Polymorphisms in feline tumour suppressor gene p53.Mutations in an osteosarcoma and a mammary carcinoma

÷

The I/etelqnmTJourna11998, 155, 1[)3-106

Short Communication Polymorphisms in Feline Tumour Suppressor Gene p53. Mutations in an Osteosarcoma and a Mammary Carcinoma B. IVlAYR*,M. REIFINGERt and G. L O U P A L t

*hlstitute fin AnimaI Breeding and Genetics, and ?lnstitute for Patholog),, Vete~qnaD, Uniw,rsity, Jos~ Baumanngasse I, A-1210 Vienna, Austria

KrXWORDS:Polymorphisms; feline p53; introns 7 and 8; missense mutation; deletion; exons 7 and 8.

A comparison of the amino acid sequences of tumour suppressor gene p53 from a variety of species has revealed structural features of this protein, giving clues to its functions and indicating that flexibility plays a key role in regulation of its biological activity (Cooper, 1995; Soussi & May, 1996). p53 aberrations are the most common genetic alterations found in human turnouts, including cancers of the breast, hmg, gastrointestinal tract, genito-urinary tract and others (Bosari & Viale, 1996). Although, the focus of studies has been restricted to human p53, investigations concerning other species, especially the mouse yacks, 1996), are also available. The purpose of the present study was to assess whether p53 is also associated with turnours in cats. The feline p53 gene has been cloned, mapped to chromosome E1 and partially sequenced (Okuda et aL, 1993, 1994), but sequence data were limited to cDNA sequence. In an attempt to characterize the p53, we have already sequenced intron 5 (Mayr et aL, 1995), and here we describe the sequences of introns 6 and 7 in 50 healthy and 25 tumour bearing cats, as well as sequence analysis of exons 6, 7 and 8 in all 75 cats. The 25 turnouts were diagnosed as 10 adenocarcinomas (mammary gland), seven basaliomas and one osteosarcoma (World Health Organisation, 1974, 1976) and there were seven malignant fibrous histiocytomas (Pulley & Stannash, 1990). DNA was extracted from blood and tissues by means of an efficient salt-chloroform extraction procedure (MOllenbach et al., 1989). Two primer pairs were used. One primer pair (21 bp each) used was sense ... 5'AGCATCTCATCCGAGTGGAAG3'/ antisense 1090-0933/98/01010fi-04/$12.00/0

5'ATGCAGGAACTGTTACACATG3', the second primer pair (20 bp and 24 bp, respectively) was 5'GTCGGCTCTGACTGTACCAC3' and antisense 5'CTCAGGACAAGGCTCCCCCTTCT-I'3'. The polymerase chain reaction (PCR) buffer was composed of 50 mM NaCI, 10 mM Tris-HCl, pH 8.0; 1.5 mM MgClz. The enzyme Ampli-Taq-DNA polymerase (Perkin-Elmer-Cetus) was used and 35 amplification cycles were performed. Each temperature cycle consisted of template denaturation (3 min at 97°C), primer annealing (1 min at 53°C) and extension (1 min at 73°C). The PCR products (325bp spanning from codons 192-243 and 489 bp from codons 225-298, respectively) were analysed by 4% NuSieve/agarose gel electrophoresis. Amplification resulted in a single discrete band, and no nonspecific bands were observed. The products were eluted from the 4% NuSieve/agarose gels, following the GenecleanII Kit (Bio 101 Inc., LaJolla, CA, USA). The PCRproducts were sequenced directly avoiding potential sampling errors that could have arisen if we had cloned the PCR-products and sequenced one or only a few clones/cat. Sequencing was performed on a ABI 373 A using a Taq Dye Deoxy Terminator Cycle Sequencing Kit, according to the manufacturers instructions (Applied Biosystems). All sequences were obtained for both strands. The DNA was amplified and sequenced three times in order to exclude PCR artefacts. The sequence from codon 210 of exon 6 to codon 285 in exon 8 is shown in Fig. 1. The GenBank database accession numbers of the newly sequenced introns 6 and 7 are GenBank U81297 and U81298, respectively. The codon numbering was derived from the human sequence. The reason for this procedure was the stringent need for © 1998 Bailli~re Tindall

104

THE VETERINARY JOURNAL, 155, 1

210 AAC N

211 ACT T

223 CCC P

224 GAG E

212 TTC F

213 CGA R

214 CAT H

215 AGC S

216 GTC V

217 GTG V

218 GTG V

219 CCC P

220 TAC Y

221 GAG E

222 CCG P

gtctgctttggcatctggggtctctgggaggaggtgggggaggggtttgtcagcggccgtcca ggtgggagatggggggggctttctccttcttatgcaacctccccacggcCgcgtgcggtgtgc t acagccagccgggtggtccccagtgcacggttgaggaaaccagcctacacactgcaggcctgc ccggcgctgggtggcctcacicggccggatcttctctcccag

