- Email: [email protected]
Polymerase chain reaction for laboratory diagnosis of orf virus infections
Journal of Clinical Virology 24 (2002) 79 – 84 www.elsevier.com/locate/jcv
Polymerase chain reaction for laboratory diagnosis of orf virus infections Einar G. Torfason *, Sigru´n Guðnado´ttir Department of Medical Virology, Landspı´tali-Uni6ersity Hospital, PO Box 8733, IS-128 Reykja6ik, Iceland Received 16 April 2001; accepted 31 August 2001
Abstract Background: The orf virus of sheep and goats is one of several zoonotic parapoxviruses. In the ovine/caprine host it causes contagious ecthyma (contagious pustular dermatitis, scabby mouth), but in humans it normally causes solitary or clustered orf lesions, typically on hands, arms or face. In addition to disease in the animals, the virus can be quite a nuisance as an occupational hazard in farmers and butchers. Clinical diagnosis is often possible, but laboratory diagnosis is sometimes necessary. For virus isolation, primary ovine or bovine cells, not routinely present, are needed. Serological methods exist, but electron microscopy is the most commonly used method. Objecti6es: To develop a reliable method for the laboratory diagnosis of orf zoonoses, without virus culture and without access to an electron microscope. Study design: A suitable primer pair was designed for orf polymerase chain reaction (PCR), using the Oligo software and sequence information from GenBank. Orf positive controls and specimens were kindly provided by several public health centers. Molluscum contagiosum specimens were provided by a dermatologist. HSV-1, HSV-2 and VZV positive swab specimens came from our routine diagnostic service. Asymptomatic skin specimens were obtained from sheep heads from the abattoir, and swab specimens from the heads of asymptomatic sheep. Selected amplified orf PCR positive specimens were sequenced to ensure the authenticity of the PCR products. Orf positive specimens were sent to another laboratory for electron microscopy. Results and conclusions: A robust PCR was developed, with very small inter-run variation. All specificity demands were met, and the sensitivity seems to be good or excellent. All negative specificity controls from cell cultures and non-orf viruses were negative. Twenty-two (95.7%) of 23 scab or swab specimens with suspected orf etiology were orf PCR positive. Five of eight skin specimens from sheep heads from the abattoir were positive, and all 11 swab specimens from asymptomatic sheep were negative. Electron microscopy demonstrated orf-like particles in orf-PCR positive specimens. This PCR seems to be suitable as a diagnostic test for orf in humans, but asymptomatic virus shedding in sheep or goats may complicate veterinary applications of the assay. © 2002 Elsevier Science B.V. All rights reserved. Keywords: Contagious ecthyma; Contagious pustular dermatitis; Parapoxvirus; Scabby mouth; Zoonosis
1. Introduction * Corresponding author. Tel.: + 354-560-2400; fax: + 354560-2406. E-mail address: [email protected] (E.G. Torfason).
The orf virus is the type species of the parapox6irus genus. It is the causal agent of conta-
1386-6532/02/$ - see front matter © 2002 Elsevier Science B.V. All rights reserved. PII: S 1 3 8 6 - 6 5 3 2 ( 0 1 ) 0 0 2 3 2 - 3
80
E.G. Torfason, S. Guðnado´ttir / Journal of Clinical Virology 24 (2002) 79–84
gious ecthyma (contagious pustular dermatitis, scabby mouth) in sheep and goats worldwide (Fenner, 1996; Murphy et al., 1999). The orf virus can also infect other ruminants, as well as humans. Other zoonotic parapoxviruses are pseudocowpox virus (paravaccinia, milker’s nodule) and bovine papular stomatitis virus in cattle, ausdyk virus in camels, and seal parapox virus in grey seals (Fenner, 1996; Murphy et al., 1999). Zoonotic parapoxviruses in Finnish and Norwegian reindeer and Norwegian musk ox have been reported (Bu¨ ttner et al., 1995; Falk, 1978). Parapoxviruses have also been found in chamois antelopes, red deer and squirrels (Fenner, 1996; Murphy et al., 1999; Haig et al., in press). The virus particles are ovoid, 260 by 160 nm, containing : 135 kbp linear dsDNA with closed hairpin loop ends (Moss, 1996). Genes are located on both strands with left and right orientation. Variation is greatest near the termini, but essential genes are located in the conserved central part of the genome. The viral DNA and RNA polymerases are eucaryotic-like. At least eight genes encode the viral RNA polymerase complex. Infectivity is resistant to organic solvents and