- Email: [email protected]
von Willebrand Factor A Domain-related Protein, a novel microneme protein of the malaria ookinete highly conserved throughout Plasmodium parasites
Molecular & Biochemical Parasitology 116 (2001) 65 – 72 www.parasitology-online.com.
von Willebrand Factor A Domain-related Protein, a novel microneme protein of the malaria ookinete highly conserved throughout Plasmodium parasites Masao Yuda a,*, Kazuhiko Yano a, Takafumi Tsuboi b, Motomi Torii b, Yasuo Chinzei a b
a Department of Medical Zoology, Mie Uni6ersity School of Medicine, Edobashi, Tsu, 514 -0001, Japan Department of Molecular Parasitology, Ehime Uni6ersity School of Medicine, Shigenobu, Ehime 791 -0295, Japan
Received 6 December 2000; received in revised form 9 May 2001; accepted 14 May 2001
Abstract The mosquito-invasive form of the malarial parasite, the ookinete, develops numerous secretory organelles, called micronemes, in the apical cytoplasm. Micronemal proteins are thought to be secreted during midgut invasion and to play a crucial role in attachment and motility of the ookinete. We found a novel ookinete micronemal protein of rodent malarial parasite Plasmodium berghei, named P. berghei von Willebrand factor A domain-related protein (PbWARP), and report it here as a putative soluble adhesive protein of the ookinete. The PbWARP gene contained a single open reading frame encoding a putative secretory protein of 303 amino acids, with a von Willebrand factor type A module-like domain as a main component. Western blot analysis demonstrated that PbWARP was firstly produced 12 h after fertilization by maturing ookinetes as SDS-resistant complexes. Recombinant PbWARP produced with a baculovirus system also formed SDS-resistant high-order oligomers. Immuno-electron microscopic studies showed that PbWARP was randomly distributed in the micronemes. PbWARP homologues also exist in human malarial parasites, Plasmodium falciparum and Plasmodium 6i6ax. Highly conserved primary structures of PbWARP homologues among these phylogenetically distant Plasmodium species suggest their functional significance and the presence of a common invasion mechanism widely utilized throughout Plasmodium parasites. © 2001 Elsevier Science B.V. All rights reserved. Keywords: Malaria; Plasmodium berghei; Ookinete; von Willebrand Factor A Domain– related Protein
1. Introduction Micronemes are membrane-bound secretory organelles commonly observed in all host-invasive forms of apicomplexan parasites. These invasive parasites store molecules critical for their adhesion and invasive locomotion in the micronemes and secrete them from the apex (or present them on the apical surface) during Abbre6iations: CTRP, circum sporozoite protein and TRAP-related protein; IEM, immuno-electron microscopy; TRAP, thrombospondin-related adhesive protein. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBank™ data base with the accession numbers AF364867 and AB051630. * Corresponding author. Tel.: +81-59-231-5013; fax: + 81-59-2315215. E-mail address: [email protected] (M. Yuda).
host-cell invasion [1]. Malarial parasites are fertilized in the midgut lumen of the mosquito vector and develop into a motile form, the ookinete. Ookinetes invade into the midgut epithelial cells, pass through them, and arrive at the basal lamina (basement membrane), where they develop into oocysts. Micronemal proteins of apicomplexan parasites reported so far include soluble proteins and transmembrane proteins. The transmembrane proteins have single transmembrane domains and usually have a large extracellular region and a short cytoplasmic tail. Some of them belong to a distinct protein family, the thrombospondin-related protein family, members of which have been widely reported in the apicomplexan parasites [2]. These proteins are thought to be necessary for creating invasive locomotion of the parasites and consequently essential for their infection of the host cell [3,4].
0166-6851/01/$ - see front matter © 2001 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 6 8 5 1 ( 0 1 ) 0 0 3 0 4 - 8
66
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
Soluble microneme proteins have mainly been reported in coccidian parasites [5– 7]. It seems that a variety of soluble proteins exist in the microneme. The function of many of these soluble microneme proteins remains unclear, but they are also thought to be involved in parasite invasion of the host cell. In the malarial ookinete, chitinase is the only soluble protein that has been reported to exist in the microneme [8]. It is secreted by ookinetes and necessary for their passage through the peritrophic membrane of the mosquito [9]. In this paper, we report a novel soluble micronemal protein with an adhesive protein-related structure that is produced by the ookinete. This protein is mainly composed of a von Willebrand factor type A module-like domain (A domain) that is known to participate in cell–cell interactions, cell– matrix interactions, and matrix formation in several proteins including von Willebrand factor, the alpha chains of integrins, and some types of collagen [10,11]. We hypothesize that this protein acts as an adhesive substrate connecting ookinete surface and midgut molecules during ookinete midgut invasion. In addition, we performed immuno-electron microscopy (IEM) studies and compared its distribution with that of P. berghei circumsporozoite protein and TRAP-related protein (PbCTRP), a micronemal transmembrane protein that belongs to the thrombospondin-related protein family of the apicomplexan parasites [12].
genomic DNA sequence that seems to encode an A domain of an unreported P. falciparum protein was obtained. Degenerate primers (5%-CCAGGAGATTATTGYGAYAAYTAYTAYGA-3% and 5%-TAATACAGCAACYTTNGGNGCRTC) were designed based on deduced amino acid sequences (PGDYCSNYYD and DAPKVAVL) and PCR (30 cycle, annealing conditions, 46 °C, 1min) was performed using P. berghei ookinete cDNA as a template. Remaining 5% and 3% portions were separately amplified by anchor-PCR using P. berghei ookinete cDNA plasmid library as a template with primer sets of a cDNA specific primer and a vector specific primer. Primer sets used for 5% portion and 3% portion amplification were 5%-A-TCACTTCTTGTACCCTCTCCG-3% (cDNA-specific primer) and 5%-TAATACGACTCACTATAGGG-3% (vector-specific primer), 5%-GATTATTGGATGAA-GGGAACAATCCC-3% (cDNA-specific primer) and 5%-GATTTAGGTGACACTATAG-3% (vector-specific primer), respectively. PbWARP gene containing a full-length open reading frame was amplified by PCR using P. berghei genomic DNA as a template with specific primers for 5%- and 3%-untranslated regions of PbWARP cDNA (5%GGGTCGACTTAAAGCTTTCCTCACCCAC-3% and 5%-GGGCGGCCGCTATGTTTCGGTTTCTAATAA GGC-3%).
2.3. Southern blot analysis 2. Methods
2.1. Ookinete culture Balb/c mice infected with Plasmodium berghei ANKA strain were prepared by peritoneal injection of infected blood that had been stored at −70 °C. Infected mice were used within one blood passage for ookinete culture as described previously [4]. Parasites were purified by erythrocyte lysis in 0.83% NH4Cl and used for further analysis.
