- Email: [email protected]
NF‐κB pathway inhibition
Accepted Manuscript Title: Pomegranate protects liver against cecal ligation and puncture-induced oxidative stress and inflammation in rats through TLR4 /NF-B pathway inhibition Author: Mirhan N. Makled Mohammed S. El-Awady Rania R. Abdelaziz Nadia Atwan Emma T. Guns Nareman M. Gamil Ahmed B.Shehab El-Din Elsayed M. Ammar PII: DOI: Reference:
S1382-6689(16)30061-8 http://dx.doi.org/doi:10.1016/j.etap.2016.03.011 ENVTOX 2478
To appear in:
Environmental Toxicology and Pharmacology
Received date: Revised date: Accepted date:
4-2-2016 7-3-2016 12-3-2016
Please cite this article as: Makled, Mirhan N., El-Awady, Mohammed S., Abdelaziz, Rania R., Atwan, Nadia, Guns, Emma T., Gamil, Nareman M., ElDin, Ahmed B.Shehab, Ammar, Elsayed M., Pomegranate protects liver against cecal ligation and puncture-induced oxidative stress and inflammation in rats through TLR4/NF-rmkappaB pathway inhibition.Environmental Toxicology and Pharmacology http://dx.doi.org/10.1016/j.etap.2016.03.011 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Pomegranate protects liver against cecal ligation and puncture-induced oxidative stress and inflammation in rats through TLR4/NF-κB pathway inhibition
Mirhan N. Makled
1*
, Mohammed S. El-Awady 1, Rania R. Abdelaziz 1, Nadia Atwan 2,
Emma T. Guns 3, Nareman M. Gamil 1, Ahmed B. Shehab El-Din 4 and Elsayed M. Ammar 1
1
Department of Pharmacology and Toxicology, Faculty of Pharmacy;
2
Department of
Pathology, Faculty of Medicine and 4 Department of Nephrology and Urology, Faculty of Medicine, Mansoura University, Mansoura 35516, Egypt 3
Vancouver Prostate Centre, Department of Urologic Sciences, University of British
Columbia, Vancouver, British Columbia, Canada
* Corresponding author: Mirhan N. Makled, MSc Department of Pharmacology and Toxicology, Faculty of Pharmacy, Mansoura University, Mansoura 35516, EGYPT Tel. 002 050 2247496 Fax. 002 050 2247496 E-mail: [email protected]
-1-
Highlights
Pomegranate has antiinflammatory and antioxidant effects on CLP-acute liver injury. Pomegranate has ability to inhibit TLR4/NF-κB pathway and neutrophil infiltration. Pomegranate has ability to modulate lipid peroxidation and antioxidants levels.
Abstract: Acute liver injury secondary to sepsis is a major challenge in intensive care unit. This study is designed to investigate potential protective effects of pomegranate against sepsis-induced acute liver injury in rats and possible underlying mechanisms. Pomegranate was orally given (800 mg/kg/day) for two weeks before sepsis induction by cecal ligation and puncture (CLP). Pomegranate improved survival and attenuated liver inflammatory response, likely related to downregulation of mRNA expression of toll like recptor-4, reduced nuclear translocation and DNA binding activity of proinflammatory transcription factor NF-κB subunit p65, decreased mRNA and protein expression of tumor necrosis factor-alpha and reduction in myeloperoxidase activity and mRNA expression. Pomegranate also decreased CLP-induced oxidative stress as reflected by decreased malondialdehyde content, and increased reduced glutathione level and superoxide dismutase activity. These results confirm the antiinflammatory and antioxidant effects of pomegranate in CLP-induced acute liver injury mediated through inhibiting TLR4/NF-κB pathway, lipid peroxidation and neutrophil infiltration.
-2-
Abbreviations: CLP, cecal ligation and puncture; GSH, reduced glutathione; LDH, lactate dehydrogenase; MDA, malondialdehyde; MPO, myeloperoxidase; NF-κB, nuclear factor-κB; SOD, superoxide dismutase; TLR, toll-like receptor-4; TNF-α, tumor necrosis factor-α.
Keywords: Acute Liver injury, cecal ligation and puncture, pomegranate, toll-like receptor-4, nuclear factor-κB.
1. Introduction Liver diseases remain one of the serious health problems throughout the world associated with a high rate of morbidity and mortality (Pushpavalli et al., 2010). The impairment of liver is multifactorial where it may result from chronic use of alcohol, viral or bacterial or protozoal infection, drugs and other xenobiotics (Farghali et al., 2009). Today, millions of people worldwide suffer from various hepatic disorders. Among these hepatic disorders is acute hepatitis which is the most prevalent and occurs at many countries (Manna et al., 2007). Sepsis is a major clinical challenge in intensive care units causing acute liver injury. Cecal ligation and puncture (CLP) induced liver injury is a well-established model because it closely resembles the progression and characteristics of human sepsis in which liver injury is mediated through an inflammatory pathway (Dejager et al., 2011; Kobayashi et al., 2001).
-3-
Liver plays a central role in bacterial phagocytosis and clearance. The invading bacteria and their products are firstly captured and cleared by liver cells, which release several proinflammatory mediators, such as tumor necrosis factor- (TNF-) 𝛼, interleukin(IL-) 1, IL-6, interferon-𝛾, IL-8, nitric oxide, and reactive oxygen species (ROS), which cause liver injury (Dhainaut et al., 2001;Yan et al., 2014). It has been previously reported that attenuation of liver injury and restoration of liver function lowers morbidity and mortality rates in patients with sepsis (Yan et al., 2014). Acute liver injury induced by sepsis is largely initiated through activation of toll like receptors (TLR4) by bacterial products (e.g., LPS or lipoteicohoic acid or peptidoglycan) or cytokines (e.g., TNF-α or IL-1), which leads to activation of transcription factor-nuclear factor-kappa B (NF-κB),
resulting in enhanced transcription of genes
responsible for the expression of proinflammatory cytokines such as TNF-α, chemokines, adhesion molecules, apoptotic factors, and other mediators of the inflammatory response associated with sepsis (Abraham, 2003;Liu et al., 2015). NF-κB is a major player in regulating the expression of many immunoregulatory mediators implicated in oxidative stress and consequently in sepsis (Sakaguchi and Furusawa, 2006). Once NF-κB p65 is activated through phosphorylation of its inhibitory protein kappa B- alpha (IκB)-α by Ikappa B kinase (IKK), NF-κB p65 translocates from the cytoplasm to the nucleus. In nucleus, NF-κB p65 attaches to κB binding sites and triggers the transcription of proinflammatory cytokines such as TNF-α and IL-1β (Huang et al., 2015).
-4-
Additionally, oxidative stress is another mechanism involved in the development of sepsis-induced acute liver injury (Macdonald et al., 2003;Yaylak et al., 2008). Previous study reported that activated neutrophils are a potential source of ROS which induce tissue damage directly or indirectly (Haegens et al., 2009;Yaylak et al., 2008). Pomegranate (Punica granatum, Punicaceae) is an ancient and highly distinctive fruit with various pharmacological and biological activities. It has been reported to be active in the treatment of inflammation, parasitic and microbial infections, respiratory complications, and cancer (Viladomiu et al., 2013). The unique antioxidant tannins and flavonoids contained in pomegranate have recently drawn the attention of many scientists. Previous studies showed that pomegranate has anti-inflammatory activity as shown in models of skin inflammation (Khan et al., 2012), gastritis (Colombo, 2013) and rheumatoid arthritis (Shukla et al., 2008), and anti-oxidant activity as shown in gentamicin-induced nephrotoxicity model (Cekmen et al., 2013). Anti-inflammatory and anti-oxidant effects of pomegranate were found to be NF-kB dependent (Colombo, 2013;Dikmen et al., 2011). Since inflammation and oxidative stress induced by sepsis are major pathways causing acute liver injury, therefore we hypothesized that pomegranate extract can ameliorate acute liver injury-induced by CLP through its antiinflammatory and antioxidant effects in rats.