desiccation but is destroyed by heating to 58– 60 °C for 30 min (Fenner, 1996; Moss, 1996). In sheep and goats the lesions commonly appear on the muzzle and lips (scabby mouth), sometimes also affecting the gums and tongue, especially in young lambs. Eyelids, feet and teats can also be affected (Murphy et al., 1999). Severe facial and oral lesions in lambs may interfere with suckling. Ewes suckling infected lambs may develop lesions on their udders (Fenner, 1996). Reinfection, chronic infections, and virus remaining viable in scabs shed by infected animals make the virus difficult to eradicate from flocks, but vaccination of ewes with commercial non-attenuated virus several weeks before lambing can minimize the risk of orf in young lambs (Baxby, 1998; Murphy et al., 1999). Zoonosis occurs most frequently during lambing, shearing, docking, drenching or slaughtering (Murphy et al., 1999). Infection occurs through abrasions in the skin. Lesions in humans proceed from macular through papular to large nodules, sometimes papillomatous, following an incuba-
tion period of 2–4 days (Murphy et al., 1999). The lesions are most often localized on hands, arms or face. Solitary lesions are more frequent than multiple lesions. Duration is from 4 to 9 weeks (Murphy et al., 1999), usually 6– 7 weeks (Buchan, 1996). Healing is complete without scars, but secondary infections may retard healing. Fever, swelling of the draining lymph nodes or blindness following an eye infection are seen only rarely. Erythema multiforme, toxic erythema or allergic reaction, as well as blisters on arms, body, face or mouth in association with orf have been reported in at least one study (Buchan, 1996). Reinfection in humans is frequent (Buchan, 1996; Murphy et al., 1999), but usually less severe (Haig et al., in press). The purpose of the present study was to develop a reliable method for the laboratory diagnosis of orf zoonoses. Orf in humans can resemble or coincide with herpes or papilloma and possibly other infections. Several specimens are sent to our laboratory each year with requests for orf diagnostics. Electron microscopy is widely used for diagnosis of ‘orf/paravaccinia’ (Baxby, 1998; Murphy et al., 1999), but we do not have access to an electron microscope. Until now, virus isolation under suboptimal conditions has been the sole available method in our laboratory. Appropriate primary cell cultures for orf isolation are not routinely available, and virus isolation attempts have therefore aimed at excluding other viruses, rather than isolating the orf agent itself. Therefore, we decided to develop polymerase chain reaction (PCR) for the laboratory diagnosis of orf infections. We decided to design a new assay from orf sequence information and aim at sufficient sensitivity for original specimens, without any need for tissue culture enhancement. One of the obstacles we had to encounter was the lack of positive reference material, because we had never isolated the virus, and attempts to acquire orf strains from abroad have not met with success. Therefore, we sent a circular to rural public health centers in Iceland, requesting viral culture specimens from lesions with the clinical diagnosis of orf. This elicited a good response and we got some orf positive specimens to start with.
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
2. Materials and methods
2.1. Primer design Orf sequence information was downloaded from GenBank. A 5261 bp sequence denominated ‘ORF-RPA’ (Accession number U33419), which is similar to the A24R gene of vaccinia (U30342, Mercer et al., 1995) was selected as a suitable target. This gene encodes RPO132, a major component of the viral RNA polymerase (Moss, 1996). The following primers flanking a 140 bp sequence (including the primers) at position 985– 1125 were selected with the Oligo software.
81
from non-infected human, simian and ovine cell cultures, as well as from an untyped human adenovirus, herpes simplex type 1 and 2 viruses, varicella-zoster virus, human cytomegalovirus, human papilloma type 18 virus and Coxsackie B4 virus. Non-orf parapoxviruses were not available in our laboratory.
2.3. Preparation of specimens for PCR
Orf2: tgagctggttggcgctgtcct
The specimens were extracted with phenol:chloroform:isoamyl alcohol (25:24:1), precipitated with sodium acetate and isopropanol, washed with 70% ethanol, and resuspended in 100 ml of lysis buffer (10 mM Tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 1 mg/ml gelatin, 0.45% NP40, 0.45% Tween 20).
