Polymerase-chain-reaction-based semi-quantification of hepatitis D viraemia in patients treated with high doses of α2b interferon

© INSTITUT PASTEUR/ELsEVIER

Res. Virol.

Paris 1994

1994, 145, 287-295

Polymerase-chain-reaction-based semi-quantification of hepatitis D viraemia in patients treated with high doses of interferon P. Ddny (i)(*), G. Fattovich (2), F. Le Gal (1), G. Giustina (3), C. Lecot (l), G. Morsica H. Poinsot 0), A. Alberti (3), C. Brdchot (4)

(3.4),

(t) Laboratoire de Bactdriologie-Virologie, CHU Avicenne, UFR de Bobigny, Universitd Paris XIII, 93009 Bobigny (France) (2)Istituto di Semeiotica e Nefrologia Medica, Universita di Verona (Italy), ~3)lstituto Medicina Clinica, Clinica Medica lla, Universita di Padova (Italy), and (4) INSERM U.370, Service d'Hdpatologie, CHU Necker, Hybridotest-Institut Pasteur, Universitd Paris V, 75015 Paris

SUMMARY

To study the antiviral efficacy of high doses of o2b interferon (a2b-IFN) for chronic hepatitis D treatment, we used polymerase-chain-reaction(PCR)-based semi-quantitative detection of HDV RNA. The semiquantification method used was based on the appearance of a positive amplification signal as a function of the number of PCR cycles. By amplifying dilutions (10-1 _ 10- s) of an HDV-positive woodchuck liver RNA, we confirmed that exponential amplification efficacy occurred at between 20 and 30 cycles. Positive signals were observed from dilution 10- 2 (gel electrophoresis after 20 cycles of PCR) to dilution 10- 7 (hybridization after 30 cycles of PCR). To characterize the HDV RNA level in sera of 8 patients treated with 0~2b-IFN (10 MU/3 times a week) for 1 year, we extracted RNA from serum samples taken every 6 months. All samples were amplified in parallel for 20 and 30 PCR cycles. Analysis of HDV cDNA after ethidium bromide/agarose gel electrophoresis and after molecular hybridization (100 times more sensitive than gel analysis), enabled us to grade the signals observed from negative to positive as 1 +, 2 +, 3 + and 4 +, with all results being positive. Three types of evolution of HDV viraemia were evidenced among the 8 treated patients. HDV replication continued to occur at a high level at the 6th and 12th month in 2 patient sera. For 2 other patients, an HDV RNA decrease or disappearance was evidenced in the serum at the 6th month; however, viral replication recurred at a higher level at the 12th month. Finally, the HDV genome was no longer detected during therapy in the final 4 patients. These results were compared to clinical and biological data. The level of alanine aminotransferase (ALAT) paralleled HDV RNA gradation in 15 samples from 5 patients. However, in 2 patients, HDV-RNA was negative at the 6th month, before the normalization of ALAT. In the serum of another patient, HDV RNA was still detected when the ALAT level was normal.

Submitted November 19, 1993, accepted May 4, 1994. (*) Correspondingauthor.

288

P. D E N Y E T AL.

This study shows the usefulness of HDV PCR in appreciating the potential benefRs of a2b-IFN during chronic hepatitis 0 infection. However, long-term improvement was present in only one patient in whom a negative HDV PCR result was associated with loss of HBs-Ag. This simple approach uses complementary results of only two PCR experiments and quickly provides information on the level of HDV viraemia.

Key-words: Hepatitis, HDV, Delta virus, Viraemia, Interferon; Therapy, c¢2b-IFN, Quantification, PCR.

INTRODUCTION Hepatitis D virus (HDV) is a defective virus involved in fulminant, acute and chronic hepatitis in man, in association with hepatitis B virus (HBV). Alpha-interferon (IF'N) has been used to treat patients with chronic hepatitis D (Hoofuagle et al., 1985; Rosina et al., 1985; Farci et al., 1990; Di Bisceglie e t al., 1990; Hadziannis, 1991 ; Cariani et al., 1991 ; Gaudin and Tr6po, 1993). However, only half of the patients show improvement during IFN therapy. Furthermore, most responders relapse when therapy is discontinued. Thus, there is a need for new therapeutic approaches, and long-term high doses of ¢t2bIFN are therefore proposed. In this view, sensitive methods to follow HDV viraemia during antiviral therapy also need to be developed. HDV RNA detection using eDNA or riboprobe hybridization has been extensively performed after cloning of different isolates. Serum HDV RNA detection reflects viral replication, since it correlates with the presence of HD-Ag in the liver in 69 to 100% of eases (Smedile et al., 1986; Rashoffer et al., 1988). A persistent positive test for serum HDV RNA is associated with liver damage and a poor outcome (Wu e t al., 1990). The usefulness of the polymerase chain reaction (PCR) has been demonstrated to detect the I-IDV genome (Zignego et al., 1990). Further-

