- Email: [email protected]
Polymerase chain reaction for diagnosis of porcine proliferative enteropathy
E LS EV I ER
Veterinary Microbiology 41 (1994) 205-212
Polymerase chain reaction for diagnosis of porcine proliferative enteropathy Steven McOrist a'*, Connie J. Gebhart b, Gordon H.K. Lawson a aDepartment of Veterinary Pathology, Universityof Edinburgh, VeterinaryField Station, Easter Bush, Midlothian EH25 9RG, UK bDepartment of Veterinary Pathobiology, College of Veterinary Medicine, Universityof Minnesota, St Paul, MN, USA Received 9 July 1993; revised; accepted 11 January 1994
Abstract
A polymerase chain reaction (PCR) assay for detection of the intracellular bacteria, ileal symbiont intracellularis of porcine proliferative enteropathy is described. The test is based on specific DNA primers and gave positive PCR product from samples of preserved intestinal mucosa and faeces from affected pigs. Mucosa and faeces from normal pigs gave no positive PCR products. The identity of the PCR product was confirmed by DNA-DNA hybridization with a probe, pCLO78, specific for IS intracellularis. Positive results were only observed in animals with active lesions of proliferative enteropathy. PCR is probably the most useful method for diagnosis of proliferative enteropathy that is currently available for live animals. Keywords: Pig; Proliferative enteropathy; Diagnosis, bacteria general; PCR
1. Introduction
Proliferative enteropathy occurs in pigs worldwide and is a major cause of economic loss (Rowland and Lawson, 1992). The disease is characterised pathologically by marked hyperplasia of the mucosa of the ileum and colon of affected pigs. A consistent feature is the presence of intracellular bacteria within crypt enterocytes in proliferative lesions (Rowland and Lawson, 1974). These bacteria have recently been identified and classified as a novel taxonomic entity, ileal symbiont (IS) intracellularis (Gebhart et al, 1993), further taxonomic studies are in progress. Culture and maintenance of these bacteria 'in vitro' in cell cultures of enterocytes (Lawson et al., 1993) has enabled the clear reproduction of the *Corresponding author. 0378-1135/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSD10378-1135 ( 9 4 ) 0 0 0 2 2 - 0
206
s. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
disease with these intracellular bacteria alone, in pigs dosed orally (McOrist et al., 1993). However, almost the entire epidemiological nature of the disease remains unknown. Immunocytological studies have indicated that there is only a weak immune response to the bacterial infection (McOrist et al., 1992) and specific IgA and IgM titres were only detected in the serum of animals found to have advanced pathological lesions (Lawson et al., 1988). Therefore, carrier animals, with or without subclinical lesions, have not been detected readily in previous serological surveys. Detection of the bacteria in smears of pig faeces by a specific immunofluorescence assay, found that besides those clinically affected pigs which excreted numerous bacteria, some subclinical in-contact pigs also excreted detectable numbers of organisms (McOrist and Lawson, 1989). Presumably therefore, these organisms can act as a source of infection for other pigs. However, these tests show obvious deficiencies for further analysis of proliferative enteropathy. Recent development of a specific polymerase chain reaction (PCR) test for the intracellular bacteria offered the possibility of both sensitivity and specificity for detection of the organism (Jones et al., 1993). PCR analysis has proved useful for a wide range of infections and would suit those such as proliferative enteropathy where the infectious agent is difficult to cultivate. We therefore attempted to validate a simplified PCR method for investigation of proliferative enteropathy, incorporating fresh and fixed specimens from natural and experimental cases.
2. Materials and methods 2.1. Sample preparation
2.1.1. Preserved intestinal mucosa
Pigs were submitted over a twenty year period from British farms for diagnosis of enteric and other conditions. To minimise the possibility of DNA degradation affecting results, only 53 pigs submitted from four local farms known to suffer proliferative enteropathy over the past five years were included. A portion of ileum was collected from each pig at necropsy, immersed in buffered formalin and embedded into paraffin wax blocks by routine methods. Four 10 /zm sections were cut with a microtome from each block and placed into an Eppendorf tube. Care was taken to clean the microtome blade with xylene between each block. Samples were processed from 35 pigs known to be naturally affected by proliferative enteropathy and a further 28 pigs known not to have any lesions following gross and histopathological examination of the ileum and colon. These latter pigs originated from the four study farms both during periods when outbreaks of proliferative enteropathy were known to be occurring and in "clean" periods. Several methods exist for sample preparation for PCR analysis of preserved specimens. We chose a simple, rapid method (Hubbard and Anderson, 1993) which gave comparable results to longer DNA extraction methods. Briefly, 100/xl of lysis buffer (50 mM Tris-C1, pH 8.4, 1 mM EDTA, 0.5% Tween-20) was added to each tube and the tubes were placed in a 100°C water bath for 8 min. Samples were stored at - 20°C, prior to PCR.