2.2. Cloning and determination of the primary structure of PbWARP Poly(A)+ RNA was extracted using a microprep mRNA purification kit (Amersham Pharmacia Biotech) from P. berghei ookinetes cultured for 23 h in vitro after fertilization. cDNA synthesis and plasmid library construction were performed using the Superscript™ Plasmid System (GIBCO BRL) according to the manufacturer’s instructions. The PbCTRP amino acid sequence was used for a TBLAST search on preliminary sequence data for Plasmodium falciparum chromosome 11 (The Insitute for Genomic Research website (www.tigr.org)). A partial
Southern blot analysis was performed in essentially the same procedure as described [4]. Partial DNA fragments of PbWARP were amplified by PCR using subcloned PbWARP genomic DNA as a template with the primer pair, 5%-ATGAAGAGTGTTAAAGGAATA-AC-3% and 5%-AATGGGATTGTTCCCTTCATCC-3%, labeled with [32P] dCTP, and used as a hybridization probe.
2.4. P6WARP and PfWARP DNA sequences Partial sequence data of Plasmodium 6i6ax WARP gene were obtained from the University of Florida Gene Sequence Tag Project Website at http://parasite.vetmed.ufl.edu by a TBLAST search. Full-length PvWARP DNA sequence was obtained by anchor PCR using a P. 6i6ax genomic DNA splinkerette library as template with primer sets of a PvWARP specific primer and a splinkerette specific primer [13]. PvWARP-specific primers used for 5% portion and 3% portion amplification were 5%-CCGAAAGTTGTAGTCCTGTT-3% and 5%-CCCACTATCACCAGTTTGAC-3%, respectively. The splinkerette specific primer is 5%-TCGTACGAGAATCGCTGTCCTCTCC-3%. Sequence data of P. falciparum WARP gene were obtained from The Sanger Centre website at http://www.sanger.ac.uk/Projects/P – falciparum/.
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
2.5 Re6erse transcriptase-PCR (RT-PCR ) mRNA extraction and cDNA synthesis for RT-PCR were carried out in the same procedure as described above. PCR (22 cycle) was performed using cDNA synthesized from 1 ng of mRNA as template. Specific primer pairs used for amplification of Pbs21, PbCTRP, and PbWARP cDNA were 5%-TGTAGACACGATATGTAAAGGTGG-3% and 5%-AACTGCTATTTGATGGCGTTTCGC-3%, 5%-CTGCTTGTGTACCTCCC-3% and 5%-CGCACACGCATATGAGC-3%, and 5%-ACAC TTGATGACGCGGG-3% and 5%-TTTATTATATAACATGTTTTTTAGTTTTCGGGC-3%, respectively.
67
Western blot analysis was performed by essentially the same procedure as described previously [4].
2.8. Immunocytochemistry Immunofluorecence microscopy analysis of the ookinete was performed using anti-peptide antibodies against the C-terminal region of PbWARP by essentially the same procedure as described previously [4]. Immuno-electron microscopy analysis was performed by essentially the same procedure as described previously [14].
2.6. Recombinant PbWARP
3. Results
Recombinant PbWARP was produced by a baculovirus–insect cell system by essentially the same procedure as described previously [12]. A DNA fragment containing the full open reading frame was amplified by PCR using subcloned PbWARP genomic DNA as a template with the primer pair, 5%-AAGGATCCAA ATATATAATGAAGAGTGTTAAAGG-3% and 5%-AA GGATCCTAGTGATGGTGATGGTG, and subcloned into the BamHI site of baculovirus-transfer vector, pAcYM1. Recombinant virus was obtained by co-transfection of Sf9 cells with this construct and BaculoGold DNA (Pharmingen). The virus obtained was cloned by plaque assay, amplified, and infected to Tn5 cells for overexpression of the recombinant protein. Production of recombinant PbWARP in E. coli (DH5a) was performed by essentially the same procedure as described previously [4]. A DNA fragment encoding PbWARP without the signal peptide was amplified by PCR using subcloned PbWARP genomic DNA as a template with the primer pair, 5%-AAGGATCCCAAAAGGTTAATGTTGTTTCAC-3% and 5%-TTCTCGAGTCAATCACTTCTTGTACCCTCTC CG-3%, and subcloned into a expression plasmid, pGEX6P-1 (Amersham Pharmasia Biotech) using the unique restriction site, BamHI/XhoI. Recombinant PbWARP was produced as GST-fusion protein and affinity-purified on glutathione sepharose (Amersham Pharmasia Biotech). Fused GST was separated according to the manufacturer’s instructions.
3.1. Structure of PbWARP Sequencing of a partial cDNA fragment isolated by degenerate PCR and the remaining 3% and 5% ends of the cDNA obtained by anchor PCR revealed that this cDNA contains an open reading frame encoding a putative 303-amino-acid protein with a calculated molecular mass of 33.7 kDa (Fig. 1). The analysis of the primary structure by Signal P [15] and TMpred [16] indicates that it has a secretory protein-like structure with a 22-amino-acid signal sequence and is composed of a short N-terminal region followed by a von Willebrand factor type A module-like domain (A domain). Therefore, we named this protein P. berghei von Willebrand Factor A Domain-related Protein (PbWARP). The PbWARP A domain exhibited 34% and 20% amino acid sequence identity and 52% and 40% similarity to the fourth A domain of PbCTRP and PbTRAP A domain, respectively. A putative metal ion-dependent adhesion site motif (11) was partially conserved (Fig. 1, boxed). Comparison of the nucleotide sequence of PbWARP cDNA and genomic DNA sequence showed that PbWARP gene had no introns. Southern blot analysis showed that it was a single copy gene (data not shown). We investigated PbWARP homologues in medically important human malaria species, P. falciparum and P. 6i6ax. They show significant sequence identities, especially in the A domains. The overall sequence identities of the PbWARP to PvWARP and PfWARP are 66.2% and 61.0%, respectively.
2.7. Antibody preparations and Western blot analysis 3.2. PbWARP is produced by the ookinete A peptide corresponding to C-terminal amino acid residues 285–303 of PbWARP was synthesized. It was conjugated to carrier protein, keyhole limpet hemocyanin, and used for immunization of rabbits. Specific antibodies were purified from the rabbit anti-serum using High Trap column (Amersham Pharmasia Biotech) linked with the peptide.