225 GTC V

226 GGC G

227 TCT S

228 GAC D

229 TGT C

230 ACC T

231 ACC T

232 ATC I

233 CAC H

234 TAC Y

235 AAT N

236 TTC F

237 ATG M

238 TGT C

239 AAC N

240 AGT S

241 TCC S

242 TGC C

243 ATG M

244 GGG G

245 GGC G

246 ATG M

247 AAC N

248 CGG R

249 AGG R

250 CCC P

251 ATC I

252 ATC I

253 ACC T

254 ATC I

255 ATC I

256 ACC T

257 CTG L

258 GAA E

259 GAC D

260 TCC S

AA

gta~ggacuc~ca

c t ~ccaccct~ccccaggccact

ct ct c c c g t g c t a c c g c c c a t

cccgcct

gtggaatccccgcctgtggaatctcctctgctgtcccccaccctccgcctccaagttttcttt tctctggctttgggaccttctcttacccggcttctcgatactccttaggcttttaggctccac ataggatgaaggaggtggggagtaaggggggccccatctccctcactgcctccagcttctgtc c ttcttatgtgggtag 261 T N

262 GGG G

263 AAG K

264 CTG L

265 CTG L

266 GGA G

267 CGG R

268 AAC N

269 AGC S

270 TTC F

271 GAG E

272 GTA V

273 CGA/CAA R/Q

274 GTT V

275 TGT C

276 GCC A

277 TGT C

278 CCT P

279 GGG G

2"80 AGA R

281 GAC D

282 CGG R

283 CGC R

284 ACC T

285 GAG E

Fig. 1. Sequence of feline partial e x o n 6, i n t r o n 6, e x o n 7, intron 7 and partial e x o n 8. Note the three T/C-polymorphic sites ( t / c ) in introns 6 and 7. Note also the transition G to A in c o d o n 273 of exon 8 d e t e c t e d in an osteosarcoma. This transition gives rise to the aminoacid change arginine to glutamine.

the gain o f easily interpretable data for c o m p a r a tive t u m o u r research. A somatic missense

m u t a t i o n CGA to CAA in c o d o n 273 o f e x o n 8 was d e t e c t e d in an o s t e o s a r c o m a o n the s h o u l d e r o f a

FELINE p53 POLYMORPHISMS AND MUTATIONS

Fig. 2. Osteosarcoma. Bar represents 30 gtm.

8 year old female cat (Fig. 2). This transition causes the amino acid change from arginine to glutamine. Both alleles CGA and CAA were present in this tumour, but the mutation was not detected in control blood material of this patient. Another mutation involved codons 251-256 of exon 7, which consist of a tandem repeat of two ATC - ATC - ACCs (isoleucine - isoleucine threonine). One of the ATC - ATC - ACCs was deleted in a tubulopapillary mammary adenocarcinoma of a 10 year old cat. The 50 healthy cats showed identical sequences with the exceptions of C / T polymorphic sites in the 107th position o f i n t r o n 6, the 14th position of intron 7 and the 259th position of intron 7. T-frequencies were 0.8 (position 107), 0.5 (position 14) and 0.5 (position 259) at each polymorphic site. Introns 6 and 7 proved to be 231 and 267 bp long. All of these cats were analysed for the genomic region between codon 210 and 285 (including introns 6 and 7) and the same region was subjected to the somatic mutation analysis in the 25 turnout bearing cats. It should be noted, that the human codons 273 and 251-256 correspond to 266 and 244-249 of the feline numbering (Okuda et al., 1993). The transition CGA to CAA (arginine to glutamine) in the osteosarcoma concerns codon 273 of exon 8, one of the most common neoplasm-associated human hot spots (Caron de Fromentel & Soussi, 1992; Levine et aL, 1994). The presence of both CGA and CAA sequences in the osteosarcoma may however reflect the contamination by normal cells, i.e., stroma. The mutation site in this osteosarcoma (codon 273) was very close to codon 282 reported in another case

105

(Mayr et al., 1994). The deletion in our tubulopapillary marrtmary carcinoma is the first reported deletion of p53 in a feline neoplasm. In a solid mammary carcinoma investigated in a previous study, a missense mutation was detected in exon 8 (Mayr et aL, 1995b). These findings together with other earlier reports on p53-mutations on a lymphosarcoma (Mayr et aL, 1993), fibrosarcomas (Mayr et aL, 1995a) and haematopoietic neoplasms (Okuda et aL, 1994) may represent evidence for the importance of p53-alterations in feline tumours. The presently detected polymorphic markers in the 6th and 7th intron provide a valuable tool for future loss of heterozygosity (LOH) studies and probably for diagnosis of certain tumours in cats. To date, the only known polymorphic site concerned a silent C/T-change in codon 163 (tyrosine) in exon 5 (Mayr et al., 1995a). It is hoped that this information on further sequencing data and the finding of polymorphic sites in the tumour suppressor gene p53 will provide assistance in the future characterization of this gene for tumour research.