2.2. Specimens and controls
2.4. Composition of PCR reaction mixture
The present study included the following specimens.)\ Twenty-three scab or swab specimens from 21 humans and one sheep with suspected orf. Two human serum specimens where orf was suspected. Three biopsies and one swab from three individuals with molluscum contagiosum. Three HSV-1 positive, two HSV-2 positive and two VZV positive swab specimens from seven individuals with lesions caused by these herpesviruses. Eight :0.5 cm2 healthy skin specimens from the area around the horn base of five sheep heads that another research group had obtained from the abattoir. Five of these came from farms in the mid-south part of the country, and three from the southwest area. Eleven swab specimens from the horn area of the skin of ten asymptomatic sheep at a small hobby farm in the southwest part of Iceland.
PCR Buffer II 50 mM KCl, 10 mM Tris–HCl, pH 8.3 MgCl2 2.5 mM dNTPs 200 mM each Primers 0.5 mM each AmpliTaq 2.5 units in each 100 ml Gold reaction
Orf1: cgcagacgtggctgagtacgt
Positive controls were prepared from specimens with solid clinical evidence of orf and positive orf PCR where the PCR product had been sequenced to demonstrate orf specificity. Negative specificity controls were prepared
Of each specimen, 25 ml dissolved in lysis buffer or tenfold dilutions of this in water were added to 75 ml of a master mix. Reaction volume was 100 ml in thin-walled 0.2 ml tubes.
2.5. Cycling profile A hot-start, two temperature cycling profile was designed as follows in a PE9600 cycler. One cycle of 94 °C for 12 min (‘Gold’ enzyme activation). Forty cycles of 94 °C for 30 s and 68 °C for 45 s. One cycle of 65 °C for 3 min. Final soaking at 4 °C.
2.6. Electrophoresis Polyacrylamide gel electrophoresis was performed in 4–20% gradient minigels (Mighty Small
82
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
II, Hoefer) of acrylamide:bis-acrylamide, ratio 29:1. Twenty-five microliter of 5× gel loading buffer (2.5× TBE, 0.1% bromophenol blue, 20% sucrose) were mixed with 100 ml of each amplified specimen. Of this, 15 ml were loaded on 15-well 0.75 mm gels and run at 300 V in TBE buffer, stained with ethidium bromide, and photographed over UV-light at 300 nm. The presence of a 140 bp band was recorded as positive results.
2.7. Sequencing Eight amplified specimens from seven humans and one sheep were sent to CyberGene AB, Huddinge, Sweden, for dye terminator sequencing of both strands on an ABI PRISM 377 sequencer. This was done to demonstrate the specificity of the amplification, because none of the positive controls had been confirmed as orf by laboratory tests. The specimens represented different districts in Iceland, separated for decades with fences to prevent spread of ovine diseases. This was done to see if there is any strain variation within this relatively short sequence.
2.8. Electron microscopy One orf-PCR positive original specimen and one orf-inoculated cell culture specimen were sent to another laboratory for electron microscopy.
3. Results A first trial run of the orf PCR with standard AmpliTaq polymerase under conditions otherwise as specified in Section 2 yielded relatively faint bands at 140 bp with orf positive specimens, and a considerable amount of non-specific products and artefacts. In contrast, when AmpliTaq Gold polymerase was substituted for the normal AmpliTaq enzyme, the 140 bp bands became sharp and intensive, and the background and primer artefacts in the gel became minimal. The 140 bp amplicon was obtained only with the positive specimens and controls (Fig. 1). Twenty-two (95.7%) of 23 scab or swab specimens where orf was suspected were orf PCR positive, and one scab specimen submitted as ‘probably orf’ was negative. The two human serum specimens were both orf PCR negative. The four molluscum contagiosum specimens and the seven swab specimens from HSV-1, HSV-2 and VZV lesions were all negative. All five skin specimens from sheep heads from the mid-south region were orf PCR positive, two of them low-positive. In contrast, all three sheep skin specimens from the southwest region were negative. All 11 swab specimens from asymptomatic sheep in the southwest region were negative. The negative specificity controls prepared from non-infected cell cultures and non-orf viruses were all orf PCR negative. Sequencing of eight of the
Fig. 1. Polyacrylamide gel electrophoresis of orf PCR positive and negative specimens and controls. Lane 1: marker (pBR322 Hae III digest), lanes 2 –6: orf positive human specimens, lane 7: herpes simplex type 1 virus, lane 8: varicella-zoster virus, lane 9: Coxsackie B4 virus, lane 10: human papilloma virus type 18, lane 11: herpes simplex type 2 virus, lanes 12 – 13: orf positive sheep skin specimens, lane 14: negative control (lysis buffer, no template), and lane 15: positive control.