ALAT EDTA I-IBs-Ag HBV HD-Ag HDV

= = = = = =

alanine aminou'ansferase.

ethylene diamine tetraacetic acid. hepatitis hepatitis hepatitis hepatitis

B B D D

surface antigen. virus. antigen. virus.

more, among infected individuals and during experimental transmission, conserved regions of the genome are highly stable (Wang et al., 1986; Kuo et al., 1988; D6ny et aL, 1991; Kos et al., 1991 ; Lee e t al., 1992), making successive experiments possible in a patient. Recently, PCR has been demonstrated to be useful in following IFN treatment (Cariani et al., 1992). However, semi-quantification of HDV genomes might better reflect the efficacy of the therapy. We developed a simple PCR-based semi-quantitative approach to follow HDV viraemia during an ¢t2b-IFN high-dose treatment. Sequential serum samples were studied in parallel. The semi-quantitative quotation was easily obtained using only two different numbers of PCR cycles. This approach was sustained by the evidence of a relationship between the number of molecules present at the beginning of the PCR and the kinetics of the PCR reaction during the exponential amplification phase, as demonstrated for I-IBV DNA (Larzul et al., I988).

MATERIALS

AND METHODS

Patients

Eight patients infected with HDV were treated with 10 MU o~2b-IFN three times a week for

cO.b-WN = MoMLV-MU = PCR = SDS =

alpha-2b interferon. Moloney murine leukaemia virus. millions o f units. polymerase chain reaction. sodium dodecyl sulphate.

INTERFERON, HEPATITIS D VIRAEMIA A N D P C R - B A S E D A S S A Y

12 months (7 patients) or 6 months (I patien0. Clinical, histological and biological data are summarized in table I. Two to four successive serum samples were obtained from each patient every six months from 1989 to 1990 and kept frozen in aliquots at -80°C.

HDV PCR PCR was conducted as previously described (Zignego et al., 1990) and samples were processed blindly with respect to clinical data. Prodcedures to avoid carry-over were observed (Kwok and Higushi, 1989). In brief, RNA was extracted from 100 Ixl of serum, diluted 1/6 in I0 mM Tris-HC1 pH 7.5, I0 mM EDTA pH 8, 1% SDS, 10 mM NaCI and

Table I. Evaluation of ALAT and HDV RNA semiquantification in 8 patients treated with 10 MU of a2b-IFN three times a week for 12 months. Patient number (age in years)

Time HDV RNA of ALAT semiHistosam(n.v. quantiSex logy piing (*) < 50) fication

1

(30)

M

CAH

2

(23)

M

CAH

3

(31)

M Cirrhosis

4

(39)

M Cirrhosis

5

(23)

M

CAH

6

(24)

M

CPH

7

(31)

F Cirrhosis

8(**)(30)

M

CAH

0 6 12 0 6 12 0 6 12 0 6 12 0 6 12 0 6 12 15 0 6 12 0 6

452 45 65 163 167 31 296 60 83 184 201 231 477 188 128 202 311 26 23 101 35 60 190 40

4+ 0 3+ 4+ 4+ 3+ 3+ 1+ 2+ 3+ 3+ 0 4+ 3+ 3+ 2+ 0 0 0 1+ 0 0 3+ 0

(*) 0 = pretreatment; 6 = 6th month; 12 = 12th month. (**) This patient was treated for only 6 months. C A H = chronic active hepatitis ; CPH = chronic persistent hepatitis.