s. McOristet al. / VeterinaryMicrobiology 41 (1994) 205-212
207
2.1.2. Faeces Faeces samples were collected from 8 control pigs and 8 pigs dosed orally with infectious IS intracellularis organisms as described elsewhere (McOrist et al., 1993) at 0, 10 and 21 days after dosing. Smears of each sample were made onto glass slides, air-dried, acetonefixed and a specific immunofluorescence assay for IS intracellularis applied (McOrist et al., 1987). In addition, 0.2 g of each faecal sample was mixed thoroughly in 1 ml of the lysis buffer, centrifuged at 500 g to remove debris, then the supernatant fluid was placed in a 100°C water bath for 20 min. Samples were stored at - 20°C prior to PCR. 2.2. Polymerase chain reaction
Prior to incorporation into PCR, each sample was placed in a 100°C water bath for 10 min. Amplification of DNA from each sample was performed on a Techne PHC3 thermal cycler using 5/zl of the prepared sample, 200/xM dNTP, 250 pM each of sense and antisense primers, 1 unit of Taq polymerase and 5 ~1 of 10 × reaction buffer (Advanced Biotech, London) to a total volume of 50 /~1. Two primer sets (A and B; C and D) had been constructed from the sequences of IS intracellularis specific portions of the pCLO78 probe and 16S rRNA section of bacterial genome respectively. These sequences are published elsewhere (Jones et al., 1993; Gebhart et al., 1993, Genbank Accession No. L15739). The primer set A and B constructed by Jones et al. (1993) 5', 5'TATGGCTGTCAAACACTCCG and 3', 5'TGAAGGTATI'GGTATI'CTCC, was selected for further study after preliminary evaulation for reliability. Thirty-five cycles were performed at respective optimal temperatures, 93°C, 55°C and 72°C, one minute per temperature. 2.3. Assay sensitivity
IS intracellularis was purified from the infected intestinal mucosa of two affected pigs by extraction methods described previously (McOrist et al., 1987). Each bacterial suspension was diluted in lysis buffer to obtain a concentration of organisms (approximately 10 per high-power dry field) which permitted accurate enumeration at 400 × magnification under fluorescent light. The average concentration of organisms was determined from each suspension, counting a minimum of 20 fields, after a sample of each had been air-dried onto a slide and stained by specific immunofluorescence assay as described previously (McOrist et al., 1987). Duplicate ten-fold serial dilutions of each suspension were then prepared in lysis buffer such that 5/zl portions contained 1000, 100, 20, 10 and 2 organisms. Samples were boiled for 20 min and incorporated into PCR. 2.4. Agarose gel electrophoresis and DNA-DNA hybridization
One fifth of each PCR reaction product ( 10/~1) was analyzed by electrophoresis through a 1% agarose gel containing TAE buffer. Gels were stained for 15 min in ethidium bromide then destained for 20 min in water. Gels were photographed under UV illumination and in some cases transferred to nylon membranes (Amersham, UK) for Southern blot analysis. Other PCR product specimens were applied directly to nylon membranes by using a Minifold I apparatus (Schleicher and Schnell, USA) for dot blot DNA-DNA hybridization.
208
S. McOristet al. / Veterinary Microbiology41 (1994) 205-212
The DNA probe for hybridizations was pCLO78 probe specific for IS intracellularis (Gebhart et al., 1991). The probe had been labelled with digoxigenin according to the manufacturer's instructions (Boehringer Mannheim, Germany). Southern and dot blot hybridizations were performed overnight at 68°C according to the same manufacturer's instructions. Bound probe was detected with an anti-digoxigenin alkaline phosphatase conjugate and subsequent reaction with Lumiphos 530 substrate (Boehringer Mannheim) for 30 min at 37°C, followed by exposure to X-ray film to record the chemiluminescence reaction. Control hybridizations were performed incorporating a DNA probe specific for Campylobacter hyointestinalis pCHC (Gebhart et al., 1990), of similar size to the pCLO78 probe. 3. Results 3.1. Development o f the PCR assay
The primers A and B used within the nucleotide sequence of IS intracellularis generated a 319 bp fragment (including 40 bp of primers) following PCR of chromosomal DNA. A fragment of the appropriate size was visualized following PCR of mucosal and faecal samples known to be positive for proliferative enteropathy and associated IS intracellularis organisms, but not following amplification of samples from normal animals or reaction mixtures without DNA (Fig. 1 ). Dot blot analysis confirmed that the product obtained from the samples was specific for IS intracellularis, that specific PCR products were absent from the negative controls, and that PCR products did not react with DNA probes to non-specific organisms (Fig. 2). Southern blot analysis indicated that these reactions with PCR products also occurred at 319 bp site (data not shown).
123456 Fig. 1. PCRof 319bp fragmentof IS intracellularis. PCRproductswerevisualizedon a 1%agaroseelectrophoresis gel stained with ethidium bromide.Lanes: (1) IS intracellularis 1269/76 DNA; (2) C. hyointestinalis DNA; (3,4) Preservedintestinal sections, pigs 39/91 and 8384 respectivelyaffectedwith proliferativeenteropathy; (5,6) Preservedintestinal sections,normalpigs.