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
83
Fig. 2. Sequence comparison of GenBank sequence U33419 and eight amplified orf positive specimens. Primer sequences are shown in boldface.
amplified positive specimens (Fig. 2) demonstrated that the amplicons were almost identical to the original sequence in GenBank, validating these specimens as positive controls. Geographical isolation of flocks of sheep for decades did not produce variation in this particular sequence. Electron microscopy (Fig. 3) demonstrated the presence of ‘brick shaped’ particles, :140 ×88 nm, presumably naked orf virus particles. 4. Discussion Our orf PCR seems to be quite sensitive, and we have seen only minimal inter-run variation. Reading of results is easy, because the background is negligible around the size (140 bp) of the orf amplicon. Molluscum contagiosum, a common poxviral infection in humans, does not react in this PCR. Therefore, this PCR seems suitable for laboratory diagnosis of orf in humans. The negative results with two human serum specimens is consistent with the fact that orf lesions are normally singular or as a localized cluster. This may indicate that viremia is rare. The five positive skin specimens from sheep heads indicate that orf may be present in considerable amounts where sheep are around. There were absolutely no visible lesions on any of the sheep heads. Therefore, the origin of the virus particles is uncertain, but virus contamination from other individuals in the herd seems likely. This should be kept in mind if this PCR is used for laboratory diagnosis of orf in animals, and also in humans shortly after exposure to environment where sheep or goats are present. In one human an infection of a little finger seemed to persist for at least 14 weeks, and swab specimens collected at 3 weeks and 14 weeks after the onset of symptoms were both orf PCR positive, see lanes 4 and 5 in Fig. 1. When the first specimen
was collected, there was one lesion, described as ‘abscess like’, that had been unsuccessfully cultivated and treated for bacteria. Differential diagnosis for herpes vs. orf was requested. When the second specimen was collected, a second lesion had developed on the same finger after surgical intervention. It is unclear whether the surgical intervention may have complicated the course and the duration of the clinical infection, which according to textbooks does normally not exceed 9 weeks (Murphy et al., 1999). One of the orf-PCR positive specimens was from a garbage disposal worker with orf-like lesions on fingers and the scalp. He had not been in any contact with sheep, but he had been working with garbage containers from an abattoir. One week later his fiance´ e developed an orf PCR positive lesion on one of her thumbs. She had not either been in any contact with sheep.
Fig. 3. Composite picture of four electron micrographs of orf-like particles seen in orf-PCR positive specimens.
84
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
Acknowledgements We thank the doctors and other medical professionals at various medical centers, who responded so well to our requests for positive orf controls. We also thank Dr Arthur Lo¨ ve for his share in our requests for the orf controls, and professor emeritus Margre´ t Gudnado´ ttir for letting us obtain skin samples from sheep heads in her possession, and for collecting swab specimens from sheep at her hobby farm. Last, but not least, we ´ lafsson for collecting the thank Dr Jo´ n Hjaltalı´n O molluscum contagiosum specimens in this study.
References Baxby D. Poxviruses. In: Collier L, Balows A, Sussman M, Mahy BWJ, editors. Topley and Wilson’s microbiology and microbial infections, virology, vol. 1, 9th ed. London: Arnold, 1998:367 – 83. Buchan J. Characteristics of orf in a farming community in mid-Wales. Br Med J 1996;313:203 –4.
Bu¨ ttner M, von Einem C, McInnes C, Oksanen A. Klinik und Diagnostik einer schweren Parapocken-Epidemie beim Rentier in Finnland. Tiera¨ rztl Prax 1995;23:614 – 8. Falk E. Parapoxvirus infections of reindeer and musk ox associated with unusual human infections. Br J Dermatol 1978;99:647 – 54. Fenner F. Poxviruses. In: Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, et al., editors. Fields virology, vol. 2, 3rd ed. Philadelphia: Lippincott – Raven Publishers, 1996:2673 – 702. Haig DM, McInnes CJ, Nettleton PF. Orf. Moredun Research Institute http://www.mri.sari.ac.uk/immunology/orfrev.htm. Mercer AA, Lyttle DJ, Whelan EM, Fleming SB, Sullivan JT. The establishment of a genetic map of orf virus reveals a pattern of genomic organization that is highly conserved among divergent poxviruses. Virology 1995;212:698 – 704. Moss B. Poxviridae: the viruses and their replication. In: Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, et al., editors. Fields virology, vol. 2, 3rd ed. Philadelphia: Lippincott – Raven Publishers, 1996:2637 – 71. Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ. Poxviridae. In: Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ, editors. Veterinary virology, 3rd ed. San Diego: Academic Press, 1999:277 – 91.