289

200 ttg/ml proteinase K (Boehringer Mannheim), then digested for 2 h at 55°C. Tris-saturated phenol extraction was followed by chloroform-isoamylalcohol extraction and the extracted nucleic acid was precipitated in ethanol and Na acetate pH 5.2 (0.25 M). After centrifugation and a 70 % cold ethanol wash, the RNA pellet was suspended in 100 lxl cold water treated with DEPC (diethyl-pyrocarbonate). Each RNA extraction included an HDV-negative serum and water as negative controls. HDV eDNA was p r e p a r e d using M o M L V reverse transcriptase (Bethesda Research Laboratories). Serum RNA (2 Ixl) was heat-denatured with the anti-sense primer 6A (ACCCCCTCGA_AGGTGGATCGA) (Dtny et al., 1993) (2 lxl, 50 pmoles) and with 8 ~tl of 2.5 mM dNTP. After boiling for 5 rain, samples were frozen in ethanol (-70°C). The eDNA mix (20 U RNAguard, Pharmacia, 4 ~tl of 5X reverse transcriptase buffer and 100 U of MoMLV) was added and the eDNA reaction was conducted in 20 ttl for 45 rain at 42°C, then 5 rain at 94°C. Eighty ~tl of the PCR mix were added (PCR mix : 8 lxl of 10 x PCR buffer II (Cetus), 1.5 mM MgC12, 2 ~tl (50 pmoles) of the sense primer 6S (GAGGAAAGAAGGACGCGAGACGCAA) and 1.5 U of Taq p o l y m e r a s e (Perkins Elmer/Cetus). The PCR was conducted for 20 and 30 cycles during two parallel experiments using a DNA thermal cycler (Perkins Elmer/Cetus) (1 rain at 94°C, 1 rain at 55°C, 1 rain at 72°C). The first and the last 20th or 30th cycles were extended for an extra 4 rain at 94 and 72°C, respectively. All samples were studied by one set of primers (6A-6S). In two patients (patient 1 and 4), results were checked with two other primer sets (2A-5S and 4A4S) (Dtny et aL, 1991).

Analysis of HDV PCR amplification products One-tenth of the amplification products were run on 1.3 % ethidium bromide agarose gel (Sigma) in Tris-borate EDTA and "Polaroid" photography was done. DNA was then transferred to a "GeneScreen P l u s " membrane (Dupont) with alkaline buffer (NaOH 0.4M, NaCI 0.6M). Probe 6 (AACCCGCTTI'ATrCACTGGGGTCGACAACTCTGGGGAGA: nucleotides 945-981) was oligodeoxynucleotide of the genomic strand radiolabelled with 32p-ATP using polynueleotide kinase (Biolabs). Hybridization was conducted in 20% formamide and "Kodak X-OMAT AR" films were exposed for 3, 16 and 72.

Semi-quantification Dilutions of control woodchuck no. 5 liver RNA, kindly provided by Dr. A. Ponzetto, were used to

290

P. D E N Y E T AL.

define the criteria of semiquantification. Total extracted RNA (27 ~tg/ml) was diluted from I0- l to 10- s. Two microlitres of each dilution were submitted to amplification for 10, 20, 30, and 35 cycles. The results confirm that the sensitivity of PCR during the exponential phase depends on the initial RNA concentration. Indeed, we chose 20 and 30 cycles of PCR because (i) during these cycles, good efficacy of amplification was observed, since 10 more cycles gave a 1,000-fold increase in sensitivity; and (ii), a wide range of HDV RNA levels (from dilution 10-2 to dilution 10 -7) could be analysed (table II). For each patient's sample, the equivalent of 2 !11 of serum RNA were reverse-transcribed and amplified for 20 and 30 cycles. Each right size band on ethidium bromide agarose gel or after Southern hybridization was carefully considered. The 16-h autoradiography exposure was useful because results were at least 100 times more sensitive than those observed on the gel. The 72-h exposure verified the negativity of negative controls and samples. These observations led us to combine results of the following analyses: agarose gel electrophoresis after 20 (i) and 30 (ii) cycles of PCR (fig. 1) and Southern hybridization results (16- or 72-h exposure) after 20 (iii) and 30 (iiii) cycles of PCR. The global result assigned a quotation to each sample ranging between 0 (no band visible anywhere), 1 + (with only a positive hybridization result after 30 cycles of PCR), 2+ (as 1, with a band observed in

Table H. Sensitivity of amplification of 2 ~tl of dilutions of HDV-positive woodchuck liver RNA (27 ~tg/ml) after 20 and 30 PCR cycles. The analysis of amplified products was performed after gel electrophoresis and hybridization.

Analysis

Last positive result of dilution HDV genome of woodchuck equivalent liver RNA after before amplification amplification (*)

PCR 20 cycles Gel electrophoresis PCR 20 cycles Hybridization PCR 30 cycles Gel electrophoresis PCR 30 cycles HybridiT~tion

10-2

6.104 - 1.8 x 106

10--4

6.102 - 1.8 x 104

10-5

6.101 - 1.8 x 103

10-7

6.10 -I - 1.8 x 101

(*) Genomeequivalent before amplification was calculated assuming that HI)V genornic RNA represents 0.01% -0.3 % of total woodchuckliverRNA (Negroe t aL, 1989).

the gel after 30 cycles of PCR), 3 + (as 2, with a positive hybridization result after 20 cycles of PCR) and 4+ (all results being positive). According to the results observed for control RNA, a 10-100-fold HDV RNA variation occurred between two levels of semi-quantification.

