). Bound protein was recognised with a mouse anti-polyhistidine monoclonal antibody (1:2000) for 1 h at 37 °C. A rabbit anti-mouse IgG Aff. Alkaline Phosphatase Conjugate was added (1:2000), as secondary antibody, under the same conditions. Results were developed using a phosphatase substrate solution (KPL Laboratories). (b) GST binding profile: Increasing concentrations of GST alone were incubated with reticulocytes, erythrocytes and lymphocytes to test whether the GST moiety of PvRBP-1 could be contributing to target cell binding. Experiments were performed in triplicate. Mean 9 SD is shown. The same protocol used in the PvRBP-1 binding was performed at GST concentrations of 6, 12.5, 25 and 50 mg ml − 1. Bound protein was recognised with a 1:4000 dilution of rabbit anti-GST. Goat anti-rabbit IgG – horseradish peroxidase conjugate (1:2000) was added as secondary antibody. The reaction was developed with the TMB Peroxidase Substrate Kit (KPL Laboratories). (c) GST/RBP-1 region I competition assay: A competition assay between 100 mg ml − 1 of PvRBP-1 region I and increasing concentrations of GST (1 ×, 5 × and 10× ) was done. Although the initial reticulocyte and erythrocyte binding at 1 × GST is similar, the erythrocyte binding drops at 10 × GST. Experiments were performed in triplicate. Mean 9 SD is shown. Target cells were blocked with 1% gelatin and then preincubated with different GST excesses (1 × , 5× and 10 ×) for 1 h at 37 °C and afterwards for 1 h at 4 °C. Four PBS washes were performed after each incubation step. PvRBP-1 region I (100 mg ml − 1) was then added and incubated overnight at 4 °C. A 1 h incubation at 37 °C with a mouse anti-polyhistidine mAb (1:1000), followed by a rabbit anti-mouse IgG –horseradish peroxidase conjugate (1:500) incubated under the same conditions, was performed to determine the PvRBP-1 region I remaining bound. The reaction was developed with the TMB Peroxidase Substrate Kit (KPL Laboratories). (d – f) Binding assay (agglutination): Thirty microscopic fields were observed; in at least ten of these fields NI-NTA beads covered with PvRBP-1 region I bound to reticulocytes in a pattern correlated with immunofluorescence localisation. Reticulocyte binding (d) and recombinant protein localisation as seen by immunofluorescence (e) in the same microscopic field. (f) Negative control. Fifty microlitres of beads were incubated with 10 mg ml − 1 recombinant protein for 1 h at room temperature. After incubation, three washes were made by gentle agitation. Afterwards, a 0.5% solution of either reticulocytes or erythrocytes in PBS was incubated for 1 h at room temperature. Three more gentle washes with PBS were done. Incubations were performed with the anti-polyhistidine monoclonal antibody (1:1000) for 1 h at room temperature followed by one wash and further incubation with an anti-mouse Fc FITC-linked monoclonal antibody (1:1000) in the same conditions. Results were observed both by light and UV microscopy.

234

E.M. Cantor et al. / Molecular & Biochemical Parasitology 117 (2001) 229–234

and Camilo Moncada for their technical help during the experimental procedures.