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
A
209
B
10 1.0 0.1
1
2
3
4
1
2
3
Fig. 2. Reactivityof the IS intracellularis probepCLO78and C. hyointestinalis probepCHCto PCR productsand C. hyointestinalis chromosomalDNA. A: Hybridizationof pCLO78with: ( 1) PCR productof section of 39/91; (2) PCR productof section of 8384; (3) PCR productof normalpig section;and (4) C. hyointestinalis DNA. B: Hybridizationof pCHC with: (I) HomologousC. hyointestinalis strain DNA; (2) pCHCprobeDNA; (3) PCR product of section of 39/91. DNA concentrations given in/zg, ml-1. Pigs 39/91 and 8384 affectedwith proliferativeenteropathy. Positive PCR results were obtained from suspensions of boiled whole IS intracellularis calculated to contain 10 or more organisms. Reliable reactions could not be obtained with more dilute samples. 3.2. Detection o f l S intracellularis in clinical specimens
Positive PCR results were obtained from preserved mucosal specimens from 23 of 25 pigs affected with proliferative enteropathy from four farms. Two of the farms had had long-term problems with the disease, despite their high health status and intensive format. Preserved material from their pigs suffering clear lesions of all pathological forms of the disease were nearly all positive (10 of 12). In contrast, ten pigs which had had clinical signs of the disease (weight loss) and had been in contact with affected pigs, but which had survived and showed apparent clinical and lesion recovery, did not produce positive PCR results. Also, ten other healthy cohort pigs with normal intestines from these farms did not produce positive PCR results. The remaining two farms had had single outbreaks of the disease, with long periods of good health status. These farms often had introductions of young pigs and a semi-intensive format. Samples from 13 animals affected during outbreaks were consistently positive. Samples from 8 animals collected at other periods were consistently negative. Of the faeces tested from animals known to have developed experimentally-induced proliferative enteropathy, seven of eight samples, 21 days post-inoculation, gave positive PCR results, two of these were positive on faecal smear examination. All other samples were negative. 4. Discussion This study validates the use of polymerase chain reaction for the detection of the intracellular bacteria associated with proliferative enteropathy. The methods described here
210
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
considerably simplify previous PCR methods proposed for detection of this bacterium in faeces (Jones et al., 1993) and those proposed for detection of other infectious organisms in faeces and tissues (Allard et al., 1990; Ho et al., 1991). It is therefore likely that the PCR will be a valuable tool for unearthing the epidemiological patterns of proliferative enteropathy. Previous epidemiological studies have only had available serological tests and insensitive faecal antigen detection tests. Serology of proliferative enteropathy has proved of limited value as it only appears to mainly detect raised, specific IgA and IgM titres in the sera of pigs with well developed lesions (Lawson et al., 1988). This would therefore probably serve only as a confirmatory test in clinically affected pigs. Similarly, detection of IS intracellularis in smears of faeces stained with specific monoclonal antibodies is not likely to be of sufficient sensitivity to be of use for epidemiological study (McOrist and Lawson, 1989). Given the primary epithelial cell response but limited infiltration of lymphocytes in the mucosa of pigs with proliferative enteropathy (McOrist et al., 1992), it is not likely that serological assays can be developed much further until a ready source of a specific immunologically reactive antigen becomes available, such as through recombinant DNA technology. Currently, therefore, sensitive detection of bacterial antigen in faeces by PCR offers the only chance to explore epidemiological aspects of the infection. Our preliminary findings suggested that, of those tested, only animals with active lesions excreted sufficient organisms for detection. Normal cohort pigs and recovering pigs did not excrete numerous organisms. However, this assessment is confused by the frequent difficulty of detecting pigs with active lesions, in a field situation. The early clinical signs of active proliferative enteropathy are often merely a failure to achieve a "normal" weight gain. It is possible that transmission of proliferative enteropathy by oral-faecal exposure mainly occurs between the ages of 5 and 12 weeks of age when susceptible pigs come into contact with clinical or subclinical cases. In the farms we studied here, this certainly seemed sufficient to provide both long-term problems and/or occasional outbreaks. Further studies may reveal whether carriers exist, and if so, at what site the carriage occurs. Use of PCR on faeces and tissues presents special technical problems. We attempted to minimise the influence of tissue and faeces inhibitors of PCR reactions by diluting and boiling samples to an extent where sample DNA would be preserved to the sensitivity described (approximately 10 organisms) while removing inhibitors. Previous studies of PCR reactions for diagnosis of faecal infections have suggested that this is a more reliable method of reducing false negatives, than applying lengthy preparative techniques (Allard et al., 1990; Mapstone and Quirke, 1992). The PCR is apparently superior to attempted faecal culture of the intracellular bacteria, IS intracellularis for diagnosis; previous studies with in vitro cultures have indicated that it is an obligate intracellular bacterium requiring epithelial cells for growth (Lawson et al., 1993). This would make its ready culture and the exclusion of other contaminating organisms from faecal samples exceedingly difficult. The PCR has been used widely for the diagnosis of other infections with bacteria that are difficult to cultivate, such as Treponemapallidum (Bustain et al., 1991 ). Our development of the PCR also included use of preserved tissue samples, making possible a retrospective examination of lesions and controls. We confirmed that this type of study can provide valid results, which could give an insight into patterns of disease over a period of several years. Veterinary microbiology offers many instances where sample examination is often precluded by tissue preservation for pathology, but this PCR technique
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
211
m a y alter the usefulness o f m a n y samples. Use of the P C R in this way must take note of possible D N A degradation however, to avoid too m a n y false negatives. D N A fragments of greater than 200 bp are thought not to survive in preserved samples for periods longer than several years ( P a a b o et al., 1989), therefore primers e n c o d i n g large fragments are of limited use in retrospective studies. Prospective studies m a y provide more information on carriers, transmission and precipitation factors in this disease.