RESULTS Eight patients with liver disease and chronic H D V infection were selected for the study (table I). All had received high-dose tx2b-IFN therapy. HDV PCR was conducted to appraise the level of viral replication before and during treatment at the 6th and 12th month. All samples were processed blindly with respect to clinical and biological information. Three different types of evolution were evidenced:

1) Inhibition of viral replication during o.2bIFN therapy Disappearance o f H D V R N A in serum was evidenced from the 6th month on for 3 patients (patients number 6, 7 and 8; table I). An additional sample was available for patient number 6 three months after the end of therapy; it remained negative (table I). No evidence of viral replication was observed in the final sample of patient number 4. Pretreatment and 6th-month samples Were both graded 3 +. Results observed for patient number 4 samples were confirmed in other PCR experiments. Indeed, PCR results were reproducible using different sets of primers. Furthermore, to avoid possible inhibition of PCR, serum dilution of the HDV-PCR-negative s a m p l e s was p e r f o r m e d b e f o r e another amplification (Zignego et aL, 1990). Results of such amplifications remained negative.

2) No inhibition of viral replication during ¢x2b-IFN therapy Patients number 2 and 5 had demonstrable H D V R N A during the entire treatment. A high level of viral replication (4+) was observed in both the 1st and 2 nd successive samples (table I). However, the final samples of the two patients

INTERFERON, H E P A T I T I S D VIRAEMIA AND P C R - B A S E D A S S A Y

291

17 345 678 9 1OR

20 cycles

30 cycles Fig. 1. PCR-based semi-quantification of HDV-RNA from IFN-treated patient samples. HDV-RNA was reverse-transcribed and amplified for 20 and 30 PCR cycles. Results were analysed after gel electrophoresis and Southern hybridization. Each band observed among thc,s e four analyses gave a positive grade of 1+. Lane 1 = extraction buffer; lane 2 = RNA extracted from a negative control serum; lanes 3, 4 and 5 = successive samples from patient 1 (respectively, pretreatmeat (4+), 6th month (0) and 12th month (3+); lanes 6, 7 and 8 = sucessive samples from patient 2 (respectively. pretreatment (4+), 6th month (4+) and 12th month (3+); lane 9 = water; lane 10 = weak positive control (dilution of infected woodchuck liver RNA, positive after a longer exposure).

showed a slight decrease in viral replication. In s a m p l e s t a k e n at the 12th m o n t h , no H D V eDNA was observed in the agarose gel after 20 cycles of PCR. However, a band was evidenced after hybridization and results were also positive after 30 cycles o f PCR. This led us to grade these samples as 3+ (patient 2, fig. 1).

3) Transient inhibition of viral replication during c~2b-IFN t h e r a p y Patients number 1 and 3 had unusual evolution. The initial sample s h o w e d intense viral

r e p l i c a t i o n b e f o r e I F N t r e a t m e n t . B u t six months later, partial (patient 3 : 1 +) or complete virological resolution (patient 1: 0, fig. 1) was observed and confirmed by the use o f other sets of primers and with serum dilutions. However, the sample taken at the end o f therapy yielded an increase in viral replication f r o m 0 to 3 + (patient 1) and from 1+ to 2 + (patient 3). In summary, the disappearance o f HDV replic a t i o n was n o t e d in h a l f - t r e a t e d patients. In 2 patients, no major effect o f high doses o f a2bIFN on HDV replication was observed. A relapse was evidenced during the course o f IFN treatment in the final 2 patients.

292

P. D E N Y E T AL.

4) Comparison of HDV RNA level with clinical and biological data Comparison with clinical and biological data was performed after the end of the PCR experiments. Evolution of viral replication under IFN therapy varied between chronic active hepatitis and cirrhosis patients (table D. However, patient 6, with chronic persistent hepatitis, had the best evolution. Alanine aminotransferase (ALAT) levels seemed to parallel HDV RNA in 15 samples from 5 patients (table D. In contrast, discordant results were noted in one of the samples from each of patients 2, 4 and 6. Normalization of transaminases (<50) was observed in the last sample of patient 2, while HDV RNA was graded 3 +. In two other patient's sera (4 and 6), the ALAT level remained high, while HDV RNA was no longer detectable. In subsequent samples from patient 6, normaliTation of ALAT, persistent HDV RNA negativity and loss of HBs-Ag were all evidenced (table D.