2. Materials and methods 2.1. Chemicals Hexadecyltrimethyl ammonium bromide was purchased from Bio Basic Canada INC, (Ontario, Canada). Ellman's reagent [5,50-dithio-bis(2-nitrobenzoic acid)], tris
-5-
(hydroxymethyl) aminomethane, trichloroacetic acid (TCA), 1,1',3,3'-tetramethoxypropane, reduced glutathione, thiobarbituric acid (TBA), pyrogallol, 3,3',5,5'-tetramethylbenzidine (TMB) and pentobarbital sodium were purchased from Sigma Aldrich chemical Co. (St. Louis, MO, USA). 2.2. Pomegranate extract Standardized pomegranate fruit extract (POM) in capsule form was provided by Verdure Science Inc. (POMELLA, Noblesville, IN, USA). It has been previously reported that this extract was high-performance liquid chromatography (HPLC)-standardized using validated methods and standards to 30% of the major ellagitannins (punicalagin α, and punicalagin β) and approximately 5% ellagic acid as shown in the HPLC-photodiode array profile. Other ingredients were also characterized and the extract was clarified to be Escherichia coli, Salmonella, S. Aureus, and Enterobacteriaceae free as previously reported (Sadik and Shaker, 2013). 2.3. Experimental animals Male Sprague Dawley rats, aging 6-8 weeks (200±20) g, were purchased from "Egyptian Organization for Biological Products and Vaccines" Giza, Egypt. Research protocol has been approved by the "Research Ethics Committee" of Faculty of Pharmacy, Mansoura University, Egypt which are in accordance with "Principles of laboratory Animal Care" (NIH publication No. 85-23, revised 1985). 2.4. Experimental design Animals were divided into 4 groups, each of 18 rats. Group 1: Sham-operated group; Group 2: POM group; Rats receiving 800 mg/kg/day POM orally for 14 days and then treated as sham group; Group 3: CLP group and Group 4: POM + CLP group, Rats
-6-
receiving 800 mg/kg/day POM for 14 days and then treated as CLP group. This dose was chosen based on results obtained in pilot experiments using lower doses of POM (400, 600 mg/kg/day) which failed to improve mortality and other parameters (data not shown) whereas 800 mg/kg/day was found to be optimal dose. After 24 h, mortality rate was assessed, then live rats were anaesthetized. Blood samples were withdrawn via orbital sinus and allowed to clot for 30 min at room temperature, followed by centrifugation at 2000g for 10 min at 4ºC. Serum samples were collected and stored at -80º C for assessment of liver function. Portions of liver tissues were rapidly removed, snap frozen in liquid nitrogen, and stored at −80 °C until subsequent analysis. Another portion of liver was placed immediately in 10% neutral buffered formalin for immunohistochemical and histopathological examination. 2.5. Induction of CLP Polymicrobial sepsis was induced by CLP according to previously described method (Camara-Lemarroy et al., 2015) with some modification. Rats were anesthetized with thiopental sodium (40 mg/kg, i.p.) and placed over heating pads to maintain body temperature. The abdomen was gently shaved and prepared with a 10% povidone-iodine solution. Small midline incision was made to expose cecum. Cecum was ligated below the ileocecal valve without causing bowel obstruction. The cecum was then subjected to a single through and through perforation with a 16-gauge needle distal to point of ligation. The cecum was then gently squeezed to extrude some fecal contents, and repositioned. The abdominal muscles was closed by applying simple interrupted sutures with 4-0 silk suture. The skin layer were then closed using subcuticular running suture with 4-0 silk suture. Rats were resuscitated with 1 mL of warmed ringer solution subcutaneously. Sham-operated
-7-
animals were subjected to laparotomy intestinal manipulation and resuscitation procedures; however, the cecum was neither ligated nor punctured and used as control. 2.6. Assessment of liver function Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), gamma aminotransferase (γ-GT) and total bilirubin were determined using commercial kits from (Biodiagnostics, Badr, Egypt).
2.7. Preparation of liver homogenate Liver tissue samples were weighed and homogenized (1:10, w/v) in phosphate buffered saline (pH 7.4) in an ice bath using Omni-125 hand held homogenizer (Omni international, USA). The homogenate was centrifuged at 2000 g, 4ºC for 15 min. Oxidative stress biomarkers such as malondialdehyde (MDA), reduced glutathione (GSH) and Superoxide dismutase (SOD) and TNF-α were assessed on the supernatant of the liver homogenate 2.8. Measurement of MDA content, reduced GSH level and SOD activity in liver homogenate Thiobarbituric acid reactive substances were measured as MDA, the end product of lipid peroxidation. The absorbance was determined at 532 nm and expressed as nmol/g tissue (Ohkawa et al., 1979). The level of acid-soluble thiols, mainly GSH, in the liver was assayed colorimetrically by the method of Ellman which is based on the reaction of GSH with
-8-
Ellman’s reagent to give a yellow compound that absorbs at 412 nm. Concentrations were expressed as nmol/mg tissue (ELLMAN, 1959). Additionally, SOD activity in liver homogenate was measured by monitoring the degree of inhibition of the auto-oxidation of pyrogallol by SOD at an alkaline pH. The change in absorbance at 420 nm was recorded and activity was expressed as U/g tissue (Marklund and Marklund, 1974).
2.9. Determination of hepatic MPO activity The extent of neutrophils accumulation in the liver was measured by assaying myeloperoxidase (MPO) activity as previously described (Schierwagen et al., 1990) with a slight modification. Hepatic tissue was homogenized in 20 volumes of phosphate buffer (0.1 M NaCl, 0.02 M NaH2PO4, 0.015 M EDTA, pH 4.7) and centrifuged at 10,000 g for 15 min. The pellets were then re-suspended in 10 volumes of 0.05 M sodium phosphate buffer (pH
5.4)
containing
0.5%
(w/v)
hexadecyltrimethylammonium
bromide
and
re-homogenized. The suspension was freeze–thawed three times using liquid nitrogen, and then centrifuged. The assay was started by adding the supernatant to H2O2 and TMB solution and incubated for 5 min at 37 ºC. The reaction was terminated by adding 100 μl of 4 M H2SO4 at 4ºC. The obtained color was quantified at 450 nm. Results were expressed as a fold change over sham group. 2.10. Histopathological examination of liver Portion of liver was harvested and rinsed with ice-cold saline. Liver specimens were fixed in 10% neutral-buffered formalin for 24 h, embedded in paraffin wax, sectioned (6 μm), stained with hematoxylin–eosin (H&E) and was assessed for the presence of
-9-
inflammation. The tissues were examined under a microscope (Leica Imaging Systems, Cambridge, UK) in a random order and without knowledge on the animal or group 2.11. Determination of NF-κB DNA-Binding activity Nuclear proteins were extracted from hepatic tissues using a commercial kit (Abcam, Cambridge, USA). Relative DNA binding of nuclear p65 transcript was quantified using a commercial kit (Abcam, Cambridge, USA). Briefly, a specific double stranded DNA sequence containing the NF-κB response element was immobilized onto the wells of a 96 well plates so that it can bind specifically to the p65 in extract. The p65 was detected by addition of specific primary antibody directed against p65. A secondary antibody conjugated to HRP was added. The obtained color was quantified at 450 nm. Both positive and non-specific binding controls were included. Results were expressed as fold change over sham group. 2.12. Immunohistochemistry for NF-𝜅B p-65 NF-𝜅B p-65 protein was assessed by immunohistochemistry technique. Briefly, after de-paraffinization and rehydration antigen retrieval was performed. Sections were incubated with rabbit anti-NF-𝜅B p-65 polyclonal antibody (Thermo Scientific, Rockford, IL, USA) overnight at 4∘C. After washing, the samples were incubated with secondary antibody (Genemed biotechnologies, South San Francisco, USA) for 2 h at room temperature, and then visualized with diaminobenzidine. The sections were analyzed under light microscope (Leica). Appropriate controls were performed to exclude background or non-specific binding. 2.13. Measurement of TNF-α level in liver tissue
- 10 -
TNF-α level in the supernatant of the liver homogenate was determined by using commercial ELISA kit, according to the manufacturer's instructions (eBioscience, Inc., San Diego, USA). TNF-α concentration was determined from a standard curve ranging from 0 to 2500 pg/ml. Concentration of TNF-α in liver homogenate was expressed as pg/g protein. 2.14. Quantitative RT-PCR Total RNA was extracted from rat livers using TRIzol reagent (life technologies, California, USA) according to the manufacturer's instructions. The concentration and purity of the RNA were estimated using nanophotometer UV/Vis spectrophotometer (Implen GmbH, München, Germany). One µg from each sample was reverse transcribed into complementary DNA (cDNA) using Quantitect Reverse Transcription Kit, according to the manufacturer's instructions (Qiagen, Hilden, Germany). RT-PCR was performed with the thermocycler Rotor Gene Q (Qiagen), using HOT FIREPol EvaGreen qPCR mix plus kit (Solis BioDyne, Tartu, Estonia). The mRNA levels of TLR4, TNF-α and MPO were normalized relative to 18S ribosomal RNA (Rn18 S) in the same sample. Sequences of primers used in this study are shown in Table (1). The results were expressed as an n-fold change of the relative expression levels of target genes from control group using ∆∆Ct method. 2.15. Statistical Analysis: Data are expressed as mean ± standard error of the mean (SEM). Statistical analyses were carried out using one way analysis of variance (ANOVA) followed by Tukey-Kramer multiple comparisons post hoc test. Additionally, Kruskal-Wallis test was used followed by
- 11 -
Dunn's post hoc test for non-parametric measurement. Significance was considered at p<0.05. Statistical analyses and graphing were carried out using GraphPad Prism V 5.02 (GraphPad Software Inc., San Diego, CA, USA).