Western blot analysis showed that PbWARP was absent in the blood-stage parasites containing both sexual and asexual stages (Fig. 2A, 0 h) and firstly appeared 12 h after fertilization, when most zygotes have just exhibited an elongated shape (Fig. 2A). Under non-reducing conditions, PbWARP was detected as
68
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
multiple bands. The apparent sizes of the detected proteins were obviously higher than that estimated from the amino acid sequence of PbWARP. As shown below, this suggests that PbWARP forms SDS-resistant complexes. RT-PCR demonstrated that the PbWARP transcript was present after fertilization (Fig. 2B, 19 h) but not in the blood stage (0 h) (Fig. 2B). Immunofluorecence microscopy showed that PbWARP was present mainly in the anterior cytoplasm of the mature ookinetes (Fig. 2C). This distribution and the ‘patchy appearance’ of the signals strongly indicated that it was localized in the micronemes.
proteins were composed of PbWARP monomers linked with disulfide bonds. Doublet band patterns might be due to different quaternary structures of the oligomers The monomer size of native PbWARP (30 kDa) indicates that part of the N-terminal region has been processed after targeting to the micronemes, since recombinant PbWARP produced by E. coli was detected at 37 kDa on SDS-PAGE under reducing conditions (data not shown).
3.4. PbWARP and PbCTRP distribution in the microneme
3.3. PbWARP forms SDS-resistant oligomers Fig. 3A shows Western blot analysis of native PbWARP under different reducing conditions. When not reduced, doublet protein bands were detected at 120/ 135 kDa, 75/82 kDa, and 60/66 kDa (Fig. 3A, lane 1). By weak reduction, smaller protein bands were enhanced (Fig. 3A, lane 2). By strong reduction, only monomers were detected mainly at 30 kDa (Fig. 3A, lane 3). Fig. 3B shows Western blot analysis of PbWARP produced in the baculovirus– insect cell system. Oligomer formation and a doublet band pattern were also observed in the recombinant proteins. Monomers were detected mainly at 37 kDa. We suppose that these complexes observed in both native and recombinant
In order to investigate subcellular localization of PbWARP, we performed IEM studies of the P. berghei ookinete cultured in vitro. In addition, we performed IEM studies with antibodies against PbCTRP and compared distribution of these ookinete proteins. As shown in Fig. 4A and B, PbCTRP was observed in all the micronemes and appeared to be peripherally distributed in each microneme. However, PbWARP was observed mainly in the high electron dense micronemes and showed random distribution in the microneme body (Fig. 4C and D). The peripheral distribution of CTRP was also observed in P. gallinacium ookinetes using antibodies against PbCTRP that cross-react with PgCTRP (unpublished data).
Fig. 1. Nucleic acid sequence of PbWARP cDNA and the predicted amino acid sequence. The predicted signal sequence is boxed with dotted lines. The amino acid sequence corresponding to the A domain is underlined. Cysteine residues are circled. Conserved amino acids of metal ion-dependent adhesion site motif are boxed. Two alternative polyadenylation sites are indicated by arrowheads.
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
69
Fig. 2. Expression profile of PbWARP gene. (A) Production of PbWARP by maturing ookinetes. Parasites were fertilized in vitro, cultured for ookinete maturation, and collected at the time intervals indicated under each lane. They were purified by erythrocyte lysis and lysed in SDS-PAGE sample buffer. Samples ( 106 ookinetes per lane) were separated on a 5 – 20% gradient gel under non-reducing conditions, blotted onto a nitrocellulose membrane, and stained using antibodies against PbWARP and then alkaliphosphatase-conjugated second antibodies. (B) Induction of PbWARP mRNA after fertilization. Poly(A)+ RNAs were extracted from the blood stage parasites (0 h) or the same parasites cultured for 19 h in vitro after fertilization (19 h). RT-PCR was performed using primers for Pbs21, PbCTRP, and PbWARP, as indicated. The mRNA of Pbs21, a surface protein of the P. berghei ookinetes, has been reported to be present both before and after fertilization. That of PbCTRP, a microneme protein, has been reported to be induced after fertilization [4]. (C) Immunofluorescence microscope of the mature ookinete. Parasites were cultured for 23 h after fertilization and purified by erythrocyte lysis. Purified parasites were fixed in acetone for 1 min and stained using antibodies against PbWARP and then FITC-conjugated second antibodies. Arrowheads indicate the apical ends of the ookinetes.
4. Discussion We report here the structure and some characteristics of a novel ookinete protein, PbWARP. PbWARP has a secretory protein-like structure and contains a putative adhesive domain, related to the von Willebrand factor A domain, as its main component. It is firstly produced by the maturing ookinete and localized in the micronemes of the mature ookinete. Distinct suborganellar distribution patterns of PbWARP and PbCTRP indicate that PbCTRP is associated with the microneme membrane, while PbWARP is stored as a soluble protein in the microneme. Since PbCTRP has a transmembrane protein-like structure [4], this observation reflects a structural difference between the two proteins. Presumably, CTRP is associated with the microneme membrane via its transmembrane-like region and then presented on the parasite surface during
parasite invasion into the midgut. However, PbWARP may exist as a soluble micronemal protein and be secreted from the parasite apex. It is known that invasive stage apicomplexan parasites typically have distinct secretory organelles, micronemes, rhoptries, and dense granules that can be distinguished from each other under transmission electron microscopy based on their electron densities, shapes, and subcellular distributions. They are also identified with specific antibodies, since the stored proteins are different among them. Our IEM studies, however, demonstrated that PbCTRP was localized to almost every vesicular organelle of the ookinete (Fig. 4A and B). Therefore, we concluded that the ookinete has only one type secretory organelle, the microneme. Since rhoptries and dense granules are thought to participate in the formation and remodeling of parasitophorous vacuoles, respectively [1], this observation
70
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
is consistent with the fact that ookinetes do not reside in the host cells but only pass through them. On the contrary, PbWARP appears to preferentially exist in the high electron dense micronemes (Fig. 4C and D). Therefore, it is possible that the soluble content and the role in ookinete invasion differ among micronemes. PbWARP has orthologues in the human malarial parasites, P. falciparum and P. 6i6ax. Comparison of deduced amino acid sequences of PbWARP and its orthologues revealed significant conservation of the primary structure. Because they are phylogenetically distant Plasmodium species [17,18], it is assumed that the common invasion mechanism in which PbWARP orthologues participate may widely exist throughout the Plasmodium parasites. At this point, it is most likely that PbWARP plays a role as a soluble adhesive protein connecting the mosquito midgut and parasite surface. High-order oligomer formation observed in vitro would be advantageous for such adhesion, because the multimeric structure would enhance binding potency of PbWARP by increasing binding sites per molecule and enable it to form networks with the molecules on the midgut cell and parasite surface. Furthermore, it is possible that PbWARP plays a role as a ‘foothold’ for the ookinete invasion and is involved in its motility through the host cell. Because PbCTRP is thought to be essential for active invasion of the ookinete, interaction between multimerized PbWARP
and PbCTRP might be present in the midgut-invading ookinete. In order to obtain further evidence for these hypotheses, an IEM study of the midgut-invading ookinete and targeting disruption studies of the PbWARP gene are currently under way.
Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research on Priority Areas (08281103) to Y.C., for Scientific Research (B) (12470060) to M.Y. (12557026) to T.T., (12670232) to M.T., and for Exploratory Research (10877043, 11877043 and 12877042) to Y.C. from the Ministry of Education, Science, Culture and Sports. This was also supported by a grant from the Research for the Future Program from the Japan Society for the Promotion of Science to Y.C. and a Grant for Research on Emerging and Re-emerging Infectious Diseases (H12-Shinkou-17), Ministry of Health and Welfare, Japan to M.T. Preliminary sequence data for P. falciparum chromosome 11 were obtained from The Insitute for Genomic Research website (www.tigr.org). Sequencing of chromosome 11 was part of the International Malaria Genome Sequencing Project and was supported by award from the National Institute of Allergy and Infectious Diseases, National Institutes of Health. Sequence data for P. 6i6ax was
Fig. 3. Native and recombinant PbWARP forms SDS-resistant but reducing agent-sensitive oligomers. (A) Western blot analysis of native PbWARP under different reducing conditions. Parasites were cultured for 23 h in vitro after fertilization, purified by erythrocyte lysis, and lysed in SDS-PAGE sample buffer containing mercaptoetanol in final concentrations as indicated under each lane. Samples ( 106 ookinetes per lane) were separated on a 5 – 20% gradient gel and stained using antibodies against PbWARP and then alkaliphosphatase-conjugated second antibodies. Non-specific bands of proteins that cross-react with the second antibodies are indicated by an arrowhead. (B) Western blot analysis of recombinant PbWARP under different reducing conditions. Recombinant PbWARP was produced in a baculovirus system and secreted into culture medium. Ten microliters of the medium were mixed with the same volume of SDS-PAGE sample buffer (containing mercaptoetanol in final concentrations, as indicated under each lane) and analyzed. Bands of putative monomers, dimers, and trimers are indicated by arrows at the right side. Western blot analysis was performed in the same conditions as above but after separation on a 10% constant gel under non-reducing conditions.
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
71
Fig. 4. Immuno-electron microscopy of P. berghei ookinetes. Ookinetes were cultured for 20 h after fertilization. After embedding in LR white, longitudinal sections (A, C) and cross-sections (B, D) were stained with the first antibodies indicated above and then goat anti-rabbit IgG conjugated with gold particles (15 nm). These results show that PbCTRP (A, B) and PbWARP (C, D) are localized differently in the microneme. Bars: 0.5 mm.
obtained from the University of Florida Gene Sequence Tag Project Website at: http://parasite.vetmed.ufl.edu. Funding for P. 6i6ax data was provided by the National Institute of Allergy and Infectious Diseases.
[7]
[8]
References [1] Dubremetz JF, Garcia-Reguet N, Conseil V, Fourmaux MN. Apical organelles and host-cell invasion by Apicomplexa. Int J Parasitol 1998;28:1007 –13. [2] Naitza S, Spano F, Robson KJ, Crisanti A. The thrombospondin-related protein family of apicomplexan parasites: the gears of the cell invasion machinery. Parasitol Today 1998;14:479 – 84. [3] Sultan AA, Thathy V, Frevert U, Robson KJ, Crisanti A, Nussenzweig V, Nussenzweig RS. TRAP is necessary for gliding motility and infectivity of plasmodium sporozoites. Cell 1997;90:511 – 22. [4] Yuda M, Sawai T, Chinzei Y. Structure and expression of an adhesive protein-like molecule of mosquito-invasive stage malarial parasite. J Exp Med 1999;189:1947 – 52. [5] Eschenbacher KH, Klein H, Sommer I, Meyer HE, Entzeroth R, Mehlhorn H, Ruger W. Characterization of cDNA clones encoding a major microneme antigen of Sarcocystis muris (Apicomplexa) cyst merozoites. Mol Biochem Parasitol 1993;62(1):27 – 36. [6] Fourmaux MN, Achbarou A, Mercereau-Puijalon O, Biderre C, Briche I, Loyens A, Odberg-Ferragut C, Camus C, Dubremetz JF. The MIC1 microneme protein of Toxoplasma
[9]
[10]
[11]
[12]
[13]
[14]
gondii contains a duplicated receptor-like domain and binds to host cell surface. Mol Biochem Parasitol 1996;83(2):201 –10. Tomley FM, Bumstead JM, Billington KJ, Dunn PP. Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol Biochem Parasitol 1996;79(2):195 –206. Langer RC, Hayward RE, Tsuboi T, Tachibana M, Torii M, Vinetz JF. Micronemal transport of plasmodium ookinete chitinases to the electron-dense area of the apical complex for extracellular secretion. Infect Immun 2000;68:6461 – 5. Shahabuddin M, Toyoshima T, Aikawa M, Kaslow DC. Transmission-blocking activity of a chitinase inhibitor and activation of malarial parasite chitinase by mosquito protease. Proc Natl Acad Sci USA 1993;90(9):4266 – 70. Colombatti A, Bonaldo P, Dolian R. Type A modules: interacting domains found in several non-fibrillar collagens and in other extracellular matrix proteins. Matrix 1993;13(4):297 –306. Lee JO, Rieu P, Arnaout MA, Liddington R. Crystal structure of the A domain from the alpha subunit of integrin CR3 (CD11b/CD18). Cell 1995;80(4):631 – 8. Yuda M, Sakaida H, Chinzei Y. Targeted disruption of the Plasmodium berghei CTRP gene reveals its essential role in malaria infection of the vector mosquito. J Exp Med 1999;190(11):1711 – 6. Tsuboi T, Kaslow DC, Gozar MMG, Tachibana M, Cao YM, Torii M. Sequence polymorphism in two novel Plasmodium 6i6ax ookinete surface proteins, Pvs25 and Pvs28, that are malaria transmission-blocking vaccine candidates. Mol Med 1998;4:772 – 82. Torii M, Adams JH, Miller LH, Aikawa M. Release of merozoite dense granules during erythrocyte invasion by Plasmodium knowlesi. Infect Immun 1989;57(10):3230 – 3.
72
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
[15] Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 1997;10(1):1 –6. [16] Hofmann K, Stoffel W. Tmbase. A database of membrane spanning proteins segments. Biol Chem Hoppe-Seyler 1993;347:166.
.