DISCUSSION Clinical im[n'ovement in hepatitis D is the aim of interferon treatment. However, antiviral therapy is at its beginnings, and the effect of a drug on viral replication must be specified. This is true even if therapy acts indirectly, as may be the case for interferon. PCR is useful in studying HDV replication under therapy because (i) it can be performed for hepatitis viruses which cannot be isolated in cell culture, (ii) PCR is,more sensitive than conventional hybridization and its usefulness has been demonstrated for I-IDV (Zignego et aL, 1990), and (iii) a quantitative approach is theoretically possible. In fact, followup of interferon treatment has already been performed using the HDV RNA slot test (Farci eta/., 1990, 1994; Di Bisceglie et al., 1990; Smedile et aL, 1996; Rosina et aL, 1987). However, the test does not predict the outcome of the illness under therapy. This might be partly due to its lack of sensitivity. Indeed, most patients who become I-IDV-RNA-negative under a-IFN treatment will relapse at the end of therapy (Farci et aL, 1990, 1994; Di Bisceglie et aL, 1990; Gan-

din et Trtpo, 1993; Rosina et al., 1987, 1991; Marzano et al., 1992). The efficacy of IFN therapy depends on the dose and the duration of treatment. Initial studies showed that 25 to 50% of treated patients seemed to have a good response (Hadziyannis, 1991). Recently, Farci et al., 1994, in a 48-week randomized controlled trial of o~2ainterferon, found that HDV RNA, analysed by conventional hybridization, disappeared in 10 of 14 patients treated with 9 MU, 3 times a week, versus none of the 13 control patients. This result must be interpreted with caution, due to the reappearance of HDV RNA (in some cases without ALAT elevation) after therapy in all patients, and might also reflect the low sensitivity of the hybridization used. A good prognosis is clearly seen in patients in whom disappearance of HBs-Ag was obtained during the course of therapy (Hoofnagle and Di Bisceglie, 1993; Rosina et al., 1993; Lau et al., 1993). In such cases, normalization of transaminases, the absence of detection of HDV RNA in the serum, the disappearance of HD-Ag in the liver and a slight improvement in the Knodell's score were all observed. Under the high-dose treatment used in this study, only patient number 6, with chronic persistent hepatitis (table D, lost I-IBs-Ag. Indeed, only a small number of treated patients show such evolution. This could be due to the fact that most cases of chronic delta hepatitis develop in association With chronic hepatitis B liver disease. In such cases, 90 % of HDV superinfections lead to chronic disease, and around 70 % of patients will develop liver cirrhosis (Rizzetto et aL, 1983, 1992; RizTJetto, 1993). Thus, the duration of chronic infection might reduce the efficacy of the drug. In 5 a m o n g the 8 p a t i e n t s s t u d i e d , we observed matching variations between the level of transaminase under therapy and HDV PCR semi-quantification results (table I). This would seem to agree with the hypothesis that hepatic injury might partly be due to the viral cytopathic effect. On the other hand, in treated patients with chronic delta infections, improvement in hepatitis was associated with the decrease in hepatic inflammatory lesions (Rosina et al., 1991; Kleinert et al., 1993; Farci et al., 1994), and it has recently been suggested that the

INTERFERON, HEPATITIS D VIRAEMIA A N D PCR-BASED A S S A Y

expression of large HDV antigen in chronic hepatitis might induce persistent infection and stimulate the i m m u n o l o g i c a l c y t o t o x i c r e s p o n s e (Gowans and Bonino, 1993; Cole et al., 1993). On the other hand, an in vitro model showed that i n t e r f e r o n did not a f f e c t H D V g e n o m e eDNA transcription and replication, though this model does not resemble natural infection (Ilan et aL, 1993). It might therefore be suspected that a prolonged high dose o f IFN acts more as an immunomodulatory agent than as a direct antiHDV drug in vivo. Furthermore, since HDV is a satellite of I-IBV infection, the action of IFN on HBV itself might block HDV excretion from liver cells, by interfering with HBs-Ag availability to HDV particle formation. Such a hypothesis might explain the apparently discordant results that we observed b e t w e e n a high level o f transaminase and no detectable H D V R N A in the serum. This was evidenced in the 12-month sample from patient number 4, and the 6-month sample from patient 6. Finally, a particular outcome was observed in patient 1 under this high dose o f interferon. A complete response was first observed, but then viral replication and liver cytolysis recurred at a high level under therapy. The emergence o f an HDV-replicating viral population is under investigation, and preliminary data have evidenced mutations in the delta antigen gene (in preparation). Quantification of HDV RNA seems useful for following antiviral treatment. Since long-term treatment is proposed, further studies will specify whether the prognosis of the interferon response is linked to results o f H D V RNA quantification using PCR. In our study and others (Hoofnagle and Di Bisceglie, 1993; Rosina et al., 1993; Lau et al., 1993), long-term i m p r o v e m e n t was associated with a negative HDV PCR result and loss of HBsAg. However, only 1 patient showed such evolution under high-dose therapy. Using only two complementary P e R analyses, we were able to specify the intensity o f viral replication. This approach would also benefit from the use of calibrated internal control RNA to assess PCR reproducible efficacy. Finally, this technique should provide rapid information on the efficacy of antiviral drugs intro-

293

duced to treat HDV chronic hepatitis, and should be useful in monitoring of therapy.