3. Results 3.1. Effect of pomegranate extract on CLP-induced mortality CLP significantly increased percentage of mortality when compared to sham group (Table 2). POM administration to normal rats did not show any significant effect on percentage of mortality when compared to sham group. Treatment with POM prior to CLP significantly prevented the CLP-induced elevated mortality. 3.2. Effect of pomegranate extract on CLP-induced changes in liver functions parameters in serum CLP significantly (p < 0.05, n=6) increased ALT, AST, ALP, γ-GT and total bilirubin by 77.5%, 46.6%, 69%, 683.7% and 617.4%, respectively as compared to the sham group (Figure 1). POM had no significant effect on these parameters when compared to sham group. The administration of POM prior to CLP significantly prevented the CLPinduced elevation in ALT, AST, ALP, γ-GT and total bilirubin. 3.3. Effect of pomegranate extract on CLP-induced changes in oxidative stress biomarkers in hepatic tissues In comparison with sham rats, CLP significantly (p < 0.05, n=6) decreased GSH level (Figure 2A), SOD activity (Figure 2B) and increased MDA content (Figure 2C) by 86.4%, 26.9% and 212.7% respectively. Rats receiving POM did not show any significant
- 12 -
effect on GSH level, SOD activity and MDA content when compared to sham group. POM treatment prior to CLP significantly prevented CLP-induced changes in hepatic oxidative stress biomarkers induced by CLP. 3.4. Effect of pomegranate extract on CLP-induced changes in mRNA expression and activity of MPO in hepatic tissues In comparison with sham group, hepatic mRNA expression and activity of MPO were significantly (p < 0.05, n=6) elevated in CLP group by 39% and 89.8%, respectively (Figure 3A and 3B). POM had no significant effect on hepatic mRNA expression and activity of MPO when compared to sham group. Pretreatment with pomegranate significantly prevented CLP-induced increase in hepatic mRNA expression and activity of MPO. 3.5. Effect of pomegranate extract on CLP-induced changes in histopathological examination of liver Histopathological examination of the liver using H&E stain in sham rats revealed normal liver architecture (Figure 4). Similarly, rats receiving POM revealed normal liver architecture and no abnormalities were observed. CLP caused a marked inflammatory cells infiltration, hydropic degeneration and central vein dilation and congestion. The administration of POM prior to CLP attenuated the histopathological changes induced by CLP. 3.6. Effect of pomegranate extract on CLP-induced changes mRNA expression of TLR4 in hepatic tissues CLP significantly (p<0.05, n=6) increased TLR4 mRNA expression when compared to sham group by 45% (Figure 5A). POM treatment in normal rats did not show any
- 13 -
significant effect on TLR4 mRNA expression when compared to sham group. Pretreatment with POM significantly decreased the elevated mRNA expression of TLR4 induced by CLP. 3.7. Effect of pomegranate extract on CLP-induced changes in DNA binding activity and protein expression of NF-κB subunit p65 in hepatic tissues Moreover, CLP significantly (p < 0.05, n=6) increased p65 DNA binding activity by 25% when compared to sham group (Figure 5B). POM did not show any significant effect on p65 DNA binding activity when compared to sham group. Pretreatment with POM significantly decreased the elevated NF-κB p65 DNA binding activity. Immunohistochemical examination indicated that p65 was limited to the cytoplasm in the majority of hepatic cells obtained from the sham rats, indicating that NF-κB was present in its inactive form. Rats received POM was not significant from sham group. In the livers of rats subjected to CLP, there was staining for p65 in the nuclei of hepatic cells indicating translocation of NF-κB to the nucleus. In rats subjected to CLP and pretreated with POM, p65 was limited to the cytoplasm in the majority of hepatic (Figure 6). 3.8. Effect of pomegranate extract on CLP-induced changes in mRNA and protein expression of TNF-α in hepatic tissues CLP caused a significant (p < 0.05, n=6) increase in mRNA and protein expression of TNF-α by 1100% and 81.6%, respectively when compared to sham group (Figure 7A and 7B). Rats receiving POM had no significant effect on TNF-α expression at both gene and protein levels when compared to sham group. Pretreatment with POM significantly prevented the CLP-induced elevation in mRNA and protein expression of TNF-α.
- 14 -
4. Discussion In the present study, CLP-induced acute liver injury was evidenced by increased mortality, elevated ALT, AST, ALP, γ-GT, total bilirubin and abnormalities in liver structure in histological section. Furthermore, polymorphonuclear leukocytes (PMN) trafficking activity was increased as indicated by histopathological examination, in addition to elevated MPO activity in liver tissues. Moreover, CLP activated TLR4/NF-κB pathway and subsequently increased TNF-α level. CLP also induced prominent oxidative stress as reflected by increased MDA content, decreased GSH level and SOD activity. Treatment with POM before CLP improved survival and attenuated the liver inflammatory response in polymicrobial sepsis model by inhibiting TLR4 expression, NF-κB p65 activation and associated cytokines release such as TNF-α. Additionally, PMN trafficking activity and prominent oxidative stress following sepsis induction were attenuated by POM pretreatment. It has been previously reported that hepatic injury following sepsis is well established by the elevated levels of hepatic enzymes such as AST, ALT and ALP in serum indicating cellular leakage and loss of functional integrity of hepatic membrane as they are released into blood stream when the liver cell plasma membrane is damaged (Mohamadin et al., 2011). This correlates with the present study which showed increased serum activity of AST, ALT, ALP, γ-GT and concentration of total bilirubin in CLP rats confirming the extensive liver damage induced by CLP. POM pretreatment decreased serum concentration of these hepatic markers indicating its ability to maintain functional integrity of hepatic membrane.
- 15 -
Additionally, histopathological examination confirmed this hepatic damage as CLP resulted in marked inflammatory cells infiltration, hepatocellular necrosis, and central vein dilation and congestion. Similarly, previous study showed that CLP produced inflammatory cells infiltration, swollen hepatocytes and hepatocellular necrosis in rats (Liu et al., 2015). Pretreatment with POM attenuated these histopathological changes confirming the protective effect of POM against the CLP-induced liver injury. Inflammation is one of major mechanisms involved in acute liver injury induced by sepsis and initiated by TLR4 activation. Therefore, expression of TLR4, NF-κB p65 DNA binding activity and associated cytokines such as TNF-α were estimated. TLR4 is one of the most important signal-transducing receptors for structurally diverse microbial molecules and can activate NF-κB to regulate immune reaction and the expression of many inflammatory cytokines such as TNF-α (Watson et al., 2008;Zhang et al., 2014). It has been previously reported that suppression of the TLR4 expression and NF-κB activation has a consequential correlation to inhibition of cytokines production in response to LPS and protection of liver tissues from being injured by excessive immune reactions (Watson et al., 2008;Zhang et al., 2014). Moreover, a recent study reported that inhibition of TNF-α is able to suppress the activation of TLR4 and NF-κB signaling pathway (Yang et al., 2014). The previous studies showed that CLP increased TLR4 mRNA expression (Yao et al., 2003), and NF-κB p65 expression and activity in rats' liver (Wang et al., 2013). Similarly, the present study showed that CLP increased TLR4 mRNA expression, and NF-κB p65 translocation and activity. Pretreatment with POM decreased TLR4 mRNA expression, and NF-κB p65 translocation and activity suggesting that inhibition of
- 16 -
TLR4/NF-κB might be a major pathway by which POM prevented CLP-induced acute liver inflammation. Activation of NF-κB p65 increases the expression of many proinflammatory cytokines; among these cytokines is TNF-α which is a major mediator of systemic inflammation (Li et al., 2013). TNF-α plays a central role in the development of acute hepatic failure after severe trauma and sepsis by directly or indirectly inducing hepatocyte necrosis rather than apoptosis (Wang et al., 1995). It has been reported that CLP elevated serum TNF-𝛼 protein level and mRNA expression of TNF-𝛼 in hepatic tissue of mice (Salkowski et al., 1998). In the current study, CLP increased mRNA and protein expression of TNF-α in hepatic tissues. This upregulation can directly lead to hepatocellular damage. POM pretreatment decreased the elevated TNF-α at both mRNA and protein levels confirming that POM has antiinflammatory effect mediated through inhibition of NF-κB and associated cytokines as TNF-𝛼. This systemic inflammatory cascade during sepsis results in PMN infiltration to site of injury/infection. PMN extravasation subsequently can lead to vascular dysfunction as well as parenchymal cell dysfunction (Mohamadin et al., 2011). Free radicals seem to trigger the accumulation of leukocytes in the tissue involved, and thus cause further injury through activated neutrophils. It has been shown that activated neutrophils secrete MPO and liberate oxygen radicals (Haegens et al., 2009;Srivastava et al., 2010). Since activity of MPO positively correlated with the number of PMNs and severity of inflammation, it is more commonly used to evaluate tissue PMNs accumulation in inflamed tissues (El et al., 2009; Lingaraju et al., 2015).