[17] Escalante AA, Ayala FJ. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences. Proc Natl Acad Sci USA 1994;91(24):11373 – 7. [18] Escalante AA, Barrio E, Ayala FJ. Evolutionary origin of human and primate malarias: evidence from the circumsporozoite protein gene. Mol Biol Evol 1995;12(4):616 – 26.
von Willebrand Factor A Domain-related Protein, a novel microneme protein of the malaria ookinete highly conserved throughout Plasmodium parasites Masao Yuda a,*, Kazuhiko Yano a, Takafumi Tsuboi b, Motomi Torii b, Yasuo Chinzei a b
a Department of Medical Zoology, Mie Uni6ersity School of Medicine, Edobashi, Tsu, 514 -0001, Japan Department of Molecular Parasitology, Ehime Uni6ersity School of Medicine, Shigenobu, Ehime 791 -0295, Japan
Received 6 December 2000; received in revised form 9 May 2001; accepted 14 May 2001
Abstract The mosquito-invasive form of the malarial parasite, the ookinete, develops numerous secretory organelles, called micronemes, in the apical cytoplasm. Micronemal proteins are thought to be secreted during midgut invasion and to play a crucial role in attachment and motility of the ookinete. We found a novel ookinete micronemal protein of rodent malarial parasite Plasmodium berghei, named P. berghei von Willebrand factor A domain-related protein (PbWARP), and report it here as a putative soluble adhesive protein of the ookinete. The PbWARP gene contained a single open reading frame encoding a putative secretory protein of 303 amino acids, with a von Willebrand factor type A module-like domain as a main component. Western blot analysis demonstrated that PbWARP was firstly produced 12 h after fertilization by maturing ookinetes as SDS-resistant complexes. Recombinant PbWARP produced with a baculovirus system also formed SDS-resistant high-order oligomers. Immuno-electron microscopic studies showed that PbWARP was randomly distributed in the micronemes. PbWARP homologues also exist in human malarial parasites, Plasmodium falciparum and Plasmodium 6i6ax. Highly conserved primary structures of PbWARP homologues among these phylogenetically distant Plasmodium species suggest their functional significance and the presence of a common invasion mechanism widely utilized throughout Plasmodium parasites. © 2001 Elsevier Science B.V. All rights reserved. Keywords: Malaria; Plasmodium berghei; Ookinete; von Willebrand Factor A Domain– related Protein
1. Introduction Micronemes are membrane-bound secretory organelles commonly observed in all host-invasive forms of apicomplexan parasites. These invasive parasites store molecules critical for their adhesion and invasive locomotion in the micronemes and secrete them from the apex (or present them on the apical surface) during Abbre6iations: CTRP, circum sporozoite protein and TRAP-related protein; IEM, immuno-electron microscopy; TRAP, thrombospondin-related adhesive protein. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBank™ data base with the accession numbers AF364867 and AB051630. * Corresponding author. Tel.: +81-59-231-5013; fax: + 81-59-2315215. E-mail address: [email protected] (M. Yuda).
host-cell invasion [1]. Malarial parasites are fertilized in the midgut lumen of the mosquito vector and develop into a motile form, the ookinete. Ookinetes invade into the midgut epithelial cells, pass through them, and arrive at the basal lamina (basement membrane), where they develop into oocysts. Micronemal proteins of apicomplexan parasites reported so far include soluble proteins and transmembrane proteins. The transmembrane proteins have single transmembrane domains and usually have a large extracellular region and a short cytoplasmic tail. Some of them belong to a distinct protein family, the thrombospondin-related protein family, members of which have been widely reported in the apicomplexan parasites [2]. These proteins are thought to be necessary for creating invasive locomotion of the parasites and consequently essential for their infection of the host cell [3,4].
0166-6851/01/$ - see front matter © 2001 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 6 8 5 1 ( 0 1 ) 0 0 3 0 4 - 8
66
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
Soluble microneme proteins have mainly been reported in coccidian parasites [5– 7]. It seems that a variety of soluble proteins exist in the microneme. The function of many of these soluble microneme proteins remains unclear, but they are also thought to be involved in parasite invasion of the host cell. In the malarial ookinete, chitinase is the only soluble protein that has been reported to exist in the microneme [8]. It is secreted by ookinetes and necessary for their passage through the peritrophic membrane of the mosquito [9]. In this paper, we report a novel soluble micronemal protein with an adhesive protein-related structure that is produced by the ookinete. This protein is mainly composed of a von Willebrand factor type A module-like domain (A domain) that is known to participate in cell–cell interactions, cell– matrix interactions, and matrix formation in several proteins including von Willebrand factor, the alpha chains of integrins, and some types of collagen [10,11]. We hypothesize that this protein acts as an adhesive substrate connecting ookinete surface and midgut molecules during ookinete midgut invasion. In addition, we performed immuno-electron microscopy (IEM) studies and compared its distribution with that of P. berghei circumsporozoite protein and TRAP-related protein (PbCTRP), a micronemal transmembrane protein that belongs to the thrombospondin-related protein family of the apicomplexan parasites [12].
genomic DNA sequence that seems to encode an A domain of an unreported P. falciparum protein was obtained. Degenerate primers (5%-CCAGGAGATTATTGYGAYAAYTAYTAYGA-3% and 5%-TAATACAGCAACYTTNGGNGCRTC) were designed based on deduced amino acid sequences (PGDYCSNYYD and DAPKVAVL) and PCR (30 cycle, annealing conditions, 46 °C, 1min) was performed using P. berghei ookinete cDNA as a template. Remaining 5% and 3% portions were separately amplified by anchor-PCR using P. berghei ookinete cDNA plasmid library as a template with primer sets of a cDNA specific primer and a vector specific primer. Primer sets used for 5% portion and 3% portion amplification were 5%-A-TCACTTCTTGTACCCTCTCCG-3% (cDNA-specific primer) and 5%-TAATACGACTCACTATAGGG-3% (vector-specific primer), 5%-GATTATTGGATGAA-GGGAACAATCCC-3% (cDNA-specific primer) and 5%-GATTTAGGTGACACTATAG-3% (vector-specific primer), respectively. PbWARP gene containing a full-length open reading frame was amplified by PCR using P. berghei genomic DNA as a template with specific primers for 5%- and 3%-untranslated regions of PbWARP cDNA (5%GGGTCGACTTAAAGCTTTCCTCACCCAC-3% and 5%-GGGCGGCCGCTATGTTTCGGTTTCTAATAA GGC-3%).
2.3. Southern blot analysis 2. Methods
2.1. Ookinete culture Balb/c mice infected with Plasmodium berghei ANKA strain were prepared by peritoneal injection of infected blood that had been stored at −70 °C. Infected mice were used within one blood passage for ookinete culture as described previously [4]. Parasites were purified by erythrocyte lysis in 0.83% NH4Cl and used for further analysis.