Acknowledgements W e thank Gary Jones, Barbara Swanson, Barbara Tall, Tudor Lloyd and Neil MacIntyre for their valuable input into this work, which was partly supported by the Agricultural Food Research C o u n c i l and the W e l l c o m e Trust of the UK.
References Allard, A., Girones, R., Juto, P. and Wadell, G., 1990. Polymerase chain reaction for detection of adenoviruses in stool samples. J. Clin. Microbiol., 28: 2659-2667. Burstain, J.M., Grimprel, E., Lukehart, S.A., Norgard, M.V. and Radolf, J.D., 1991. Sensitive detection of Treponema pallidum by using the polymerase chain reaction. J. Clin. Microbiol., 29: 62--69. Gebhart, C.J., Murtaugh, M.P., Lin, G.F. and Ward, G.E., 1990. Species-specific DNA probes for Campylobacter species isolated from pigs with proliferative enteritis. Vet. Microbiol., 24: 367-379. Gebhart, C.J., Lin, G.F., McOrist, S., Lawson, G.H.K. and Murtaugh, M.P., 1991. Cloned DNA probes specific for the intracellular Campylobacter-like organism of porcine proliferative enteritis. J. Clin. Microbiol., 29: 1011-1015. Gebhart, C.J., Barns, S,M., McOrist, S., Lin, G.F. and Lawson, G.H.K., 1993. Ileal symbiont, intracellularis, an obligate intracellular bacterium of porcine intestines, showing a relationship to Desulfovibrio species. Int. J. Syst. Bacteriol., 43. Ho, S., Hoyle, J.A., Lewis, F.A., Secker, A.D., Cross, D., Mapstone, N.P., Dixon, M.F., Wyatt, J.I., Tompkins, D.S., Taylor, G.R. and Quirke, P., 1991. Direct polymerase chain reaction test for detection of Helicobacter pylori in humans and animals. J. Clin. Microbiol., 29: 2543-2549. Hubbard, A.L. and Anderson, T.J., 1993. Simple 10 minute preparation of fixed, embedded breast tissue for the polymerase chain reaction. Breast, 2: 50-51. Jones, G.F., Ward, G.E., Murtaugh, M.P., Lin, G.F. and Gebhart, C.J., 1993. Enhanced detection of intracellular organism of swine proliferative enteritis ileal symbiont intracellularis in feces by polymerase chain reaction. J. Clin. Microbiol., 31: 2611-2615. Lawson, G.H.K., McOrist, S., Rowland, A.C., McCartney, E. and Roberts, L., 1988. Serological diagnosis of the porcine proliferative enteropathies: Implications for aetiology and epidemiology. Vet. Rec., 122: 554-557. Lawson, G.H.K., McOrist, S., Jasni, S. and Mackie, R.A., 1993. IntraceUular bacteria of porcine proliferative enteropathy: cultivation and maintenance in vitro. J. Clin. Microbiol., 31: 1136-1142. Mapstone, N.P. and Quirke, P., 1992. Molecular biology and infections of the gut. Gut, 33: 1441-1443. McOrist, S., Boid, R., Lawson, G.H.K. and McConnell, I., 1987. Monoclonal antibodies to intracellular campylobacter-like organisms of the porcine proliferative enteropathies. Vet. Rec., 121: 421-422. McOrist, S. and Lawson, G.H.K., 1989. Proliferative enteropathies: Campylobacter species in the faeces of normal and contact pigs. Vet. Rec., 124: 41. McOrist, S., Maclntyre, N., Stokes, C.R. and Lawson, G.H.K., 1992. Immunocytological responses in porcine proliferative enteropathies. Infect. Immun., 60:4184--4191. McOrist, S., Jasni, S., Mackie, R.A., Macintyre, N., Neef, N. and Lawson, G.H.K., 1993. Reproduction of porcine proliferative enteropathy with pure cultures of ileal symbiont intracellularis. Infect. Immun., 61: 4286--4292.
212
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
Paabo, S., Higuchi, R.G. and Wilson, A.C., 1989. Ancient DNA and the polymerase chain reaction, the emerging field of molecular archeology. J. Biol. Chem., 264:9709-9712. Rowland, A.C. and Lawson, G.H.K., 1974. Intestinal adenomatosis in the pig: immunofluorescent and electron microscopic studies. Res. Vet. Sci., 17: 323-330. Rowland, A.C. and Lawson, G.H.K., 1992. Porcine proliferative enteropathies. In: A.D. Leman, B. Straw, W.L. Mengeling, S. D'Allaire and D.J. Taylor (Eds.), Diseases of Swine, 7th edition. Iowa State University Press, Ames, Iowa, USA. pp. 560-569.