- 17 -
It has been previously reported that CLP increased MPO activity in hepatic rats (Mohamadin et al., 2011). In the present study, MPO mRNA expression and activity was markedly increased in CLP rats and pretreatment with POM lowered MPO mRNA expression and activity indicating its attenuating effect on neutrophils infiltration mediating liver damage. This was further supported by histopathological examination showing decrease in PMN infiltration in hepatic tissues. It has been previously reported that ellagic acid has anti-inflammatory effects on concovalin A-induced hepatitis mediated through suppression of TLR and mitogenactivated protein kinase/ NF-κB pathway (Lee et al., 2014). Therefore, anti-inflammatory effects of POM on acute liver injury induced by CLP may be mediated through its ellagic acid content. Since oxidative stress is another pathway involved in acute liver injury, lipid peroxidation (LPO) and antioxidant enzymes such as SOD and GSH were estimated. Previous study reported that activated neutrophils are a potential source of ROS which generate hypocholorus acid in the presence of MPO leading to tissue damage (Haegens et al., 2009). LPO of hepatocyte membranes is one of the principal causes of LPS-induced hepatotoxicity, and is mediated by the generation of ROS (Macdonald et al., 2003). In the present study, CLP resulted in a significant increase in the hepatic MDA level, as indicator of lipid peroxidation. Pretreatment with POM protected the liver against LPO. It clearly demonstrates that POM effectively quenches the free radicals indicating its antioxidant properties. Antioxidant enzymes like GSH and SOD are considered to be a primary defense that prevents biological macromolecules from oxidative damage. LPS induced toxicity
- 18 -
might result in decreased activities of enzymatic antioxidants. It may be due to their increased usage in scavenging free radicals induced by the LPS thus causing irreversible inhibition in their activities (Zhao et al., 2008). In the present study, CLP reduced hepatic SOD activity and GSH level. POM was found to increase the activities of these antioxidant enzymes, suggesting that scavenging of ROS may be due to its effective antioxidant activity, consequently resulting in reduced oxidative stress. Similarly, the study of Mohamadin et al. (2011) reported that LPS increased hepatic MDA level and decreased SOD activity and GSH level in rats (Mohamadin et al., 2011). Lin et al., reported that punicalagin and punicalin have anti-oxidant activity against acetaminophen induced liver damage in rats (Lin et al., 2001). Therefore, POM may exert its antioxidant effect through its punicalagin content. In conclusion, POM could prevent sepsis-induced ALI in rats through its antiinflammatory effects mediated through inhibition of TLR4 expression, NF-κB activity, associated TNF-α release, and neutrophil infiltration in addition to its antioxidant effects.
Conflict of interest statement: None declared.
5. References Abraham, E., 2003. Nuclear factor-kappaB and its role in sepsis-associated organ failure. J Infect Dis 187 Suppl 2, S364-S369. Camara-Lemarroy, C.R., Guzman-DE LA Garza FJ, Cordero-Perez, P., Ibarra-Hernandez, J.M., Munoz-Espinosa, L.E., Fernandez-Garza, N.E., 2015. Gemfibrozil attenuates the inflammatory response and protects rats from abdominal sepsis. Exp Ther Med 9, 10181022.
- 19 -
Cekmen, M., Otunctemur, A., Ozbek, E., Cakir, S.S., Dursun, M., Polat, E.C., Somay, A., Ozbay, N., 2013. Pomegranate extract attenuates gentamicin-induced nephrotoxicity in rats by reducing oxidative stress. Ren Fail 35, 268-274. Colombo, E.S.E.D.M., 2013. A Review on the Anti-Inflammatory Activity of Pomegranate in the Gastrointestinal Tract. Evid Based Complement Alternat Med doi: 10.1155/2013/247145. Dejager, L., Pinheiro, I., Dejonckheere, E., Libert, C., 2011. Cecal ligation and puncture: the gold standard model for polymicrobial sepsis? Trends Microbiol 19, 198-208. Dhainaut, J.F., Marin, N., Mignon, A., Vinsonneau, C., 2001. Hepatic response to sepsis: interaction between coagulation and inflammatory processes. Crit Care Med 29, S42-S47. Dikmen, M., Ozturk, N., Ozturk, Y., 2011. The antioxidant potency of Punica granatum L. Fruit peel reduces cell proliferation and induces apoptosis on breast cancer. J Med Food 14, 1638-1646. El, K.D., Jozsef, L., Pan, W., Wang, L., Petasis, N.A., Serhan, C.N., Filep, J.G., 2009. 15epi-lipoxin A4 inhibits myeloperoxidase signaling and enhances resolution of acute lung injury. Am J Respir Crit Care Med 180, 311-319. ELLMAN, G.L., 1959. Tissue sulfhydryl groups. Arch Biochem Biophys 82, 70-77. Farghali, H., Cerny, D., Kamenikova, L., Martinek, J., Horinek, A., Kmonickova, E., Zidek, Z., 2009. Resveratrol attenuates lipopolysaccharide-induced hepatitis in Dgalactosamine sensitized rats: role of nitric oxide synthase 2 and heme oxygenase-1. Nitric Oxide 21, 216-225. Haegens, A., Heeringa, P., van Suylen, R.J., Steele, C., Aratani, Y., O'Donoghue, R.J., Mutsaers, S.E., Mossman, B.T., Wouters, E.F., Vernooy, J.H., 2009. Myeloperoxidase deficiency attenuates lipopolysaccharide-induced acute lung inflammation and subsequent cytokine and chemokine production. J Immunol 182, 7990-7996. Huang, X., Tang, J., Cai, H., Pan, Y., He, Y., Dai, C., Chen, A., Yu, X., Chen, M., Zou, L., Wang, L., 2015. Anti-Inflammatory Effects of Monoammonium Glycyrrhizinate on Lipopolysaccharide-Induced Acute Lung Injury in Mice through Regulating Nuclear Factor-Kappa B Signaling Pathway. Evid Based Complement Alternat Med doi: 10.1155/2015/272474. Khan, N., Syed, D.N., Pal, H.C., Mukhtar, H., Afaq, F., 2012. Pomegranate fruit extract inhibits UVB-induced inflammation and proliferation by modulating NF-kappaB and MAPK signaling pathways in mouse skin. Photochem Photobiol 88, 1126-1134.
- 20 -
Kobayashi, T., Tashiro, K., Cui, X., Konzaki, T., Xu, Y., Kabata, C., Yamamoto, K., 2001. Experimental models of acute respiratory distress syndrome: clinical relevance and response to surfactant therapy. Biol Neonate 80 Suppl 1, 26-28. Lee, J.H., Won, J.H., Choi, J.M., Cha, H.H., Jang, Y.J., Park, S., Kim, H.C., Kim, D.K., 2014. protective effect of ellagic acid on concovalin A-induced hepatitis via toll-like receptor and mitogen activated protein kinase/nuclear factor κB signalling pathways. J Agric Food Chem 62, doi: 10.1021/jf503188c. Li, X.H., Gong, X., Zhang, L., Jiang, R., Li, H.Z., Wu, M.J., Wan, J.Y., 2013. Protective effects of polydatin on septic lung injury in mice via upregulation of HO-1. Mediators Inflamm doi: 10.1155/2013/354087. Lin, C.C., Hsu, Y.F., Lin, T.C., Hsu, H.Y., 2001. Antioxidant and hepatoprotective effects of punicalagin and punicalin on acetaminophen-induced liver damage in rats. Phytother Res 15, 206-212 Lingaraju, M.C., Pathak, N.N., Begum, J., Balaganur, V., Bhat, R.A., Ramachandra, H.D., Ayanur, A., Ram, M., Singh, V., Kumar, D., Kumar, D., Tandan, S.K., 2015. Betulinic acid attenuates lung injury by modulation of inflammatory cytokine response in experimentallyinduced polymicrobial sepsis in mice. Cytokine 71, 101-108. Liu, A., Wang, W., Fang, H., Yang, Y., Jiang, X., Liu, S., Hu, J., Hu, Q., Dahmen, U., Dirsch, O., 2015. Baicalein protects against polymicrobial sepsis-induced liver injury via inhibition of inflammation and apoptosis in mice. Eur J Pharmacol 748, 45-53. Macdonald, J., Galley, H.F., Webster, N.R., 2003. Oxidative stress and gene expression in sepsis. Br J Anaesth 90, 221-232. Manna, P., Sinha, M., Sil, P.C., 2007. Protection of arsenic-induced hepatic disorder by arjunolic acid. Basic Clin Pharmacol Toxicol 101, 333-338. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 47, 469-474. Mohamadin, A.M., Elberry, A.A., Elkablawy, M.A., Gawad, H.S., Al-Abbasi, F.A., 2011. Montelukast, a leukotriene receptor antagonist abrogates lipopolysaccharide-induced toxicity and oxidative stress in rat liver. Pathophysiology 18, 235-242. Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 95, 351-358. Pushpavalli, G., Kalaiarasi, P., Veeramani, C., Pugalendi, K.V., 2010. Effect of chrysin on hepatoprotective and antioxidant status in D-galactosamine-induced hepatitis in rats. Eur J Pharmacol 631, 36-41.