Polymerase chain reaction for laboratory diagnosis of orf virus infections Einar G. Torfason *, Sigru´n Guðnado´ttir Department of Medical Virology, Landspı´tali-Uni6ersity Hospital, PO Box 8733, IS-128 Reykja6ik, Iceland Received 16 April 2001; accepted 31 August 2001
Abstract Background: The orf virus of sheep and goats is one of several zoonotic parapoxviruses. In the ovine/caprine host it causes contagious ecthyma (contagious pustular dermatitis, scabby mouth), but in humans it normally causes solitary or clustered orf lesions, typically on hands, arms or face. In addition to disease in the animals, the virus can be quite a nuisance as an occupational hazard in farmers and butchers. Clinical diagnosis is often possible, but laboratory diagnosis is sometimes necessary. For virus isolation, primary ovine or bovine cells, not routinely present, are needed. Serological methods exist, but electron microscopy is the most commonly used method. Objecti6es: To develop a reliable method for the laboratory diagnosis of orf zoonoses, without virus culture and without access to an electron microscope. Study design: A suitable primer pair was designed for orf polymerase chain reaction (PCR), using the Oligo software and sequence information from GenBank. Orf positive controls and specimens were kindly provided by several public health centers. Molluscum contagiosum specimens were provided by a dermatologist. HSV-1, HSV-2 and VZV positive swab specimens came from our routine diagnostic service. Asymptomatic skin specimens were obtained from sheep heads from the abattoir, and swab specimens from the heads of asymptomatic sheep. Selected amplified orf PCR positive specimens were sequenced to ensure the authenticity of the PCR products. Orf positive specimens were sent to another laboratory for electron microscopy. Results and conclusions: A robust PCR was developed, with very small inter-run variation. All specificity demands were met, and the sensitivity seems to be good or excellent. All negative specificity controls from cell cultures and non-orf viruses were negative. Twenty-two (95.7%) of 23 scab or swab specimens with suspected orf etiology were orf PCR positive. Five of eight skin specimens from sheep heads from the abattoir were positive, and all 11 swab specimens from asymptomatic sheep were negative. Electron microscopy demonstrated orf-like particles in orf-PCR positive specimens. This PCR seems to be suitable as a diagnostic test for orf in humans, but asymptomatic virus shedding in sheep or goats may complicate veterinary applications of the assay. © 2002 Elsevier Science B.V. All rights reserved. Keywords: Contagious ecthyma; Contagious pustular dermatitis; Parapoxvirus; Scabby mouth; Zoonosis
1. Introduction * Corresponding author. Tel.: + 354-560-2400; fax: + 354560-2406. E-mail address: [email protected] (E.G. Torfason).
The orf virus is the type species of the parapox6irus genus. It is the causal agent of conta-
1386-6532/02/$ - see front matter © 2002 Elsevier Science B.V. All rights reserved. PII: S 1 3 8 6 - 6 5 3 2 ( 0 1 ) 0 0 2 3 2 - 3
80
E.G. Torfason, S. Guðnado´ttir / Journal of Clinical Virology 24 (2002) 79–84
gious ecthyma (contagious pustular dermatitis, scabby mouth) in sheep and goats worldwide (Fenner, 1996; Murphy et al., 1999). The orf virus can also infect other ruminants, as well as humans. Other zoonotic parapoxviruses are pseudocowpox virus (paravaccinia, milker’s nodule) and bovine papular stomatitis virus in cattle, ausdyk virus in camels, and seal parapox virus in grey seals (Fenner, 1996; Murphy et al., 1999). Zoonotic parapoxviruses in Finnish and Norwegian reindeer and Norwegian musk ox have been reported (Bu¨ ttner et al., 1995; Falk, 1978). Parapoxviruses have also been found in chamois antelopes, red deer and squirrels (Fenner, 1996; Murphy et al., 1999; Haig et al., in press). The virus particles are ovoid, 260 by 160 nm, containing : 135 kbp linear dsDNA with closed hairpin loop ends (Moss, 1996). Genes are located on both strands with left and right orientation. Variation is greatest near the termini, but essential genes are located in the conserved central part of the genome. The viral DNA and RNA polymerases are eucaryotic-like. At least eight genes encode the viral RNA polymerase complex. Infectivity is resistant to organic solvents and desiccation but is destroyed by heating to 58– 60 °C for 30 min (Fenner, 1996; Moss, 1996). In sheep and goats the lesions commonly appear on the muzzle and lips (scabby mouth), sometimes also affecting the gums and tongue, especially in young lambs. Eyelids, feet and teats can also be affected (Murphy et al., 1999). Severe facial and oral lesions in lambs may interfere with suckling. Ewes suckling infected lambs may develop lesions on their udders (Fenner, 1996). Reinfection, chronic infections, and virus remaining viable in scabs shed by infected animals make the virus difficult to eradicate from flocks, but vaccination of ewes with commercial non-attenuated virus several weeks before lambing can minimize the risk of orf in young lambs (Baxby, 1998; Murphy et al., 1999). Zoonosis occurs most frequently during lambing, shearing, docking, drenching or slaughtering (Murphy et al., 1999). Infection occurs through abrasions in the skin. Lesions in humans proceed from macular through papular to large nodules, sometimes papillomatous, following an incuba-