Veterinary Microbiology 41 (1994) 205-212
Polymerase chain reaction for diagnosis of porcine proliferative enteropathy Steven McOrist a'*, Connie J. Gebhart b, Gordon H.K. Lawson a aDepartment of Veterinary Pathology, Universityof Edinburgh, VeterinaryField Station, Easter Bush, Midlothian EH25 9RG, UK bDepartment of Veterinary Pathobiology, College of Veterinary Medicine, Universityof Minnesota, St Paul, MN, USA Received 9 July 1993; revised; accepted 11 January 1994
Abstract
A polymerase chain reaction (PCR) assay for detection of the intracellular bacteria, ileal symbiont intracellularis of porcine proliferative enteropathy is described. The test is based on specific DNA primers and gave positive PCR product from samples of preserved intestinal mucosa and faeces from affected pigs. Mucosa and faeces from normal pigs gave no positive PCR products. The identity of the PCR product was confirmed by DNA-DNA hybridization with a probe, pCLO78, specific for IS intracellularis. Positive results were only observed in animals with active lesions of proliferative enteropathy. PCR is probably the most useful method for diagnosis of proliferative enteropathy that is currently available for live animals. Keywords: Pig; Proliferative enteropathy; Diagnosis, bacteria general; PCR
1. Introduction
Proliferative enteropathy occurs in pigs worldwide and is a major cause of economic loss (Rowland and Lawson, 1992). The disease is characterised pathologically by marked hyperplasia of the mucosa of the ileum and colon of affected pigs. A consistent feature is the presence of intracellular bacteria within crypt enterocytes in proliferative lesions (Rowland and Lawson, 1974). These bacteria have recently been identified and classified as a novel taxonomic entity, ileal symbiont (IS) intracellularis (Gebhart et al, 1993), further taxonomic studies are in progress. Culture and maintenance of these bacteria 'in vitro' in cell cultures of enterocytes (Lawson et al., 1993) has enabled the clear reproduction of the *Corresponding author. 0378-1135/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSD10378-1135 ( 9 4 ) 0 0 0 2 2 - 0
206
s. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
disease with these intracellular bacteria alone, in pigs dosed orally (McOrist et al., 1993). However, almost the entire epidemiological nature of the disease remains unknown. Immunocytological studies have indicated that there is only a weak immune response to the bacterial infection (McOrist et al., 1992) and specific IgA and IgM titres were only detected in the serum of animals found to have advanced pathological lesions (Lawson et al., 1988). Therefore, carrier animals, with or without subclinical lesions, have not been detected readily in previous serological surveys. Detection of the bacteria in smears of pig faeces by a specific immunofluorescence assay, found that besides those clinically affected pigs which excreted numerous bacteria, some subclinical in-contact pigs also excreted detectable numbers of organisms (McOrist and Lawson, 1989). Presumably therefore, these organisms can act as a source of infection for other pigs. However, these tests show obvious deficiencies for further analysis of proliferative enteropathy. Recent development of a specific polymerase chain reaction (PCR) test for the intracellular bacteria offered the possibility of both sensitivity and specificity for detection of the organism (Jones et al., 1993). PCR analysis has proved useful for a wide range of infections and would suit those such as proliferative enteropathy where the infectious agent is difficult to cultivate. We therefore attempted to validate a simplified PCR method for investigation of proliferative enteropathy, incorporating fresh and fixed specimens from natural and experimental cases.
2. Materials and methods 2.1. Sample preparation
2.1.1. Preserved intestinal mucosa
Pigs were submitted over a twenty year period from British farms for diagnosis of enteric and other conditions. To minimise the possibility of DNA degradation affecting results, only 53 pigs submitted from four local farms known to suffer proliferative enteropathy over the past five years were included. A portion of ileum was collected from each pig at necropsy, immersed in buffered formalin and embedded into paraffin wax blocks by routine methods. Four 10 /zm sections were cut with a microtome from each block and placed into an Eppendorf tube. Care was taken to clean the microtome blade with xylene between each block. Samples were processed from 35 pigs known to be naturally affected by proliferative enteropathy and a further 28 pigs known not to have any lesions following gross and histopathological examination of the ileum and colon. These latter pigs originated from the four study farms both during periods when outbreaks of proliferative enteropathy were known to be occurring and in "clean" periods. Several methods exist for sample preparation for PCR analysis of preserved specimens. We chose a simple, rapid method (Hubbard and Anderson, 1993) which gave comparable results to longer DNA extraction methods. Briefly, 100/xl of lysis buffer (50 mM Tris-C1, pH 8.4, 1 mM EDTA, 0.5% Tween-20) was added to each tube and the tubes were placed in a 100°C water bath for 8 min. Samples were stored at - 20°C, prior to PCR.