- 21 -
Sadik, N.A., Shaker, O.G., 2013. Inhibitory effect of a standardized pomegranate fruit extract on Wnt signalling in 1, 2-dimethylhydrazine induced rat colon carcinogenesis. Dig Dis Sci 58, 2507-2517. Sakaguchi, S., Furusawa, S., 2006. Oxidative stress and septic shock: metabolic aspects of oxygen-derived free radicals generated in the liver during endotoxemia. FEMS Immunol Med Microbiol 47, 167-177. Salkowski, C.A., Detore, G., Franks, A., Falk, M.C., Vogel, S.N., 1998. Pulmonary and hepatic gene expression following cecal ligation and puncture: monophosphoryl lipid A prophylaxis attenuates sepsis-induced cytokine and chemokine expression and neutrophil infiltration. Infect Immun 66, 3569-3578. Schierwagen, C., Bylund-Fellenius, A.C., Lundberg, C., 1990. Improved method for quantification of tissue PMN accumulation measured by myeloperoxidase activity. J Pharmacol Methods 23, 179-186. Shukla, M., Gupta, K., Rasheed, Z., Khan, K.A., Haqqi, T.M., 2008. Consumption of hydrolyzable tannins-rich pomegranate extract suppresses inflammation and joint damage in rheumatoid arthritis. Nutrition 24, 733-743. Srivastava, A., Maggs, J.L., Antoine, D.J., Williams, D.P., Smith, D.A., Park, B.K., 2010. Role of reactive metabolites in drug-induced hepatotoxicity. Handb Exp Pharmacol165194. Viladomiu, M., Hontecillas, R., Lu, P., Bassaganya-Riera, J., 2013. Preventive and prophylactic mechanisms of action of pomegranate bioactive constituents. Evid Based Complement Alternat Med 2013, doi: 10.1155/2013/789764. Wang, H.L., Xing, Y.Q., Xu, Y.X., Rong, F., Lei, W.F., Zhang, W.H., 2013. The protective effect of lidocaine on septic rats via the inhibition of high mobility group box 1 expression and NF-kappaB activation. Mediators Inflammdoi: 10.1155/2013/570370. Wang, J.H., Redmond, H.P., Watson, R.W., Bouchier-Hayes, D., 1995. Role of lipopolysaccharide and tumor necrosis factor-alpha in induction of hepatocyte necrosis. Am J Physiol 269, G297-G304. Watson, M.R., Wallace, K., Gieling, R.G., Manas, D.M., Jaffray, E., Hay, R.T., Mann, D.A., Oakley, F., 2008. NF-kappaB is a critical regulator of the survival of rodent and human hepatic myofibroblasts. J Hepatol 48, 589-597. Yan, J., Li, S., Li, S., 2014. The role of the liver in sepsis. Int Rev Immunol 33, 498-510. Yang, F., Li, X., Wang, L.K., Wang, L.W., Han, X.Q., Zhang, H., Gong, Z.J., 2014. Inhibitions of NF-kappaB and TNF-alpha result in differential effects in rats with acute on chronic liver failure induced by d-Gal and LPS. Inflammation 37, 848-857.
- 22 -
Yao, Y.M., Yan, X.J., Yao, F.H., Cheng, M.H., Dong, N., Yu, Y., Sheng, Z.Y., 2003. [Changes in Toll-like receptor 2 and 4 gene expression in vital organs in septic rats and their regulation mechanisms]. Zhongguo Wei Zhong Bing Ji Jiu Yi Xue 15, 646-650. Yaylak, F., Canbaz, H., Caglikulekci, M., Dirlik, M., Tamer, L., Ogetman, Z., Polat, Y., Kanik, A., Aydin, S., 2008. Liver tissue inducible nitric oxide synthase (iNOS) expression and lipid peroxidation in experimental hepatic ischemia reperfusion injury stimulated with lipopolysaccharide: the role of aminoguanidine. J Surg Res 148, 214-223. Zhang, S., Yang, N., Ni, S., Li, W., Xu, L., Dong, P., Lu, M., 2014. Pretreatment of lipopolysaccharide (LPS) ameliorates D-GalN/LPS induced acute liver failure through TLR4 signaling pathway. Int J Clin Exp Pathol 7, 6626-6634. Zhao, L., Chen, Y.H., Wang, H., Ji, Y.L., Ning, H., Wang, S.F., Zhang, C., Lu, J.W., Duan, Z.H., Xu, D.X., 2008. Reactive oxygen species contribute to lipopolysaccharide-induced teratogenesis in mice. Toxicol Sci 103, 149-157.
- 23 -
Figure legends: Figure (1): Effect of pomegranate extract on CLP-induced changes in liver functions parameters in serum
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and serum was collected 24 h after CLP to measure ALT (A), AST (B), ALP (C), γ-GT (D) and total bilirubin (E). Data are expressed as mean ± SEM, n=6. *, # p0.05, significantly different from sham and CLP groups, respectively using oneway ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. ALT, alanine transaminase; ALP, alkaline phosphatase; AST, aspartate transaminase; CLP, cecal ligation and puncture; γ-GT, gamma-glutamyl transferase and POM; pomegranate.
- 24 -
Figure (2): Effect of pomegranate extract on CLP-induced changes in oxidative stress biomarkers in hepatic tissues
- 25 -
- 26 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to measure GSH (A); SOD (B) and MDA (C). Data are expressed as mean ± SEM, n=6. *,
#
p0.05, significantly different from sham and CLP groups, respectively using
one-way ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; GSH, reduced glutathione; MDA, malondialdehyde; POM; pomegranate and SOD, superoxide dismutase.
- 27 -
Figure (3): Effect of pomegranate extract on CLP-induced changes in mRNA expression and activity of MPO in hepatic tissues.
- 28 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to assess relative mRNA expression of MPO (A) and MPO activity (B). Data are expressed as mean ± SEM, n=6. *,
#
p0.05, significantly different from sham, CLP group respectively using one-way
ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; MPO, myeloperoxidase and POM, pomegranate.
- 29 -
Figure (4): Effect of pomegranate extract on CLP-induced changes in histopathological examination of liver.
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and liver tissues were collected 24 h after CLP for histopathological examination of the liver using H&E (X100) stain, n=6. Sham and POM rats revealed normal liver architecture. CLP caused a marked inflammatory cells infiltration, hepatocellular necrosis, and central vein dilation and congestion. The administration of POM prior to CLP attenuated the histopathological changes induced by CLP. CLP, cecal ligation and puncture and POM, pomegranate.
- 30 -
Figure (5): Effect of pomegranate extract on CLP-induced changes in TLR4 mRNA expression in addition to DNA binding activity of NF-κB p65 in hepatic tissues.
- 31 -
- 32 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to assess relative mRNA expression of TLR 4 (A) and NF-κB p65 DNA binding activity (B). Data are expressed as mean ± SEM, n=6. *, # p0.05, significantly different from sham and CLP groups, respectively using oneway ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; NF-κB, nuclear factor-Kappa B; POM, pomegranate and TLR, toll-like receptor-4.
- 33 -
Figure (6): Effect of pomegranate extract on CLP-induced changes in protein expression of NF-κB subunit p65 in hepatic tissues.
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP for immunohistochemical examination of transcription factor NF-κB subunit p65 using light microscope (X400), n=3. CLP, cecal ligation and puncture; NF-κB, nuclear factor-Kappa B and POM, pomegranate.
- 34 -
Figure (7): Effect of pomegranate extract on CLP-induced changes in mRNA and protein expression of TNF-α in hepatic tissues.
- 35 -
- 36 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to assess relative mRNA expression of TNF-α (A) and TNF-α protein level (B). Data are expressed as mean ± SEM, n=6. *,
#
p0.05, significantly different from sham, CLP group respectively using one-way
ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; TNF-α, tumor necrosis factor-alpha and POM, pomegranate.
- 37 -
Table (1): Primers used for quantitative RT-PCR: Primer sense
Sequence
Amplicon size
AGTTGGTG GAGCGATTTGTC 121
Rn18 S antisense
GAACGCCACTTGTCC CTCTA
sense
TGTTCCTTTCCTGCCTGAGA 129
TLR4 antisense
GGTTCTTGGTTGAATAAGGGATG
sense
ATGTGGAACTGGCAGAGGAG 195
TNF-α antisense
TGGAACTGATGAGAGG GAG
sense
CTGGAGAGTTGTGCTGGAAG 75
MPO antisense
CGATTCAGTTTGGCAGGAGT
MPO, myeloperoxidase; Rn18 S, 18S ribosomal RNA; TLR, toll-like receptor-4; TNF-α, tumor necrosis factor-α.