2.2. Cloning and determination of the primary structure of PbWARP Poly(A)+ RNA was extracted using a microprep mRNA purification kit (Amersham Pharmacia Biotech) from P. berghei ookinetes cultured for 23 h in vitro after fertilization. cDNA synthesis and plasmid library construction were performed using the Superscript™ Plasmid System (GIBCO BRL) according to the manufacturer’s instructions. The PbCTRP amino acid sequence was used for a TBLAST search on preliminary sequence data for Plasmodium falciparum chromosome 11 (The Insitute for Genomic Research website (www.tigr.org)). A partial
Southern blot analysis was performed in essentially the same procedure as described [4]. Partial DNA fragments of PbWARP were amplified by PCR using subcloned PbWARP genomic DNA as a template with the primer pair, 5%-ATGAAGAGTGTTAAAGGAATA-AC-3% and 5%-AATGGGATTGTTCCCTTCATCC-3%, labeled with [32P] dCTP, and used as a hybridization probe.
2.4. P6WARP and PfWARP DNA sequences Partial sequence data of Plasmodium 6i6ax WARP gene were obtained from the University of Florida Gene Sequence Tag Project Website at http://parasite.vetmed.ufl.edu by a TBLAST search. Full-length PvWARP DNA sequence was obtained by anchor PCR using a P. 6i6ax genomic DNA splinkerette library as template with primer sets of a PvWARP specific primer and a splinkerette specific primer [13]. PvWARP-specific primers used for 5% portion and 3% portion amplification were 5%-CCGAAAGTTGTAGTCCTGTT-3% and 5%-CCCACTATCACCAGTTTGAC-3%, respectively. The splinkerette specific primer is 5%-TCGTACGAGAATCGCTGTCCTCTCC-3%. Sequence data of P. falciparum WARP gene were obtained from The Sanger Centre website at http://www.sanger.ac.uk/Projects/P – falciparum/.
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
2.5 Re6erse transcriptase-PCR (RT-PCR ) mRNA extraction and cDNA synthesis for RT-PCR were carried out in the same procedure as described above. PCR (22 cycle) was performed using cDNA synthesized from 1 ng of mRNA as template. Specific primer pairs used for amplification of Pbs21, PbCTRP, and PbWARP cDNA were 5%-TGTAGACACGATATGTAAAGGTGG-3% and 5%-AACTGCTATTTGATGGCGTTTCGC-3%, 5%-CTGCTTGTGTACCTCCC-3% and 5%-CGCACACGCATATGAGC-3%, and 5%-ACAC TTGATGACGCGGG-3% and 5%-TTTATTATATAACATGTTTTTTAGTTTTCGGGC-3%, respectively.
67
Western blot analysis was performed by essentially the same procedure as described previously [4].
2.8. Immunocytochemistry Immunofluorecence microscopy analysis of the ookinete was performed using anti-peptide antibodies against the C-terminal region of PbWARP by essentially the same procedure as described previously [4]. Immuno-electron microscopy analysis was performed by essentially the same procedure as described previously [14].
2.6. Recombinant PbWARP
3. Results
Recombinant PbWARP was produced by a baculovirus–insect cell system by essentially the same procedure as described previously [12]. A DNA fragment containing the full open reading frame was amplified by PCR using subcloned PbWARP genomic DNA as a template with the primer pair, 5%-AAGGATCCAA ATATATAATGAAGAGTGTTAAAGG-3% and 5%-AA GGATCCTAGTGATGGTGATGGTG, and subcloned into the BamHI site of baculovirus-transfer vector, pAcYM1. Recombinant virus was obtained by co-transfection of Sf9 cells with this construct and BaculoGold DNA (Pharmingen). The virus obtained was cloned by plaque assay, amplified, and infected to Tn5 cells for overexpression of the recombinant protein. Production of recombinant PbWARP in E. coli (DH5a) was performed by essentially the same procedure as described previously [4]. A DNA fragment encoding PbWARP without the signal peptide was amplified by PCR using subcloned PbWARP genomic DNA as a template with the primer pair, 5%-AAGGATCCCAAAAGGTTAATGTTGTTTCAC-3% and 5%-TTCTCGAGTCAATCACTTCTTGTACCCTCTC CG-3%, and subcloned into a expression plasmid, pGEX6P-1 (Amersham Pharmasia Biotech) using the unique restriction site, BamHI/XhoI. Recombinant PbWARP was produced as GST-fusion protein and affinity-purified on glutathione sepharose (Amersham Pharmasia Biotech). Fused GST was separated according to the manufacturer’s instructions.
3.1. Structure of PbWARP Sequencing of a partial cDNA fragment isolated by degenerate PCR and the remaining 3% and 5% ends of the cDNA obtained by anchor PCR revealed that this cDNA contains an open reading frame encoding a putative 303-amino-acid protein with a calculated molecular mass of 33.7 kDa (Fig. 1). The analysis of the primary structure by Signal P [15] and TMpred [16] indicates that it has a secretory protein-like structure with a 22-amino-acid signal sequence and is composed of a short N-terminal region followed by a von Willebrand factor type A module-like domain (A domain). Therefore, we named this protein P. berghei von Willebrand Factor A Domain-related Protein (PbWARP). The PbWARP A domain exhibited 34% and 20% amino acid sequence identity and 52% and 40% similarity to the fourth A domain of PbCTRP and PbTRAP A domain, respectively. A putative metal ion-dependent adhesion site motif (11) was partially conserved (Fig. 1, boxed). Comparison of the nucleotide sequence of PbWARP cDNA and genomic DNA sequence showed that PbWARP gene had no introns. Southern blot analysis showed that it was a single copy gene (data not shown). We investigated PbWARP homologues in medically important human malaria species, P. falciparum and P. 6i6ax. They show significant sequence identities, especially in the A domains. The overall sequence identities of the PbWARP to PvWARP and PfWARP are 66.2% and 61.0%, respectively.
2.7. Antibody preparations and Western blot analysis 3.2. PbWARP is produced by the ookinete A peptide corresponding to C-terminal amino acid residues 285–303 of PbWARP was synthesized. It was conjugated to carrier protein, keyhole limpet hemocyanin, and used for immunization of rabbits. Specific antibodies were purified from the rabbit anti-serum using High Trap column (Amersham Pharmasia Biotech) linked with the peptide.