s. McOristet al. / VeterinaryMicrobiology 41 (1994) 205-212
207
2.1.2. Faeces Faeces samples were collected from 8 control pigs and 8 pigs dosed orally with infectious IS intracellularis organisms as described elsewhere (McOrist et al., 1993) at 0, 10 and 21 days after dosing. Smears of each sample were made onto glass slides, air-dried, acetonefixed and a specific immunofluorescence assay for IS intracellularis applied (McOrist et al., 1987). In addition, 0.2 g of each faecal sample was mixed thoroughly in 1 ml of the lysis buffer, centrifuged at 500 g to remove debris, then the supernatant fluid was placed in a 100°C water bath for 20 min. Samples were stored at - 20°C prior to PCR. 2.2. Polymerase chain reaction
Prior to incorporation into PCR, each sample was placed in a 100°C water bath for 10 min. Amplification of DNA from each sample was performed on a Techne PHC3 thermal cycler using 5/zl of the prepared sample, 200/xM dNTP, 250 pM each of sense and antisense primers, 1 unit of Taq polymerase and 5 ~1 of 10 × reaction buffer (Advanced Biotech, London) to a total volume of 50 /~1. Two primer sets (A and B; C and D) had been constructed from the sequences of IS intracellularis specific portions of the pCLO78 probe and 16S rRNA section of bacterial genome respectively. These sequences are published elsewhere (Jones et al., 1993; Gebhart et al., 1993, Genbank Accession No. L15739). The primer set A and B constructed by Jones et al. (1993) 5', 5'TATGGCTGTCAAACACTCCG and 3', 5'TGAAGGTATI'GGTATI'CTCC, was selected for further study after preliminary evaulation for reliability. Thirty-five cycles were performed at respective optimal temperatures, 93°C, 55°C and 72°C, one minute per temperature. 2.3. Assay sensitivity
IS intracellularis was purified from the infected intestinal mucosa of two affected pigs by extraction methods described previously (McOrist et al., 1987). Each bacterial suspension was diluted in lysis buffer to obtain a concentration of organisms (approximately 10 per high-power dry field) which permitted accurate enumeration at 400 × magnification under fluorescent light. The average concentration of organisms was determined from each suspension, counting a minimum of 20 fields, after a sample of each had been air-dried onto a slide and stained by specific immunofluorescence assay as described previously (McOrist et al., 1987). Duplicate ten-fold serial dilutions of each suspension were then prepared in lysis buffer such that 5/zl portions contained 1000, 100, 20, 10 and 2 organisms. Samples were boiled for 20 min and incorporated into PCR. 2.4. Agarose gel electrophoresis and DNA-DNA hybridization
One fifth of each PCR reaction product ( 10/~1) was analyzed by electrophoresis through a 1% agarose gel containing TAE buffer. Gels were stained for 15 min in ethidium bromide then destained for 20 min in water. Gels were photographed under UV illumination and in some cases transferred to nylon membranes (Amersham, UK) for Southern blot analysis. Other PCR product specimens were applied directly to nylon membranes by using a Minifold I apparatus (Schleicher and Schnell, USA) for dot blot DNA-DNA hybridization.
208
S. McOristet al. / Veterinary Microbiology41 (1994) 205-212
The DNA probe for hybridizations was pCLO78 probe specific for IS intracellularis (Gebhart et al., 1991). The probe had been labelled with digoxigenin according to the manufacturer's instructions (Boehringer Mannheim, Germany). Southern and dot blot hybridizations were performed overnight at 68°C according to the same manufacturer's instructions. Bound probe was detected with an anti-digoxigenin alkaline phosphatase conjugate and subsequent reaction with Lumiphos 530 substrate (Boehringer Mannheim) for 30 min at 37°C, followed by exposure to X-ray film to record the chemiluminescence reaction. Control hybridizations were performed incorporating a DNA probe specific for Campylobacter hyointestinalis pCHC (Gebhart et al., 1990), of similar size to the pCLO78 probe. 3. Results 3.1. Development o f the PCR assay
The primers A and B used within the nucleotide sequence of IS intracellularis generated a 319 bp fragment (including 40 bp of primers) following PCR of chromosomal DNA. A fragment of the appropriate size was visualized following PCR of mucosal and faecal samples known to be positive for proliferative enteropathy and associated IS intracellularis organisms, but not following amplification of samples from normal animals or reaction mixtures without DNA (Fig. 1 ). Dot blot analysis confirmed that the product obtained from the samples was specific for IS intracellularis, that specific PCR products were absent from the negative controls, and that PCR products did not react with DNA probes to non-specific organisms (Fig. 2). Southern blot analysis indicated that these reactions with PCR products also occurred at 319 bp site (data not shown).
123456 Fig. 1. PCRof 319bp fragmentof IS intracellularis. PCRproductswerevisualizedon a 1%agaroseelectrophoresis gel stained with ethidium bromide.Lanes: (1) IS intracellularis 1269/76 DNA; (2) C. hyointestinalis DNA; (3,4) Preservedintestinal sections, pigs 39/91 and 8384 respectivelyaffectedwith proliferativeenteropathy; (5,6) Preservedintestinal sections,normalpigs.