- 38 -
Table (2): Effect of pomegranate extract on CLP-induced mortality
Mortality percent
Sham
POM
CLP
CLP+POM
0
0
69.4*
11.1#
POM (800 mg/kg, orally) was given for two weeks before induction of CLP. 24 h after CLP, percentage of mortality was assessed. Data are expressed as mean ± SEM. *,
#
p0.05, significantly different from sham, CLP group, respectively using
Kruskal-Wallis test was used
followed by Dunn's post hoc test for non-parametric
measurement at p0.05, n=18. Pomegranate (POM); cecal ligation and puncture (CLP)
- 39 -
S1382-6689(16)30061-8 http://dx.doi.org/doi:10.1016/j.etap.2016.03.011 ENVTOX 2478
To appear in:
Environmental Toxicology and Pharmacology
Received date: Revised date: Accepted date:
4-2-2016 7-3-2016 12-3-2016
Please cite this article as: Makled, Mirhan N., El-Awady, Mohammed S., Abdelaziz, Rania R., Atwan, Nadia, Guns, Emma T., Gamil, Nareman M., ElDin, Ahmed B.Shehab, Ammar, Elsayed M., Pomegranate protects liver against cecal ligation and puncture-induced oxidative stress and inflammation in rats through TLR4/NF-rmkappaB pathway inhibition.Environmental Toxicology and Pharmacology http://dx.doi.org/10.1016/j.etap.2016.03.011 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Pomegranate protects liver against cecal ligation and puncture-induced oxidative stress and inflammation in rats through TLR4/NF-κB pathway inhibition
Mirhan N. Makled
1*
, Mohammed S. El-Awady 1, Rania R. Abdelaziz 1, Nadia Atwan 2,
Emma T. Guns 3, Nareman M. Gamil 1, Ahmed B. Shehab El-Din 4 and Elsayed M. Ammar 1
1
Department of Pharmacology and Toxicology, Faculty of Pharmacy;
2
Department of
Pathology, Faculty of Medicine and 4 Department of Nephrology and Urology, Faculty of Medicine, Mansoura University, Mansoura 35516, Egypt 3
Vancouver Prostate Centre, Department of Urologic Sciences, University of British
Columbia, Vancouver, British Columbia, Canada
* Corresponding author: Mirhan N. Makled, MSc Department of Pharmacology and Toxicology, Faculty of Pharmacy, Mansoura University, Mansoura 35516, EGYPT Tel. 002 050 2247496 Fax. 002 050 2247496 E-mail: [email protected]
-1-
Highlights
Pomegranate has antiinflammatory and antioxidant effects on CLP-acute liver injury. Pomegranate has ability to inhibit TLR4/NF-κB pathway and neutrophil infiltration. Pomegranate has ability to modulate lipid peroxidation and antioxidants levels.
Abstract: Acute liver injury secondary to sepsis is a major challenge in intensive care unit. This study is designed to investigate potential protective effects of pomegranate against sepsis-induced acute liver injury in rats and possible underlying mechanisms. Pomegranate was orally given (800 mg/kg/day) for two weeks before sepsis induction by cecal ligation and puncture (CLP). Pomegranate improved survival and attenuated liver inflammatory response, likely related to downregulation of mRNA expression of toll like recptor-4, reduced nuclear translocation and DNA binding activity of proinflammatory transcription factor NF-κB subunit p65, decreased mRNA and protein expression of tumor necrosis factor-alpha and reduction in myeloperoxidase activity and mRNA expression. Pomegranate also decreased CLP-induced oxidative stress as reflected by decreased malondialdehyde content, and increased reduced glutathione level and superoxide dismutase activity. These results confirm the antiinflammatory and antioxidant effects of pomegranate in CLP-induced acute liver injury mediated through inhibiting TLR4/NF-κB pathway, lipid peroxidation and neutrophil infiltration.
-2-
Abbreviations: CLP, cecal ligation and puncture; GSH, reduced glutathione; LDH, lactate dehydrogenase; MDA, malondialdehyde; MPO, myeloperoxidase; NF-κB, nuclear factor-κB; SOD, superoxide dismutase; TLR, toll-like receptor-4; TNF-α, tumor necrosis factor-α.
Keywords: Acute Liver injury, cecal ligation and puncture, pomegranate, toll-like receptor-4, nuclear factor-κB.
1. Introduction Liver diseases remain one of the serious health problems throughout the world associated with a high rate of morbidity and mortality (Pushpavalli et al., 2010). The impairment of liver is multifactorial where it may result from chronic use of alcohol, viral or bacterial or protozoal infection, drugs and other xenobiotics (Farghali et al., 2009). Today, millions of people worldwide suffer from various hepatic disorders. Among these hepatic disorders is acute hepatitis which is the most prevalent and occurs at many countries (Manna et al., 2007). Sepsis is a major clinical challenge in intensive care units causing acute liver injury. Cecal ligation and puncture (CLP) induced liver injury is a well-established model because it closely resembles the progression and characteristics of human sepsis in which liver injury is mediated through an inflammatory pathway (Dejager et al., 2011; Kobayashi et al., 2001).
-3-
Liver plays a central role in bacterial phagocytosis and clearance. The invading bacteria and their products are firstly captured and cleared by liver cells, which release several proinflammatory mediators, such as tumor necrosis factor- (TNF-) 𝛼, interleukin(IL-) 1, IL-6, interferon-𝛾, IL-8, nitric oxide, and reactive oxygen species (ROS), which cause liver injury (Dhainaut et al., 2001;Yan et al., 2014). It has been previously reported that attenuation of liver injury and restoration of liver function lowers morbidity and mortality rates in patients with sepsis (Yan et al., 2014). Acute liver injury induced by sepsis is largely initiated through activation of toll like receptors (TLR4) by bacterial products (e.g., LPS or lipoteicohoic acid or peptidoglycan) or cytokines (e.g., TNF-α or IL-1), which leads to activation of transcription factor-nuclear factor-kappa B (NF-κB),
resulting in enhanced transcription of genes
responsible for the expression of proinflammatory cytokines such as TNF-α, chemokines, adhesion molecules, apoptotic factors, and other mediators of the inflammatory response associated with sepsis (Abraham, 2003;Liu et al., 2015). NF-κB is a major player in regulating the expression of many immunoregulatory mediators implicated in oxidative stress and consequently in sepsis (Sakaguchi and Furusawa, 2006). Once NF-κB p65 is activated through phosphorylation of its inhibitory protein kappa B- alpha (IκB)-α by Ikappa B kinase (IKK), NF-κB p65 translocates from the cytoplasm to the nucleus. In nucleus, NF-κB p65 attaches to κB binding sites and triggers the transcription of proinflammatory cytokines such as TNF-α and IL-1β (Huang et al., 2015).
-4-
Additionally, oxidative stress is another mechanism involved in the development of sepsis-induced acute liver injury (Macdonald et al., 2003;Yaylak et al., 2008). Previous study reported that activated neutrophils are a potential source of ROS which induce tissue damage directly or indirectly (Haegens et al., 2009;Yaylak et al., 2008). Pomegranate (Punica granatum, Punicaceae) is an ancient and highly distinctive fruit with various pharmacological and biological activities. It has been reported to be active in the treatment of inflammation, parasitic and microbial infections, respiratory complications, and cancer (Viladomiu et al., 2013). The unique antioxidant tannins and flavonoids contained in pomegranate have recently drawn the attention of many scientists. Previous studies showed that pomegranate has anti-inflammatory activity as shown in models of skin inflammation (Khan et al., 2012), gastritis (Colombo, 2013) and rheumatoid arthritis (Shukla et al., 2008), and anti-oxidant activity as shown in gentamicin-induced nephrotoxicity model (Cekmen et al., 2013). Anti-inflammatory and anti-oxidant effects of pomegranate were found to be NF-kB dependent (Colombo, 2013;Dikmen et al., 2011). Since inflammation and oxidative stress induced by sepsis are major pathways causing acute liver injury, therefore we hypothesized that pomegranate extract can ameliorate acute liver injury-induced by CLP through its antiinflammatory and antioxidant effects in rats.
2. Materials and methods 2.1. Chemicals Hexadecyltrimethyl ammonium bromide was purchased from Bio Basic Canada INC, (Ontario, Canada). Ellman's reagent [5,50-dithio-bis(2-nitrobenzoic acid)], tris
-5-
(hydroxymethyl) aminomethane, trichloroacetic acid (TCA), 1,1',3,3'-tetramethoxypropane, reduced glutathione, thiobarbituric acid (TBA), pyrogallol, 3,3',5,5'-tetramethylbenzidine (TMB) and pentobarbital sodium were purchased from Sigma Aldrich chemical Co. (St. Louis, MO, USA). 2.2. Pomegranate extract Standardized pomegranate fruit extract (POM) in capsule form was provided by Verdure Science Inc. (POMELLA, Noblesville, IN, USA). It has been previously reported that this extract was high-performance liquid chromatography (HPLC)-standardized using validated methods and standards to 30% of the major ellagitannins (punicalagin α, and punicalagin β) and approximately 5% ellagic acid as shown in the HPLC-photodiode array profile. Other ingredients were also characterized and the extract was clarified to be Escherichia coli, Salmonella, S. Aureus, and Enterobacteriaceae free as previously reported (Sadik and Shaker, 2013). 2.3. Experimental animals Male Sprague Dawley rats, aging 6-8 weeks (200±20) g, were purchased from "Egyptian Organization for Biological Products and Vaccines" Giza, Egypt. Research protocol has been approved by the "Research Ethics Committee" of Faculty of Pharmacy, Mansoura University, Egypt which are in accordance with "Principles of laboratory Animal Care" (NIH publication No. 85-23, revised 1985). 2.4. Experimental design Animals were divided into 4 groups, each of 18 rats. Group 1: Sham-operated group; Group 2: POM group; Rats receiving 800 mg/kg/day POM orally for 14 days and then treated as sham group; Group 3: CLP group and Group 4: POM + CLP group, Rats
-6-
receiving 800 mg/kg/day POM for 14 days and then treated as CLP group. This dose was chosen based on results obtained in pilot experiments using lower doses of POM (400, 600 mg/kg/day) which failed to improve mortality and other parameters (data not shown) whereas 800 mg/kg/day was found to be optimal dose. After 24 h, mortality rate was assessed, then live rats were anaesthetized. Blood samples were withdrawn via orbital sinus and allowed to clot for 30 min at room temperature, followed by centrifugation at 2000g for 10 min at 4ºC. Serum samples were collected and stored at -80º C for assessment of liver function. Portions of liver tissues were rapidly removed, snap frozen in liquid nitrogen, and stored at −80 °C until subsequent analysis. Another portion of liver was placed immediately in 10% neutral buffered formalin for immunohistochemical and histopathological examination. 2.5. Induction of CLP Polymicrobial sepsis was induced by CLP according to previously described method (Camara-Lemarroy et al., 2015) with some modification. Rats were anesthetized with thiopental sodium (40 mg/kg, i.p.) and placed over heating pads to maintain body temperature. The abdomen was gently shaved and prepared with a 10% povidone-iodine solution. Small midline incision was made to expose cecum. Cecum was ligated below the ileocecal valve without causing bowel obstruction. The cecum was then subjected to a single through and through perforation with a 16-gauge needle distal to point of ligation. The cecum was then gently squeezed to extrude some fecal contents, and repositioned. The abdominal muscles was closed by applying simple interrupted sutures with 4-0 silk suture. The skin layer were then closed using subcuticular running suture with 4-0 silk suture. Rats were resuscitated with 1 mL of warmed ringer solution subcutaneously. Sham-operated
-7-
animals were subjected to laparotomy intestinal manipulation and resuscitation procedures; however, the cecum was neither ligated nor punctured and used as control. 2.6. Assessment of liver function Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), gamma aminotransferase (γ-GT) and total bilirubin were determined using commercial kits from (Biodiagnostics, Badr, Egypt).