tion period of 2–4 days (Murphy et al., 1999). The lesions are most often localized on hands, arms or face. Solitary lesions are more frequent than multiple lesions. Duration is from 4 to 9 weeks (Murphy et al., 1999), usually 6– 7 weeks (Buchan, 1996). Healing is complete without scars, but secondary infections may retard healing. Fever, swelling of the draining lymph nodes or blindness following an eye infection are seen only rarely. Erythema multiforme, toxic erythema or allergic reaction, as well as blisters on arms, body, face or mouth in association with orf have been reported in at least one study (Buchan, 1996). Reinfection in humans is frequent (Buchan, 1996; Murphy et al., 1999), but usually less severe (Haig et al., in press). The purpose of the present study was to develop a reliable method for the laboratory diagnosis of orf zoonoses. Orf in humans can resemble or coincide with herpes or papilloma and possibly other infections. Several specimens are sent to our laboratory each year with requests for orf diagnostics. Electron microscopy is widely used for diagnosis of ‘orf/paravaccinia’ (Baxby, 1998; Murphy et al., 1999), but we do not have access to an electron microscope. Until now, virus isolation under suboptimal conditions has been the sole available method in our laboratory. Appropriate primary cell cultures for orf isolation are not routinely available, and virus isolation attempts have therefore aimed at excluding other viruses, rather than isolating the orf agent itself. Therefore, we decided to develop polymerase chain reaction (PCR) for the laboratory diagnosis of orf infections. We decided to design a new assay from orf sequence information and aim at sufficient sensitivity for original specimens, without any need for tissue culture enhancement. One of the obstacles we had to encounter was the lack of positive reference material, because we had never isolated the virus, and attempts to acquire orf strains from abroad have not met with success. Therefore, we sent a circular to rural public health centers in Iceland, requesting viral culture specimens from lesions with the clinical diagnosis of orf. This elicited a good response and we got some orf positive specimens to start with.
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
2. Materials and methods
2.1. Primer design Orf sequence information was downloaded from GenBank. A 5261 bp sequence denominated ‘ORF-RPA’ (Accession number U33419), which is similar to the A24R gene of vaccinia (U30342, Mercer et al., 1995) was selected as a suitable target. This gene encodes RPO132, a major component of the viral RNA polymerase (Moss, 1996). The following primers flanking a 140 bp sequence (including the primers) at position 985– 1125 were selected with the Oligo software.
81
from non-infected human, simian and ovine cell cultures, as well as from an untyped human adenovirus, herpes simplex type 1 and 2 viruses, varicella-zoster virus, human cytomegalovirus, human papilloma type 18 virus and Coxsackie B4 virus. Non-orf parapoxviruses were not available in our laboratory.
2.3. Preparation of specimens for PCR
Orf2: tgagctggttggcgctgtcct
The specimens were extracted with phenol:chloroform:isoamyl alcohol (25:24:1), precipitated with sodium acetate and isopropanol, washed with 70% ethanol, and resuspended in 100 ml of lysis buffer (10 mM Tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 1 mg/ml gelatin, 0.45% NP40, 0.45% Tween 20).
2.2. Specimens and controls
2.4. Composition of PCR reaction mixture
The present study included the following specimens.)\ Twenty-three scab or swab specimens from 21 humans and one sheep with suspected orf. Two human serum specimens where orf was suspected. Three biopsies and one swab from three individuals with molluscum contagiosum. Three HSV-1 positive, two HSV-2 positive and two VZV positive swab specimens from seven individuals with lesions caused by these herpesviruses. Eight :0.5 cm2 healthy skin specimens from the area around the horn base of five sheep heads that another research group had obtained from the abattoir. Five of these came from farms in the mid-south part of the country, and three from the southwest area. Eleven swab specimens from the horn area of the skin of ten asymptomatic sheep at a small hobby farm in the southwest part of Iceland.