Western blot analysis showed that PbWARP was absent in the blood-stage parasites containing both sexual and asexual stages (Fig. 2A, 0 h) and firstly appeared 12 h after fertilization, when most zygotes have just exhibited an elongated shape (Fig. 2A). Under non-reducing conditions, PbWARP was detected as
68
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
multiple bands. The apparent sizes of the detected proteins were obviously higher than that estimated from the amino acid sequence of PbWARP. As shown below, this suggests that PbWARP forms SDS-resistant complexes. RT-PCR demonstrated that the PbWARP transcript was present after fertilization (Fig. 2B, 19 h) but not in the blood stage (0 h) (Fig. 2B). Immunofluorecence microscopy showed that PbWARP was present mainly in the anterior cytoplasm of the mature ookinetes (Fig. 2C). This distribution and the ‘patchy appearance’ of the signals strongly indicated that it was localized in the micronemes.
proteins were composed of PbWARP monomers linked with disulfide bonds. Doublet band patterns might be due to different quaternary structures of the oligomers The monomer size of native PbWARP (30 kDa) indicates that part of the N-terminal region has been processed after targeting to the micronemes, since recombinant PbWARP produced by E. coli was detected at 37 kDa on SDS-PAGE under reducing conditions (data not shown).
3.4. PbWARP and PbCTRP distribution in the microneme
3.3. PbWARP forms SDS-resistant oligomers Fig. 3A shows Western blot analysis of native PbWARP under different reducing conditions. When not reduced, doublet protein bands were detected at 120/ 135 kDa, 75/82 kDa, and 60/66 kDa (Fig. 3A, lane 1). By weak reduction, smaller protein bands were enhanced (Fig. 3A, lane 2). By strong reduction, only monomers were detected mainly at 30 kDa (Fig. 3A, lane 3). Fig. 3B shows Western blot analysis of PbWARP produced in the baculovirus– insect cell system. Oligomer formation and a doublet band pattern were also observed in the recombinant proteins. Monomers were detected mainly at 37 kDa. We suppose that these complexes observed in both native and recombinant
In order to investigate subcellular localization of PbWARP, we performed IEM studies of the P. berghei ookinete cultured in vitro. In addition, we performed IEM studies with antibodies against PbCTRP and compared distribution of these ookinete proteins. As shown in Fig. 4A and B, PbCTRP was observed in all the micronemes and appeared to be peripherally distributed in each microneme. However, PbWARP was observed mainly in the high electron dense micronemes and showed random distribution in the microneme body (Fig. 4C and D). The peripheral distribution of CTRP was also observed in P. gallinacium ookinetes using antibodies against PbCTRP that cross-react with PgCTRP (unpublished data).
Fig. 1. Nucleic acid sequence of PbWARP cDNA and the predicted amino acid sequence. The predicted signal sequence is boxed with dotted lines. The amino acid sequence corresponding to the A domain is underlined. Cysteine residues are circled. Conserved amino acids of metal ion-dependent adhesion site motif are boxed. Two alternative polyadenylation sites are indicated by arrowheads.
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
69
Fig. 2. Expression profile of PbWARP gene. (A) Production of PbWARP by maturing ookinetes. Parasites were fertilized in vitro, cultured for ookinete maturation, and collected at the time intervals indicated under each lane. They were purified by erythrocyte lysis and lysed in SDS-PAGE sample buffer. Samples ( 106 ookinetes per lane) were separated on a 5 – 20% gradient gel under non-reducing conditions, blotted onto a nitrocellulose membrane, and stained using antibodies against PbWARP and then alkaliphosphatase-conjugated second antibodies. (B) Induction of PbWARP mRNA after fertilization. Poly(A)+ RNAs were extracted from the blood stage parasites (0 h) or the same parasites cultured for 19 h in vitro after fertilization (19 h). RT-PCR was performed using primers for Pbs21, PbCTRP, and PbWARP, as indicated. The mRNA of Pbs21, a surface protein of the P. berghei ookinetes, has been reported to be present both before and after fertilization. That of PbCTRP, a microneme protein, has been reported to be induced after fertilization [4]. (C) Immunofluorescence microscope of the mature ookinete. Parasites were cultured for 23 h after fertilization and purified by erythrocyte lysis. Purified parasites were fixed in acetone for 1 min and stained using antibodies against PbWARP and then FITC-conjugated second antibodies. Arrowheads indicate the apical ends of the ookinetes.
4. Discussion We report here the structure and some characteristics of a novel ookinete protein, PbWARP. PbWARP has a secretory protein-like structure and contains a putative adhesive domain, related to the von Willebrand factor A domain, as its main component. It is firstly produced by the maturing ookinete and localized in the micronemes of the mature ookinete. Distinct suborganellar distribution patterns of PbWARP and PbCTRP indicate that PbCTRP is associated with the microneme membrane, while PbWARP is stored as a soluble protein in the microneme. Since PbCTRP has a transmembrane protein-like structure [4], this observation reflects a structural difference between the two proteins. Presumably, CTRP is associated with the microneme membrane via its transmembrane-like region and then presented on the parasite surface during
parasite invasion into the midgut. However, PbWARP may exist as a soluble micronemal protein and be secreted from the parasite apex. It is known that invasive stage apicomplexan parasites typically have distinct secretory organelles, micronemes, rhoptries, and dense granules that can be distinguished from each other under transmission electron microscopy based on their electron densities, shapes, and subcellular distributions. They are also identified with specific antibodies, since the stored proteins are different among them. Our IEM studies, however, demonstrated that PbCTRP was localized to almost every vesicular organelle of the ookinete (Fig. 4A and B). Therefore, we concluded that the ookinete has only one type secretory organelle, the microneme. Since rhoptries and dense granules are thought to participate in the formation and remodeling of parasitophorous vacuoles, respectively [1], this observation
70
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
is consistent with the fact that ookinetes do not reside in the host cells but only pass through them. On the contrary, PbWARP appears to preferentially exist in the high electron dense micronemes (Fig. 4C and D). Therefore, it is possible that the soluble content and the role in ookinete invasion differ among micronemes. PbWARP has orthologues in the human malarial parasites, P. falciparum and P. 6i6ax. Comparison of deduced amino acid sequences of PbWARP and its orthologues revealed significant conservation of the primary structure. Because they are phylogenetically distant Plasmodium species [17,18], it is assumed that the common invasion mechanism in which PbWARP orthologues participate may widely exist throughout the Plasmodium parasites. At this point, it is most likely that PbWARP plays a role as a soluble adhesive protein connecting the mosquito midgut and parasite surface. High-order oligomer formation observed in vitro would be advantageous for such adhesion, because the multimeric structure would enhance binding potency of PbWARP by increasing binding sites per molecule and enable it to form networks with the molecules on the midgut cell and parasite surface. Furthermore, it is possible that PbWARP plays a role as a ‘foothold’ for the ookinete invasion and is involved in its motility through the host cell. Because PbCTRP is thought to be essential for active invasion of the ookinete, interaction between multimerized PbWARP
and PbCTRP might be present in the midgut-invading ookinete. In order to obtain further evidence for these hypotheses, an IEM study of the midgut-invading ookinete and targeting disruption studies of the PbWARP gene are currently under way.
Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research on Priority Areas (08281103) to Y.C., for Scientific Research (B) (12470060) to M.Y. (12557026) to T.T., (12670232) to M.T., and for Exploratory Research (10877043, 11877043 and 12877042) to Y.C. from the Ministry of Education, Science, Culture and Sports. This was also supported by a grant from the Research for the Future Program from the Japan Society for the Promotion of Science to Y.C. and a Grant for Research on Emerging and Re-emerging Infectious Diseases (H12-Shinkou-17), Ministry of Health and Welfare, Japan to M.T. Preliminary sequence data for P. falciparum chromosome 11 were obtained from The Insitute for Genomic Research website (www.tigr.org). Sequencing of chromosome 11 was part of the International Malaria Genome Sequencing Project and was supported by award from the National Institute of Allergy and Infectious Diseases, National Institutes of Health. Sequence data for P. 6i6ax was
Fig. 3. Native and recombinant PbWARP forms SDS-resistant but reducing agent-sensitive oligomers. (A) Western blot analysis of native PbWARP under different reducing conditions. Parasites were cultured for 23 h in vitro after fertilization, purified by erythrocyte lysis, and lysed in SDS-PAGE sample buffer containing mercaptoetanol in final concentrations as indicated under each lane. Samples ( 106 ookinetes per lane) were separated on a 5 – 20% gradient gel and stained using antibodies against PbWARP and then alkaliphosphatase-conjugated second antibodies. Non-specific bands of proteins that cross-react with the second antibodies are indicated by an arrowhead. (B) Western blot analysis of recombinant PbWARP under different reducing conditions. Recombinant PbWARP was produced in a baculovirus system and secreted into culture medium. Ten microliters of the medium were mixed with the same volume of SDS-PAGE sample buffer (containing mercaptoetanol in final concentrations, as indicated under each lane) and analyzed. Bands of putative monomers, dimers, and trimers are indicated by arrows at the right side. Western blot analysis was performed in the same conditions as above but after separation on a 10% constant gel under non-reducing conditions.
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
71
Fig. 4. Immuno-electron microscopy of P. berghei ookinetes. Ookinetes were cultured for 20 h after fertilization. After embedding in LR white, longitudinal sections (A, C) and cross-sections (B, D) were stained with the first antibodies indicated above and then goat anti-rabbit IgG conjugated with gold particles (15 nm). These results show that PbCTRP (A, B) and PbWARP (C, D) are localized differently in the microneme. Bars: 0.5 mm.
obtained from the University of Florida Gene Sequence Tag Project Website at: http://parasite.vetmed.ufl.edu. Funding for P. 6i6ax data was provided by the National Institute of Allergy and Infectious Diseases.
[7]
[8]
References [1] Dubremetz JF, Garcia-Reguet N, Conseil V, Fourmaux MN. Apical organelles and host-cell invasion by Apicomplexa. Int J Parasitol 1998;28:1007 –13. [2] Naitza S, Spano F, Robson KJ, Crisanti A. The thrombospondin-related protein family of apicomplexan parasites: the gears of the cell invasion machinery. Parasitol Today 1998;14:479 – 84. [3] Sultan AA, Thathy V, Frevert U, Robson KJ, Crisanti A, Nussenzweig V, Nussenzweig RS. TRAP is necessary for gliding motility and infectivity of plasmodium sporozoites. Cell 1997;90:511 – 22. [4] Yuda M, Sawai T, Chinzei Y. Structure and expression of an adhesive protein-like molecule of mosquito-invasive stage malarial parasite. J Exp Med 1999;189:1947 – 52. [5] Eschenbacher KH, Klein H, Sommer I, Meyer HE, Entzeroth R, Mehlhorn H, Ruger W. Characterization of cDNA clones encoding a major microneme antigen of Sarcocystis muris (Apicomplexa) cyst merozoites. Mol Biochem Parasitol 1993;62(1):27 – 36. [6] Fourmaux MN, Achbarou A, Mercereau-Puijalon O, Biderre C, Briche I, Loyens A, Odberg-Ferragut C, Camus C, Dubremetz JF. The MIC1 microneme protein of Toxoplasma
[9]
[10]
[11]
[12]
[13]
[14]
gondii contains a duplicated receptor-like domain and binds to host cell surface. Mol Biochem Parasitol 1996;83(2):201 –10. Tomley FM, Bumstead JM, Billington KJ, Dunn PP. Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol Biochem Parasitol 1996;79(2):195 –206. Langer RC, Hayward RE, Tsuboi T, Tachibana M, Torii M, Vinetz JF. Micronemal transport of plasmodium ookinete chitinases to the electron-dense area of the apical complex for extracellular secretion. Infect Immun 2000;68:6461 – 5. Shahabuddin M, Toyoshima T, Aikawa M, Kaslow DC. Transmission-blocking activity of a chitinase inhibitor and activation of malarial parasite chitinase by mosquito protease. Proc Natl Acad Sci USA 1993;90(9):4266 – 70. Colombatti A, Bonaldo P, Dolian R. Type A modules: interacting domains found in several non-fibrillar collagens and in other extracellular matrix proteins. Matrix 1993;13(4):297 –306. Lee JO, Rieu P, Arnaout MA, Liddington R. Crystal structure of the A domain from the alpha subunit of integrin CR3 (CD11b/CD18). Cell 1995;80(4):631 – 8. Yuda M, Sakaida H, Chinzei Y. Targeted disruption of the Plasmodium berghei CTRP gene reveals its essential role in malaria infection of the vector mosquito. J Exp Med 1999;190(11):1711 – 6. Tsuboi T, Kaslow DC, Gozar MMG, Tachibana M, Cao YM, Torii M. Sequence polymorphism in two novel Plasmodium 6i6ax ookinete surface proteins, Pvs25 and Pvs28, that are malaria transmission-blocking vaccine candidates. Mol Med 1998;4:772 – 82. Torii M, Adams JH, Miller LH, Aikawa M. Release of merozoite dense granules during erythrocyte invasion by Plasmodium knowlesi. Infect Immun 1989;57(10):3230 – 3.
72
M. Yuda et al. / Molecular & Biochemical Parasitology 116 (2001) 65–72
[15] Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 1997;10(1):1 –6. [16] Hofmann K, Stoffel W. Tmbase. A database of membrane spanning proteins segments. Biol Chem Hoppe-Seyler 1993;347:166.
.
[17] Escalante AA, Ayala FJ. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences. Proc Natl Acad Sci USA 1994;91(24):11373 – 7. [18] Escalante AA, Barrio E, Ayala FJ. Evolutionary origin of human and primate malarias: evidence from the circumsporozoite protein gene. Mol Biol Evol 1995;12(4):616 – 26.