2.7. Preparation of liver homogenate Liver tissue samples were weighed and homogenized (1:10, w/v) in phosphate buffered saline (pH 7.4) in an ice bath using Omni-125 hand held homogenizer (Omni international, USA). The homogenate was centrifuged at 2000 g, 4ºC for 15 min. Oxidative stress biomarkers such as malondialdehyde (MDA), reduced glutathione (GSH) and Superoxide dismutase (SOD) and TNF-α were assessed on the supernatant of the liver homogenate 2.8. Measurement of MDA content, reduced GSH level and SOD activity in liver homogenate Thiobarbituric acid reactive substances were measured as MDA, the end product of lipid peroxidation. The absorbance was determined at 532 nm and expressed as nmol/g tissue (Ohkawa et al., 1979). The level of acid-soluble thiols, mainly GSH, in the liver was assayed colorimetrically by the method of Ellman which is based on the reaction of GSH with
-8-
Ellman’s reagent to give a yellow compound that absorbs at 412 nm. Concentrations were expressed as nmol/mg tissue (ELLMAN, 1959). Additionally, SOD activity in liver homogenate was measured by monitoring the degree of inhibition of the auto-oxidation of pyrogallol by SOD at an alkaline pH. The change in absorbance at 420 nm was recorded and activity was expressed as U/g tissue (Marklund and Marklund, 1974).
2.9. Determination of hepatic MPO activity The extent of neutrophils accumulation in the liver was measured by assaying myeloperoxidase (MPO) activity as previously described (Schierwagen et al., 1990) with a slight modification. Hepatic tissue was homogenized in 20 volumes of phosphate buffer (0.1 M NaCl, 0.02 M NaH2PO4, 0.015 M EDTA, pH 4.7) and centrifuged at 10,000 g for 15 min. The pellets were then re-suspended in 10 volumes of 0.05 M sodium phosphate buffer (pH
5.4)
containing
0.5%
(w/v)
hexadecyltrimethylammonium
bromide
and
re-homogenized. The suspension was freeze–thawed three times using liquid nitrogen, and then centrifuged. The assay was started by adding the supernatant to H2O2 and TMB solution and incubated for 5 min at 37 ºC. The reaction was terminated by adding 100 μl of 4 M H2SO4 at 4ºC. The obtained color was quantified at 450 nm. Results were expressed as a fold change over sham group. 2.10. Histopathological examination of liver Portion of liver was harvested and rinsed with ice-cold saline. Liver specimens were fixed in 10% neutral-buffered formalin for 24 h, embedded in paraffin wax, sectioned (6 μm), stained with hematoxylin–eosin (H&E) and was assessed for the presence of
-9-
inflammation. The tissues were examined under a microscope (Leica Imaging Systems, Cambridge, UK) in a random order and without knowledge on the animal or group 2.11. Determination of NF-κB DNA-Binding activity Nuclear proteins were extracted from hepatic tissues using a commercial kit (Abcam, Cambridge, USA). Relative DNA binding of nuclear p65 transcript was quantified using a commercial kit (Abcam, Cambridge, USA). Briefly, a specific double stranded DNA sequence containing the NF-κB response element was immobilized onto the wells of a 96 well plates so that it can bind specifically to the p65 in extract. The p65 was detected by addition of specific primary antibody directed against p65. A secondary antibody conjugated to HRP was added. The obtained color was quantified at 450 nm. Both positive and non-specific binding controls were included. Results were expressed as fold change over sham group. 2.12. Immunohistochemistry for NF-𝜅B p-65 NF-𝜅B p-65 protein was assessed by immunohistochemistry technique. Briefly, after de-paraffinization and rehydration antigen retrieval was performed. Sections were incubated with rabbit anti-NF-𝜅B p-65 polyclonal antibody (Thermo Scientific, Rockford, IL, USA) overnight at 4∘C. After washing, the samples were incubated with secondary antibody (Genemed biotechnologies, South San Francisco, USA) for 2 h at room temperature, and then visualized with diaminobenzidine. The sections were analyzed under light microscope (Leica). Appropriate controls were performed to exclude background or non-specific binding. 2.13. Measurement of TNF-α level in liver tissue
- 10 -
TNF-α level in the supernatant of the liver homogenate was determined by using commercial ELISA kit, according to the manufacturer's instructions (eBioscience, Inc., San Diego, USA). TNF-α concentration was determined from a standard curve ranging from 0 to 2500 pg/ml. Concentration of TNF-α in liver homogenate was expressed as pg/g protein. 2.14. Quantitative RT-PCR Total RNA was extracted from rat livers using TRIzol reagent (life technologies, California, USA) according to the manufacturer's instructions. The concentration and purity of the RNA were estimated using nanophotometer UV/Vis spectrophotometer (Implen GmbH, München, Germany). One µg from each sample was reverse transcribed into complementary DNA (cDNA) using Quantitect Reverse Transcription Kit, according to the manufacturer's instructions (Qiagen, Hilden, Germany). RT-PCR was performed with the thermocycler Rotor Gene Q (Qiagen), using HOT FIREPol EvaGreen qPCR mix plus kit (Solis BioDyne, Tartu, Estonia). The mRNA levels of TLR4, TNF-α and MPO were normalized relative to 18S ribosomal RNA (Rn18 S) in the same sample. Sequences of primers used in this study are shown in Table (1). The results were expressed as an n-fold change of the relative expression levels of target genes from control group using ∆∆Ct method. 2.15. Statistical Analysis: Data are expressed as mean ± standard error of the mean (SEM). Statistical analyses were carried out using one way analysis of variance (ANOVA) followed by Tukey-Kramer multiple comparisons post hoc test. Additionally, Kruskal-Wallis test was used followed by
- 11 -
Dunn's post hoc test for non-parametric measurement. Significance was considered at p<0.05. Statistical analyses and graphing were carried out using GraphPad Prism V 5.02 (GraphPad Software Inc., San Diego, CA, USA).