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
A
209
B
10 1.0 0.1
1
2
3
4
1
2
3
Fig. 2. Reactivityof the IS intracellularis probepCLO78and C. hyointestinalis probepCHCto PCR productsand C. hyointestinalis chromosomalDNA. A: Hybridizationof pCLO78with: ( 1) PCR productof section of 39/91; (2) PCR productof section of 8384; (3) PCR productof normalpig section;and (4) C. hyointestinalis DNA. B: Hybridizationof pCHC with: (I) HomologousC. hyointestinalis strain DNA; (2) pCHCprobeDNA; (3) PCR product of section of 39/91. DNA concentrations given in/zg, ml-1. Pigs 39/91 and 8384 affectedwith proliferativeenteropathy. Positive PCR results were obtained from suspensions of boiled whole IS intracellularis calculated to contain 10 or more organisms. Reliable reactions could not be obtained with more dilute samples. 3.2. Detection o f l S intracellularis in clinical specimens
Positive PCR results were obtained from preserved mucosal specimens from 23 of 25 pigs affected with proliferative enteropathy from four farms. Two of the farms had had long-term problems with the disease, despite their high health status and intensive format. Preserved material from their pigs suffering clear lesions of all pathological forms of the disease were nearly all positive (10 of 12). In contrast, ten pigs which had had clinical signs of the disease (weight loss) and had been in contact with affected pigs, but which had survived and showed apparent clinical and lesion recovery, did not produce positive PCR results. Also, ten other healthy cohort pigs with normal intestines from these farms did not produce positive PCR results. The remaining two farms had had single outbreaks of the disease, with long periods of good health status. These farms often had introductions of young pigs and a semi-intensive format. Samples from 13 animals affected during outbreaks were consistently positive. Samples from 8 animals collected at other periods were consistently negative. Of the faeces tested from animals known to have developed experimentally-induced proliferative enteropathy, seven of eight samples, 21 days post-inoculation, gave positive PCR results, two of these were positive on faecal smear examination. All other samples were negative. 4. Discussion This study validates the use of polymerase chain reaction for the detection of the intracellular bacteria associated with proliferative enteropathy. The methods described here
210
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
considerably simplify previous PCR methods proposed for detection of this bacterium in faeces (Jones et al., 1993) and those proposed for detection of other infectious organisms in faeces and tissues (Allard et al., 1990; Ho et al., 1991). It is therefore likely that the PCR will be a valuable tool for unearthing the epidemiological patterns of proliferative enteropathy. Previous epidemiological studies have only had available serological tests and insensitive faecal antigen detection tests. Serology of proliferative enteropathy has proved of limited value as it only appears to mainly detect raised, specific IgA and IgM titres in the sera of pigs with well developed lesions (Lawson et al., 1988). This would therefore probably serve only as a confirmatory test in clinically affected pigs. Similarly, detection of IS intracellularis in smears of faeces stained with specific monoclonal antibodies is not likely to be of sufficient sensitivity to be of use for epidemiological study (McOrist and Lawson, 1989). Given the primary epithelial cell response but limited infiltration of lymphocytes in the mucosa of pigs with proliferative enteropathy (McOrist et al., 1992), it is not likely that serological assays can be developed much further until a ready source of a specific immunologically reactive antigen becomes available, such as through recombinant DNA technology. Currently, therefore, sensitive detection of bacterial antigen in faeces by PCR offers the only chance to explore epidemiological aspects of the infection. Our preliminary findings suggested that, of those tested, only animals with active lesions excreted sufficient organisms for detection. Normal cohort pigs and recovering pigs did not excrete numerous organisms. However, this assessment is confused by the frequent difficulty of detecting pigs with active lesions, in a field situation. The early clinical signs of active proliferative enteropathy are often merely a failure to achieve a "normal" weight gain. It is possible that transmission of proliferative enteropathy by oral-faecal exposure mainly occurs between the ages of 5 and 12 weeks of age when susceptible pigs come into contact with clinical or subclinical cases. In the farms we studied here, this certainly seemed sufficient to provide both long-term problems and/or occasional outbreaks. Further studies may reveal whether carriers exist, and if so, at what site the carriage occurs. Use of PCR on faeces and tissues presents special technical problems. We attempted to minimise the influence of tissue and faeces inhibitors of PCR reactions by diluting and boiling samples to an extent where sample DNA would be preserved to the sensitivity described (approximately 10 organisms) while removing inhibitors. Previous studies of PCR reactions for diagnosis of faecal infections have suggested that this is a more reliable method of reducing false negatives, than applying lengthy preparative techniques (Allard et al., 1990; Mapstone and Quirke, 1992). The PCR is apparently superior to attempted faecal culture of the intracellular bacteria, IS intracellularis for diagnosis; previous studies with in vitro cultures have indicated that it is an obligate intracellular bacterium requiring epithelial cells for growth (Lawson et al., 1993). This would make its ready culture and the exclusion of other contaminating organisms from faecal samples exceedingly difficult. The PCR has been used widely for the diagnosis of other infections with bacteria that are difficult to cultivate, such as Treponemapallidum (Bustain et al., 1991 ). Our development of the PCR also included use of preserved tissue samples, making possible a retrospective examination of lesions and controls. We confirmed that this type of study can provide valid results, which could give an insight into patterns of disease over a period of several years. Veterinary microbiology offers many instances where sample examination is often precluded by tissue preservation for pathology, but this PCR technique
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
211
m a y alter the usefulness o f m a n y samples. Use of the P C R in this way must take note of possible D N A degradation however, to avoid too m a n y false negatives. D N A fragments of greater than 200 bp are thought not to survive in preserved samples for periods longer than several years ( P a a b o et al., 1989), therefore primers e n c o d i n g large fragments are of limited use in retrospective studies. Prospective studies m a y provide more information on carriers, transmission and precipitation factors in this disease.