References [1] The World Health Report 1999: making a difference. World Health Organization (WHO), Geneva, 1999. [2] Galinski MR, Barnwell JW. Plasmodium 6i6ax: merozoites, invasion of reticulocytes and considerations for malaria vaccine development. Parasitol Today 1996;12:20 –9. [3] Galinski MR, Corredor C, Ingravallo P, Barnwell JW. A reticulocyte-biding protein complex of Plasmodium 6i6ax merozoites. Cell 1992;69:1213 – 26. [4] Merrifield RB. Solid phase peptide synthesis I. The synthesis of a tetrapeptide. J Am Chem Soc 1963;85:2149. [5] Houghten RA. General method for the rapid solid phase synthesis of large numbers of peptides: specificity of antigen antibody interaction at the level of individual amino acids. Proc Natl Acad Sci USA 1985;82:5131. [6] Tam JP, Heath WF, Merrifield RB. SN2 deprotection of synthetic peptides with a low concentration of HF in dimethyl sulphide: evidence and application in peptide synthesis. J Am Chem Soc 1983;105:6442. [7] Urquiza M, Rodriguez LE, Suarez JE, Guzman F, Ocampo M, Curtidor H, Segura C, Trujillo E, Patarroyo ME. Identification of Plasmodium falciparum MSP-1 peptides able to bind to human red blood cells. Parasite Immunol 1996;18:515 –26. [8] Ocampo M, Urquiza M, Guzman F, Rodriguez LE, Suarez J, Curtidor H, Rosas J, Diaz M, Patarroyo ME. Two MSA-2 peptides that bind to human red blood cells are relevant to Plasmodium falciparum merozoite invasion. J Pept Res 2000;55:216 – 23. [9] Rodriguez LE, Urquiza M, Ocampo M, Suarez J, Curtidor H, Vargas LE, Trivin˜ os M, Rosas M, Partarroyo ME. Plasmodium falciparum EBA-175 kDa protein peptides which bind to human red blood cells. Parasitology 2000;20:225 – 35. [10] Vigagni F, Norppa H. Comparison of separated erythrocyte preparations and manual smears of bone marrow in showing micronucleus induction by clastogens and aneuploidogens in mouse. Mutagenesis 1995;10:365 – 9.

[11] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1989. [12] Ausubel FM, Brent R, et al. Current protocols in molecular biology, 2nd ed. New York: Greene Publishing Associates and Wiley Interscience, 1993. [13] Gutie´ rrez A, Vicini J, Patarroyo ME, Murillo LA, Patarroyo MA. Plasmodium 6i6ax: polymorphism in the merozoite surface protein 1 gene from wild Colombian isolates. Exp Parasitol 2000;95:215 – 9. [14] Ampudia E, Patarroyo MA, Patarroyo ME, Murillo LA. Genetic polymorphism of the Duffy receptor binding domain of Plasmodium 6i6ax in Colombian wild isolates. Mol Biochem Parasitol 1996;78:269 – 72. [15] Murphy CI, et al. Current protocols in molecular biology. New York: Wiley, 1997 (Supplement 38). [16] Higgins SJ, Hames BD. Protein expression: a practical approach. Oxford: Oxford University Press, 1999. [17] Crossen R, Gruenwald S. Baculovirus expression vector system manual, 5th ed. San Diego, USA: BD PharMingen, 1998. [18] Luckow VA. Cloning and expression of heterologous genes in the insect cells with baculovirus vectors. In: Prokop E, Bajpai RK, Ho C, editors. Recombinant DNA Technology and Application. McGraw-Hill: New York, 1991:97 – 152. [19] O’Reilly DR, Miller LK, Luckow VA. Baculovirus expression vectors: a laboratory manual. oxford: Oxford University Press, 1994. [20] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680. [21] Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Proc Natl Acad Sci USA 1979;76:4350 – 4. [22] Porath J, Carlsson J. Metal chelate affinity chromatography, a new approach to protein fractionation. Nature 1975;258:598 –9. [23] Janknecht R, de Martynoff G, Lou J, Hipskind RA, Nordheim A, Stunnenberg HG. Rapid and efficient purification of native histidine-tagged protein expressed by recombinant vaccinia virus. Proc Natl Acad Sci USA 1991;88:8972 – 6. [24] Ternynck TH, Avrameas S. Immunoenzymatic techniques, vol. 1. Paris: Pasteur Institute, 1990. [25] Mendis KN, David H, Carter R. Antigenic polymorphism in malaria: is it an important mechanism for immune evasion? Immunol Today 1996;12(3):34 – 7.