Acknowledgments

We wish to thank M. Scavizzi and P. Tiollais for helpful discussions. We also thank A. Ponzeuo and M.A. Buendia for providing the positive control woodchuck fiver used in this study. This work was supported by the Commission de la Recherche Clinique de l'Assistanee Publique (eontrat n° 183), the DRED and the SNAM-Fonds de Recherche.

DEtection semi-quantitative par P e R de I'ARN du virus de l'htpatite D chez des sujets trait& par des doses ~lev(~es d'interf~ron a2b

Pour ~tudier l'efficacit6 antivirale de hautes doses d'interf~mn tx2b (IFNot2b) darts le traitement de l'htpatite chronique D, nous avons utilis6 un essai semi-quantitatif bas~ sur la PCR (polymerase chain reaction) pour d~tecter I'ARN du VHD (virus de l'hdpatite D). La semi-quantification repose sur l'apparition d'un signal positif en fonction du hombre de cycles de PCR. En amplifiant des dilutions d'un ARN (10-1-10 -8) extrait d'un foie de marmotte infect6 par le VHD, nous avons confirm# une efficacit6 d'amplifieation exponentielle entre 20 et 30 cycles de PeR. Un signal positif a 6t~ observ6 d ~ la dilution 10-2 (analyse en gel d'agarose apr~s 20 cycles de PCR) j u s q u ' a la dilution 10 - 7 (hybridation moltculaire apr~s 30 cycles d'amplifieation). Pour 6tudier le tanx de I'ARN du VHD clans le s~rum de 8 sujets trait~s par l'IFNa2b (30 millions d'unit~s pax semaines pendant 1 an), I'ARN a 6t~ extrait d'~chantillons de s~rums pr~lev~.s tousles 6 mois. Les ~chantillons ont ~t~ amplifies parall~lement pendant 20 et 30 cycles. L'ttude de I'ADN amplifi6 apr~s 61ectrophorb.se en gel d'agarose color6 par le bromurc d'tthidium puis transfert hybridation (I00 fo/s plus sensible que l'analyse en gel) a pennis la graduation des signaux observes de n~gatif A positif I+, 2+, 3+ et 4+ o/I tousles r~sultats sont positifs. Trois types d ' t v o l u t i o n de la v i r t m i e ont 6t6 observts chez les 8 sujets trait~s. Chez deux sujets, la r~plication du VHD est rest~e intense au 6e et au 12c mois. Deux autres ont eu une chute transitoire ou une disparition de I'ARN viral au 6e mois; cependant, la r~plication virale est rtapparue an 12c mois. Enfm, le gtnome du VHD n'a plus ~t~ dttect~ chez les 4 derniers sujets trait&s. Ces r&ultats ont ensuite 6t~ compar& aux d o r m . s

294

P. D E N Y E T AL.

cliniques et biologiques. Une variation simultante du taux de l'alanine aminotransferase (ALAT) et de I'ARN du V I I a 6t6 observte pour 15 6chantillons de 5 sujets. Cependant, pour 2 sujets I'ARN viral a 6t6 ntgatif au 6 e mois, avant la normalisation du taux de I'ALAT. Enfin, duns le s t r u m d ' u n autre sujet, I'ARN du VHD a 6t6 encore dttect6 alors que le taux de I'ALAT &ait normal. Ces rtsultats soulignent l'utilit6 de la PCR-VHD pour suivre l'efficacit6 de l'IFNct2b darts le traitem e n t de l ' h t p a t i t e c h r o n i q u e D. C e p e n d a n t , l'efficacit6 a long terme du traitement associant un rtsultat ntgatif pour la PCR du VHD ~ la dispadtion de I'AgHBs, n'a 6t6 observte clue chez un seul sujet. Cette approche semi-quantitative simple qui utilise les rtsultats de 2PCR seulement, apporte rapidement des informations sur le niveau de la virtmie VHD. M o t s - c l ~ s : PCR, H t p a t i t e D, VHD, V i r t m i e , Interf&on; Traitement, WNct2b, Technique semiquantitative, PCR.