ACKNOWI.EDGEMENTS The study was supported by the project 'Chromosomendefekte solider Neoplasmen bei H u n d und Katze' of the Austrian Fonds zur F6rderung der wissenschaftlichen Forschung.

REFERENCES BosAm, S. & V[ALE, G. (1995). The clinical significance of p53 aberrations in human tumours. VirchowsArchive 427, 229-41. CaRONOEFROMErCrEL,C. & Soussx,T. (1992). P53 tumour suppressor gene: a model for investigating human mutagenesis. Genes, Chromosomesand Cancer4,-15. COOPER, G. M. (1995). Tumor suppressor genes in human neoplasms. In: Oncogenes,Jones and Barrett" Publishers International, 2nd Edn. pp. 145-50. JACKS,T. (1996). Lessons from the p53 mutant mouse. Journal of Cancer Research in Clinical Oncology 122, 319-27. LEV1NE,A.J., PERRY,M. E., CHANG,A., SILVER,A., DITrMER, D., Wu, M. & WELSH, D. (1994). The 1993 Walter Hubert Lecture. The role of the p53 tumor suppressor gene in tumorigenesis. British Journal of Cancer69, 409-16. MAYR, B., HECZKO, U., SCHELLANDER,K., SCHLEGER,W. ~: REIFINGER, M. (1993). Sequence of an exon of the

106

THE VETERINARYJOURNAL, 155, 1

feline p53 gene-mutation in a lymphosarcoma. Bfftish Vete~naTyJourna1149, 387-90. MA~a, B. & RE.'WUNGER,M. (1994). Mutation in exon 8 of t u m o u r suppressor gene p53 in a feline osteosarcoma (Abstr.). Proceedings of the LS.A.G. IntenTational Socie(~, for Animal Genetics Conference, Prague. Animal Genetics, 44, (Suppl. E), 89. MA~, B., SCH.-WFNER,G., KURZBAUER, R., SCHNEIDER, A., RJ£[FINGER, M. & LOt'PAL, G. (1995a). Mutations in turnout suppressor gene p53 in two feline fibrosarcomas. B~4tish Veterina~),Jounm1151, 707-13. MA'~I~., B., SCHAFFNER,G., KURZBAUt'ZR,R., REIFINC;ER,M. & SCHELLANDER,K. (1995b). Sequence of an exon o f t u m o u r suppressor p53 g e n e - - c o m p a r a t i v e study in domestic animals. Mutation in a feline solid mammary carcinoma. B74tish Veterina~),Journa1151, 325-9. MC'I.LENSACH,J. P., L.XC;ODA,L. & WEI:rER, C. (1989). An efficient salt-chloroform extraction o f DNA blood and tissues. Trends in Genetics 5, -391. OKUDA, M., U~UED:X,A., M:VrSL'.~tOTO,Y. et al. (1993). Molecular cloning and c h r o m o s o m a l m a p p i n g of feline

p53 t u m o u r suppressor gene. Joumml of Veterinary Medidne Science 55, 801-5. OKVDA, M., UMEDA,A., SAg.&1,T. et al. (1994). Cloning o f feline p53 tumour-suppressor gene and its abberation in h e m a t o p o i e t i c tumors. International Journal of Cancer 58, 602-7. PUL.L.E',,T. & STANNASH,A. A. (1990). T u m o r s of the skin and soft tissues. In Mouhon, V. E. eds Tumors in Domestic Animals, 3rd Edn, pp. 23-87. California: University o f California Press. Soussl, T. 8,: MAY, P. (1996). Structural aspects of the p53 protein in relation to gene evohttion: a second look. Journal of Molecular Biolo~, 260, 623-37. WORLD HEM.TH ORGANISATION, (1974). International Iristological classification of tumours of domestic animals. Bulletin of the World Health 01~anisation 50, 1-2. D,rORl.I) Hl-:AI.rHORC;A~'ISATION, (1976). International histological classification of tumours o f domestic animals. Bulh,tin of the World Health O~anisation 50, 2-3.

(Acceptedfor publication 26 I:elnTtaly199~