Acknowledgements W e thank Gary Jones, Barbara Swanson, Barbara Tall, Tudor Lloyd and Neil MacIntyre for their valuable input into this work, which was partly supported by the Agricultural Food Research C o u n c i l and the W e l l c o m e Trust of the UK.
References Allard, A., Girones, R., Juto, P. and Wadell, G., 1990. Polymerase chain reaction for detection of adenoviruses in stool samples. J. Clin. Microbiol., 28: 2659-2667. Burstain, J.M., Grimprel, E., Lukehart, S.A., Norgard, M.V. and Radolf, J.D., 1991. Sensitive detection of Treponema pallidum by using the polymerase chain reaction. J. Clin. Microbiol., 29: 62--69. Gebhart, C.J., Murtaugh, M.P., Lin, G.F. and Ward, G.E., 1990. Species-specific DNA probes for Campylobacter species isolated from pigs with proliferative enteritis. Vet. Microbiol., 24: 367-379. Gebhart, C.J., Lin, G.F., McOrist, S., Lawson, G.H.K. and Murtaugh, M.P., 1991. Cloned DNA probes specific for the intracellular Campylobacter-like organism of porcine proliferative enteritis. J. Clin. Microbiol., 29: 1011-1015. Gebhart, C.J., Barns, S,M., McOrist, S., Lin, G.F. and Lawson, G.H.K., 1993. Ileal symbiont, intracellularis, an obligate intracellular bacterium of porcine intestines, showing a relationship to Desulfovibrio species. Int. J. Syst. Bacteriol., 43. Ho, S., Hoyle, J.A., Lewis, F.A., Secker, A.D., Cross, D., Mapstone, N.P., Dixon, M.F., Wyatt, J.I., Tompkins, D.S., Taylor, G.R. and Quirke, P., 1991. Direct polymerase chain reaction test for detection of Helicobacter pylori in humans and animals. J. Clin. Microbiol., 29: 2543-2549. Hubbard, A.L. and Anderson, T.J., 1993. Simple 10 minute preparation of fixed, embedded breast tissue for the polymerase chain reaction. Breast, 2: 50-51. Jones, G.F., Ward, G.E., Murtaugh, M.P., Lin, G.F. and Gebhart, C.J., 1993. Enhanced detection of intracellular organism of swine proliferative enteritis ileal symbiont intracellularis in feces by polymerase chain reaction. J. Clin. Microbiol., 31: 2611-2615. Lawson, G.H.K., McOrist, S., Rowland, A.C., McCartney, E. and Roberts, L., 1988. Serological diagnosis of the porcine proliferative enteropathies: Implications for aetiology and epidemiology. Vet. Rec., 122: 554-557. Lawson, G.H.K., McOrist, S., Jasni, S. and Mackie, R.A., 1993. IntraceUular bacteria of porcine proliferative enteropathy: cultivation and maintenance in vitro. J. Clin. Microbiol., 31: 1136-1142. Mapstone, N.P. and Quirke, P., 1992. Molecular biology and infections of the gut. Gut, 33: 1441-1443. McOrist, S., Boid, R., Lawson, G.H.K. and McConnell, I., 1987. Monoclonal antibodies to intracellular campylobacter-like organisms of the porcine proliferative enteropathies. Vet. Rec., 121: 421-422. McOrist, S. and Lawson, G.H.K., 1989. Proliferative enteropathies: Campylobacter species in the faeces of normal and contact pigs. Vet. Rec., 124: 41. McOrist, S., Maclntyre, N., Stokes, C.R. and Lawson, G.H.K., 1992. Immunocytological responses in porcine proliferative enteropathies. Infect. Immun., 60:4184--4191. McOrist, S., Jasni, S., Mackie, R.A., Macintyre, N., Neef, N. and Lawson, G.H.K., 1993. Reproduction of porcine proliferative enteropathy with pure cultures of ileal symbiont intracellularis. Infect. Immun., 61: 4286--4292.
212
S. McOrist et al. / Veterinary Microbiology 41 (1994) 205-212
Paabo, S., Higuchi, R.G. and Wilson, A.C., 1989. Ancient DNA and the polymerase chain reaction, the emerging field of molecular archeology. J. Biol. Chem., 264:9709-9712. Rowland, A.C. and Lawson, G.H.K., 1974. Intestinal adenomatosis in the pig: immunofluorescent and electron microscopic studies. Res. Vet. Sci., 17: 323-330. Rowland, A.C. and Lawson, G.H.K., 1992. Porcine proliferative enteropathies. In: A.D. Leman, B. Straw, W.L. Mengeling, S. D'Allaire and D.J. Taylor (Eds.), Diseases of Swine, 7th edition. Iowa State University Press, Ames, Iowa, USA. pp. 560-569.