References

Cariani, E., Rabaggi, A., Puoti, M., Mantero, G., Albertini, A. & Primi, D. (1992), Evaluation of hepatitis delta virus RNA levels during interferon therapy by analysis of polymerase chain reaction products with a nonradioisotopic hybridization assay. Hepatology, 15, 685-689. Cole, S., Macnaughton, T. & Gowans, E. (1993) Differential roles for HD-Ag-p24 and -p27 in HDV pathogenesis. IX International Congress of Virology. Glasgow p31 Wll-6 (Abslract). Deny, P., Zignego, A.L., Rascalou, N., Ponzetto, A., Tiollais, P. & Brtchot, C. (1991), Nucleotide sequence analysis of 3 different hepatitis delta viruses isolated from woodchuck and humans. J. Gen. ViroL, 72, 735-739. Dtny, P., Lecot, C., Jeantils, V., Ovaguimian, L., K.dvitzky, A. & Brtchot, C. (1993), Polymerase chain reaction-based detection of hepatits virus genome is patients infected with human immunodefieieney vims. J. Med. ViroL, 39, 214-218. Di Bisceglie, A.M., Marlin, P., Lisker-Melman, M., Kassianides, C., Korenman, J., Bergasa, N.V., Baker, B. & Hoofnagle, J.H. (1990), Therapy of chronic delta hepatitis with interferon alpha-2b. J. HepatoL, 1L S151-S154. Farei, P., Mandas, A., Lai, M.E., Farei, A.M.G., Fan, G., Caruso, L., Trisehitta, C., Seaeeabarozzi, S., Ryff, J.C. & Balestried, A. (1990), Treatment of chronic delta hepatitis with high and low doses interferon alpha-2& A randomized controlled trial.Gastroenterology, 12, 869 (abstract). Farci, P., Mandas, A., Coiana, A., Lai, M.E., Desmet, V., Van Eyken, P., Gibo, Y., Caruso, L., Seaceabarozzi, S., Criseuolo, D., Ryff, J.C. & Balestrieri, A. (1994),

Treatment of hepatitis D with interferon alpha-2a. N. Engl. J. Med., 330, 88-94. Ilan, Y., Klein, A., Taylor, J. et al. (1992), Resistance of hepatitis delta virus replication to interferon-or treatment in transfected human cells. J. Infect. Dis., 166, 1164-1166. Gaudin, J.L. & Trgpo, C. (1993), Therapy of chronic delta hepatitis with alpha- and beta-interferon. Prog. Clin. BioL Res., 282, 345-352. Gowans, E.J. & Bonino, F. (1993), Hepatitis delta virus pathogenicity. Prog. Clin. Biol. Res., 282, 125-130. Hadziyannis, J. (1991), Use of a interferon in treatment of chronic delta hepatitis. J. HepatoL, 13, $21-$26. Hoofnagle, J.H., Mullen, ICD., Peters, M., Mark, I., Avigan, Yoon Park, Waggoner, J.G., Gerin, J.L., Smedile, A. & Hoyer, B. (1985), Treatment of chronic delta hepatitis with recombinant human alpha interferon,/n "The biology of the interferon system" (Stewart, W.E. et a/.) (pp 493-497). Elsevier, Amsterdam. Hoofnagle, J.H. & Di Bisceglie, A.M. (1993), Therapy of chronic delta hepatitis: an overview. Prog. Clin. BioL Res., 282, 337-344. Kleiaert, D., Di Bisceglie, A.M., Axiotis, C.A. & Hoffnagle, J.H. (1993), Prolonged alpha interferon therapy for chronic delta hepatitis: effect on liver histopathology. Prog. Clin. BioL Res., 282, 365-372. Kos, T., Molinj, A., Van Doom, L.J., Van Belkum, A., Dubbeld, M. & Sehellekens, H. (1991), Hepatitis Delta virus eDNA sequence from an acutely I-IBVinfected chimpanzee: sequence conservation in experimental animals. J. Med~ ViroL, 34, 268-279. Kuo, M., Goldberg, J., Coates, L., Mason W., Gerin J. & Taylor, J. (1988), Molecular cloning of hepatitis delta virus RNA from an infected woodchuck liver: sequence, structure, and applications. J. ViroL, 62, 1855-1861. Kwok, S. & I-Iigushi R. (1989), Avoiding false positives with PCR. Nature (Lond.), 339, 237-338. Larzul, D., Guigue, F., Sninsky, J.l., Mack, D. Brtchot, C. & Guesdon, J.L. (1988), Detection of hepatitis B virus sequences in serum by 'using in vitro enzymatic amplification. Z ViroL Meth., 20, 227-237. Lau, J.Y.N., King, R., Tibbs, C.J., Catterall, A.P., Smith, H.M., Portmann, B.C., Alexander, G.J.M. & Willianas, R. (1993), Loss of HBsAg with interferon-or therapy in chronic hepatitis D virus infection; J. Med. ViroL, 39, 292-296. Lee, C.M., Bib, F.Y., Chao, Y.C., Govindarajan, S. & Lai, M. (1992), Evolution of hepatitis delta virus RNA during chronic infection. Virology, 188, 265-273. Marzano, A., Ottobrelli, A., Spezia, C., Daziano, E., Soranzo, M.L. & Rizzetto, M. (1992), Treatment of early chronic delta hepatitis with lymphoblastoid alpha interferon: a pilot study. Ital. J. GastroenteroL 24, 119-121. Negro, F;, Korba, B.E., Forzani, B., Baroudy, B.M., Brown, T.L., G-erin, J.L. & Ponzetto, A. (1989), Hepatitis delta virus (HDV) and woodchuck hepatitis virus (WHV) nucleic acids in tissues of HDVinfected chronic WHV carrier woodchuck. J. ViroL, 63, 1612-1618. Rashoffer, R., Buff, M., Esteban, R., Jardi, R. & Roggendoff, M. (1988), Demonstration of hepatitis D virus RNA in patient with chronic hepatitis. J. Infect. Dis., 157, 191-195.