PCR Buffer II 50 mM KCl, 10 mM Tris–HCl, pH 8.3 MgCl2 2.5 mM dNTPs 200 mM each Primers 0.5 mM each AmpliTaq 2.5 units in each 100 ml Gold reaction
Orf1: cgcagacgtggctgagtacgt
Positive controls were prepared from specimens with solid clinical evidence of orf and positive orf PCR where the PCR product had been sequenced to demonstrate orf specificity. Negative specificity controls were prepared
Of each specimen, 25 ml dissolved in lysis buffer or tenfold dilutions of this in water were added to 75 ml of a master mix. Reaction volume was 100 ml in thin-walled 0.2 ml tubes.
2.5. Cycling profile A hot-start, two temperature cycling profile was designed as follows in a PE9600 cycler. One cycle of 94 °C for 12 min (‘Gold’ enzyme activation). Forty cycles of 94 °C for 30 s and 68 °C for 45 s. One cycle of 65 °C for 3 min. Final soaking at 4 °C.
2.6. Electrophoresis Polyacrylamide gel electrophoresis was performed in 4–20% gradient minigels (Mighty Small
82
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
II, Hoefer) of acrylamide:bis-acrylamide, ratio 29:1. Twenty-five microliter of 5× gel loading buffer (2.5× TBE, 0.1% bromophenol blue, 20% sucrose) were mixed with 100 ml of each amplified specimen. Of this, 15 ml were loaded on 15-well 0.75 mm gels and run at 300 V in TBE buffer, stained with ethidium bromide, and photographed over UV-light at 300 nm. The presence of a 140 bp band was recorded as positive results.
2.7. Sequencing Eight amplified specimens from seven humans and one sheep were sent to CyberGene AB, Huddinge, Sweden, for dye terminator sequencing of both strands on an ABI PRISM 377 sequencer. This was done to demonstrate the specificity of the amplification, because none of the positive controls had been confirmed as orf by laboratory tests. The specimens represented different districts in Iceland, separated for decades with fences to prevent spread of ovine diseases. This was done to see if there is any strain variation within this relatively short sequence.
2.8. Electron microscopy One orf-PCR positive original specimen and one orf-inoculated cell culture specimen were sent to another laboratory for electron microscopy.
3. Results A first trial run of the orf PCR with standard AmpliTaq polymerase under conditions otherwise as specified in Section 2 yielded relatively faint bands at 140 bp with orf positive specimens, and a considerable amount of non-specific products and artefacts. In contrast, when AmpliTaq Gold polymerase was substituted for the normal AmpliTaq enzyme, the 140 bp bands became sharp and intensive, and the background and primer artefacts in the gel became minimal. The 140 bp amplicon was obtained only with the positive specimens and controls (Fig. 1). Twenty-two (95.7%) of 23 scab or swab specimens where orf was suspected were orf PCR positive, and one scab specimen submitted as ‘probably orf’ was negative. The two human serum specimens were both orf PCR negative. The four molluscum contagiosum specimens and the seven swab specimens from HSV-1, HSV-2 and VZV lesions were all negative. All five skin specimens from sheep heads from the mid-south region were orf PCR positive, two of them low-positive. In contrast, all three sheep skin specimens from the southwest region were negative. All 11 swab specimens from asymptomatic sheep in the southwest region were negative. The negative specificity controls prepared from non-infected cell cultures and non-orf viruses were all orf PCR negative. Sequencing of eight of the
Fig. 1. Polyacrylamide gel electrophoresis of orf PCR positive and negative specimens and controls. Lane 1: marker (pBR322 Hae III digest), lanes 2 –6: orf positive human specimens, lane 7: herpes simplex type 1 virus, lane 8: varicella-zoster virus, lane 9: Coxsackie B4 virus, lane 10: human papilloma virus type 18, lane 11: herpes simplex type 2 virus, lanes 12 – 13: orf positive sheep skin specimens, lane 14: negative control (lysis buffer, no template), and lane 15: positive control.