I N T E R F E R O N , H E P A T I T I S D VIRAEMIA A N D P C R - B A S E D A S S A Y Rizzetto, M., Verme, G., Recchia, S., Bonino, F., Farci, P., Arico, S., Calzia, R., Picciotto, A., Colombo, M. & Popper, H. (1983), Chronic hepatitis in carriers of hepatitis B surface antigen with intra-hepafic expression of the delta antigen: an active and progressive disease unresponsive to immuuosuppressive treatment. Ann. Intern. Med., 98, 437--441. Rizzetto, M., Hadzyiannis, S., Hasson, Bg., Toukan, A. & Gust, I. (1992), Hepatitis delta virus infection in the world; epidemiological patterns and clinical expression. Gastroenterol. Intern., 5, 18-32. Rizzetto, M. (1993), Hepatitis delta virus disease: an overview. Prog. Clin. BioL Res., 282, 353-358. Rosina, F., Saracco, G., Lattore, V., Quartarone, V., Rizzetto, M., Verme, G., Trinchero, P., Sansalvadore, F. & Smedile, A. (1987), Alpha-2 recombinant interferon in the treatment of chronic hepatitis delta virus hepatitis, in "The hepatitis delta virus and its infection" (M. Rizzetto, Gerin, J.L. & Purcell, R.H.) (pp 299-303). Alan R. Liss, Inc. New York. Rosina, F., Pintus, C., Meschievitz, C. & Rizzetto, M. (1991), A randomized controlled trial of a 12-month course of recombinant human interferon-alpha in chronic delta (type D) hepatitis: a multicenter italian study. Hepatology, 13, 1052-1056.

295

Rosina, F., Saracco, G., Cozzolongo, R., Costa, C;, Bonnino, F., Verme, G. & Rizzetto, M. (1993), Italian trials of interferon alpha in chronic delta hepatitis. Prog. Clin. Biol. Res., 282, 353-358. Smedile, A., Rizzetto, M;, Denniston, K., Bonino, F., Wells, F., Verme, G., Consolo, F., Hoyer, B., Purcell, R. & Gerin, J. (1986), Type D hepatitis: the clinical significance of hepatitis D virus RNA in serum as detected by a hybridization-based assay. Hepatology, 6, 1297-1302. Wang, ICS., Choo, Q.L., Weiner, A., Ou, J., Najarian, R., Thayer, R., Mullenbach, G., Denniston, K., Gerin, J. & Houghton, M. (1986), Structure, sequence and expression of the hepatitis delta viral genome. Nature CLond.), 323, 508-514 (Author's correction (1987) Nature (Lond.), 328, 456). Wu, J.C., Lee, S.D., Govindarajan, S., Kung, T.W., Tsal, Y.T., Lo, K.J. & Ting, L.P. (1990): Correlation of serum delta RNA with clinical course of acute hepatitis delta virus superinfection in Taiwan: a longitudinal study. J. Infect. Dis., 161, 1116-1120. Zignego, A.L., Dtny, P., Ftray, C., Ponzetto, A., Gentilini, P. & Brt.chot, C. (1990), Amplification of hepatitis delta virus RNA sequences by polymerase chain reaction: a tool for viral detection and cloning. Mol. Cell. Probes, 3, 209-212.