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
83
Fig. 2. Sequence comparison of GenBank sequence U33419 and eight amplified orf positive specimens. Primer sequences are shown in boldface.
amplified positive specimens (Fig. 2) demonstrated that the amplicons were almost identical to the original sequence in GenBank, validating these specimens as positive controls. Geographical isolation of flocks of sheep for decades did not produce variation in this particular sequence. Electron microscopy (Fig. 3) demonstrated the presence of ‘brick shaped’ particles, :140 ×88 nm, presumably naked orf virus particles. 4. Discussion Our orf PCR seems to be quite sensitive, and we have seen only minimal inter-run variation. Reading of results is easy, because the background is negligible around the size (140 bp) of the orf amplicon. Molluscum contagiosum, a common poxviral infection in humans, does not react in this PCR. Therefore, this PCR seems suitable for laboratory diagnosis of orf in humans. The negative results with two human serum specimens is consistent with the fact that orf lesions are normally singular or as a localized cluster. This may indicate that viremia is rare. The five positive skin specimens from sheep heads indicate that orf may be present in considerable amounts where sheep are around. There were absolutely no visible lesions on any of the sheep heads. Therefore, the origin of the virus particles is uncertain, but virus contamination from other individuals in the herd seems likely. This should be kept in mind if this PCR is used for laboratory diagnosis of orf in animals, and also in humans shortly after exposure to environment where sheep or goats are present. In one human an infection of a little finger seemed to persist for at least 14 weeks, and swab specimens collected at 3 weeks and 14 weeks after the onset of symptoms were both orf PCR positive, see lanes 4 and 5 in Fig. 1. When the first specimen
was collected, there was one lesion, described as ‘abscess like’, that had been unsuccessfully cultivated and treated for bacteria. Differential diagnosis for herpes vs. orf was requested. When the second specimen was collected, a second lesion had developed on the same finger after surgical intervention. It is unclear whether the surgical intervention may have complicated the course and the duration of the clinical infection, which according to textbooks does normally not exceed 9 weeks (Murphy et al., 1999). One of the orf-PCR positive specimens was from a garbage disposal worker with orf-like lesions on fingers and the scalp. He had not been in any contact with sheep, but he had been working with garbage containers from an abattoir. One week later his fiance´ e developed an orf PCR positive lesion on one of her thumbs. She had not either been in any contact with sheep.
Fig. 3. Composite picture of four electron micrographs of orf-like particles seen in orf-PCR positive specimens.
84
E.G. Torfason, S. Guðnado´ ttir / Journal of Clinical Virology 24 (2002) 79–84
Acknowledgements We thank the doctors and other medical professionals at various medical centers, who responded so well to our requests for positive orf controls. We also thank Dr Arthur Lo¨ ve for his share in our requests for the orf controls, and professor emeritus Margre´ t Gudnado´ ttir for letting us obtain skin samples from sheep heads in her possession, and for collecting swab specimens from sheep at her hobby farm. Last, but not least, we ´ lafsson for collecting the thank Dr Jo´ n Hjaltalı´n O molluscum contagiosum specimens in this study.
References Baxby D. Poxviruses. In: Collier L, Balows A, Sussman M, Mahy BWJ, editors. Topley and Wilson’s microbiology and microbial infections, virology, vol. 1, 9th ed. London: Arnold, 1998:367 – 83. Buchan J. Characteristics of orf in a farming community in mid-Wales. Br Med J 1996;313:203 –4.
Bu¨ ttner M, von Einem C, McInnes C, Oksanen A. Klinik und Diagnostik einer schweren Parapocken-Epidemie beim Rentier in Finnland. Tiera¨ rztl Prax 1995;23:614 – 8. Falk E. Parapoxvirus infections of reindeer and musk ox associated with unusual human infections. Br J Dermatol 1978;99:647 – 54. Fenner F. Poxviruses. In: Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, et al., editors. Fields virology, vol. 2, 3rd ed. Philadelphia: Lippincott – Raven Publishers, 1996:2673 – 702. Haig DM, McInnes CJ, Nettleton PF. Orf. Moredun Research Institute http://www.mri.sari.ac.uk/immunology/orfrev.htm. Mercer AA, Lyttle DJ, Whelan EM, Fleming SB, Sullivan JT. The establishment of a genetic map of orf virus reveals a pattern of genomic organization that is highly conserved among divergent poxviruses. Virology 1995;212:698 – 704. Moss B. Poxviridae: the viruses and their replication. In: Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, et al., editors. Fields virology, vol. 2, 3rd ed. Philadelphia: Lippincott – Raven Publishers, 1996:2637 – 71. Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ. Poxviridae. In: Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ, editors. Veterinary virology, 3rd ed. San Diego: Academic Press, 1999:277 – 91.