3. Results 3.1. Effect of pomegranate extract on CLP-induced mortality CLP significantly increased percentage of mortality when compared to sham group (Table 2). POM administration to normal rats did not show any significant effect on percentage of mortality when compared to sham group. Treatment with POM prior to CLP significantly prevented the CLP-induced elevated mortality. 3.2. Effect of pomegranate extract on CLP-induced changes in liver functions parameters in serum CLP significantly (p < 0.05, n=6) increased ALT, AST, ALP, γ-GT and total bilirubin by 77.5%, 46.6%, 69%, 683.7% and 617.4%, respectively as compared to the sham group (Figure 1). POM had no significant effect on these parameters when compared to sham group. The administration of POM prior to CLP significantly prevented the CLPinduced elevation in ALT, AST, ALP, γ-GT and total bilirubin. 3.3. Effect of pomegranate extract on CLP-induced changes in oxidative stress biomarkers in hepatic tissues In comparison with sham rats, CLP significantly (p < 0.05, n=6) decreased GSH level (Figure 2A), SOD activity (Figure 2B) and increased MDA content (Figure 2C) by 86.4%, 26.9% and 212.7% respectively. Rats receiving POM did not show any significant
- 12 -
effect on GSH level, SOD activity and MDA content when compared to sham group. POM treatment prior to CLP significantly prevented CLP-induced changes in hepatic oxidative stress biomarkers induced by CLP. 3.4. Effect of pomegranate extract on CLP-induced changes in mRNA expression and activity of MPO in hepatic tissues In comparison with sham group, hepatic mRNA expression and activity of MPO were significantly (p < 0.05, n=6) elevated in CLP group by 39% and 89.8%, respectively (Figure 3A and 3B). POM had no significant effect on hepatic mRNA expression and activity of MPO when compared to sham group. Pretreatment with pomegranate significantly prevented CLP-induced increase in hepatic mRNA expression and activity of MPO. 3.5. Effect of pomegranate extract on CLP-induced changes in histopathological examination of liver Histopathological examination of the liver using H&E stain in sham rats revealed normal liver architecture (Figure 4). Similarly, rats receiving POM revealed normal liver architecture and no abnormalities were observed. CLP caused a marked inflammatory cells infiltration, hydropic degeneration and central vein dilation and congestion. The administration of POM prior to CLP attenuated the histopathological changes induced by CLP. 3.6. Effect of pomegranate extract on CLP-induced changes mRNA expression of TLR4 in hepatic tissues CLP significantly (p<0.05, n=6) increased TLR4 mRNA expression when compared to sham group by 45% (Figure 5A). POM treatment in normal rats did not show any
- 13 -
significant effect on TLR4 mRNA expression when compared to sham group. Pretreatment with POM significantly decreased the elevated mRNA expression of TLR4 induced by CLP. 3.7. Effect of pomegranate extract on CLP-induced changes in DNA binding activity and protein expression of NF-κB subunit p65 in hepatic tissues Moreover, CLP significantly (p < 0.05, n=6) increased p65 DNA binding activity by 25% when compared to sham group (Figure 5B). POM did not show any significant effect on p65 DNA binding activity when compared to sham group. Pretreatment with POM significantly decreased the elevated NF-κB p65 DNA binding activity. Immunohistochemical examination indicated that p65 was limited to the cytoplasm in the majority of hepatic cells obtained from the sham rats, indicating that NF-κB was present in its inactive form. Rats received POM was not significant from sham group. In the livers of rats subjected to CLP, there was staining for p65 in the nuclei of hepatic cells indicating translocation of NF-κB to the nucleus. In rats subjected to CLP and pretreated with POM, p65 was limited to the cytoplasm in the majority of hepatic (Figure 6). 3.8. Effect of pomegranate extract on CLP-induced changes in mRNA and protein expression of TNF-α in hepatic tissues CLP caused a significant (p < 0.05, n=6) increase in mRNA and protein expression of TNF-α by 1100% and 81.6%, respectively when compared to sham group (Figure 7A and 7B). Rats receiving POM had no significant effect on TNF-α expression at both gene and protein levels when compared to sham group. Pretreatment with POM significantly prevented the CLP-induced elevation in mRNA and protein expression of TNF-α.
- 14 -
4. Discussion In the present study, CLP-induced acute liver injury was evidenced by increased mortality, elevated ALT, AST, ALP, γ-GT, total bilirubin and abnormalities in liver structure in histological section. Furthermore, polymorphonuclear leukocytes (PMN) trafficking activity was increased as indicated by histopathological examination, in addition to elevated MPO activity in liver tissues. Moreover, CLP activated TLR4/NF-κB pathway and subsequently increased TNF-α level. CLP also induced prominent oxidative stress as reflected by increased MDA content, decreased GSH level and SOD activity. Treatment with POM before CLP improved survival and attenuated the liver inflammatory response in polymicrobial sepsis model by inhibiting TLR4 expression, NF-κB p65 activation and associated cytokines release such as TNF-α. Additionally, PMN trafficking activity and prominent oxidative stress following sepsis induction were attenuated by POM pretreatment. It has been previously reported that hepatic injury following sepsis is well established by the elevated levels of hepatic enzymes such as AST, ALT and ALP in serum indicating cellular leakage and loss of functional integrity of hepatic membrane as they are released into blood stream when the liver cell plasma membrane is damaged (Mohamadin et al., 2011). This correlates with the present study which showed increased serum activity of AST, ALT, ALP, γ-GT and concentration of total bilirubin in CLP rats confirming the extensive liver damage induced by CLP. POM pretreatment decreased serum concentration of these hepatic markers indicating its ability to maintain functional integrity of hepatic membrane.
- 15 -
Additionally, histopathological examination confirmed this hepatic damage as CLP resulted in marked inflammatory cells infiltration, hepatocellular necrosis, and central vein dilation and congestion. Similarly, previous study showed that CLP produced inflammatory cells infiltration, swollen hepatocytes and hepatocellular necrosis in rats (Liu et al., 2015). Pretreatment with POM attenuated these histopathological changes confirming the protective effect of POM against the CLP-induced liver injury. Inflammation is one of major mechanisms involved in acute liver injury induced by sepsis and initiated by TLR4 activation. Therefore, expression of TLR4, NF-κB p65 DNA binding activity and associated cytokines such as TNF-α were estimated. TLR4 is one of the most important signal-transducing receptors for structurally diverse microbial molecules and can activate NF-κB to regulate immune reaction and the expression of many inflammatory cytokines such as TNF-α (Watson et al., 2008;Zhang et al., 2014). It has been previously reported that suppression of the TLR4 expression and NF-κB activation has a consequential correlation to inhibition of cytokines production in response to LPS and protection of liver tissues from being injured by excessive immune reactions (Watson et al., 2008;Zhang et al., 2014). Moreover, a recent study reported that inhibition of TNF-α is able to suppress the activation of TLR4 and NF-κB signaling pathway (Yang et al., 2014). The previous studies showed that CLP increased TLR4 mRNA expression (Yao et al., 2003), and NF-κB p65 expression and activity in rats' liver (Wang et al., 2013). Similarly, the present study showed that CLP increased TLR4 mRNA expression, and NF-κB p65 translocation and activity. Pretreatment with POM decreased TLR4 mRNA expression, and NF-κB p65 translocation and activity suggesting that inhibition of
- 16 -
TLR4/NF-κB might be a major pathway by which POM prevented CLP-induced acute liver inflammation. Activation of NF-κB p65 increases the expression of many proinflammatory cytokines; among these cytokines is TNF-α which is a major mediator of systemic inflammation (Li et al., 2013). TNF-α plays a central role in the development of acute hepatic failure after severe trauma and sepsis by directly or indirectly inducing hepatocyte necrosis rather than apoptosis (Wang et al., 1995). It has been reported that CLP elevated serum TNF-𝛼 protein level and mRNA expression of TNF-𝛼 in hepatic tissue of mice (Salkowski et al., 1998). In the current study, CLP increased mRNA and protein expression of TNF-α in hepatic tissues. This upregulation can directly lead to hepatocellular damage. POM pretreatment decreased the elevated TNF-α at both mRNA and protein levels confirming that POM has antiinflammatory effect mediated through inhibition of NF-κB and associated cytokines as TNF-𝛼. This systemic inflammatory cascade during sepsis results in PMN infiltration to site of injury/infection. PMN extravasation subsequently can lead to vascular dysfunction as well as parenchymal cell dysfunction (Mohamadin et al., 2011). Free radicals seem to trigger the accumulation of leukocytes in the tissue involved, and thus cause further injury through activated neutrophils. It has been shown that activated neutrophils secrete MPO and liberate oxygen radicals (Haegens et al., 2009;Srivastava et al., 2010). Since activity of MPO positively correlated with the number of PMNs and severity of inflammation, it is more commonly used to evaluate tissue PMNs accumulation in inflamed tissues (El et al., 2009; Lingaraju et al., 2015).
- 17 -
It has been previously reported that CLP increased MPO activity in hepatic rats (Mohamadin et al., 2011). In the present study, MPO mRNA expression and activity was markedly increased in CLP rats and pretreatment with POM lowered MPO mRNA expression and activity indicating its attenuating effect on neutrophils infiltration mediating liver damage. This was further supported by histopathological examination showing decrease in PMN infiltration in hepatic tissues. It has been previously reported that ellagic acid has anti-inflammatory effects on concovalin A-induced hepatitis mediated through suppression of TLR and mitogenactivated protein kinase/ NF-κB pathway (Lee et al., 2014). Therefore, anti-inflammatory effects of POM on acute liver injury induced by CLP may be mediated through its ellagic acid content. Since oxidative stress is another pathway involved in acute liver injury, lipid peroxidation (LPO) and antioxidant enzymes such as SOD and GSH were estimated. Previous study reported that activated neutrophils are a potential source of ROS which generate hypocholorus acid in the presence of MPO leading to tissue damage (Haegens et al., 2009). LPO of hepatocyte membranes is one of the principal causes of LPS-induced hepatotoxicity, and is mediated by the generation of ROS (Macdonald et al., 2003). In the present study, CLP resulted in a significant increase in the hepatic MDA level, as indicator of lipid peroxidation. Pretreatment with POM protected the liver against LPO. It clearly demonstrates that POM effectively quenches the free radicals indicating its antioxidant properties. Antioxidant enzymes like GSH and SOD are considered to be a primary defense that prevents biological macromolecules from oxidative damage. LPS induced toxicity
- 18 -
might result in decreased activities of enzymatic antioxidants. It may be due to their increased usage in scavenging free radicals induced by the LPS thus causing irreversible inhibition in their activities (Zhao et al., 2008). In the present study, CLP reduced hepatic SOD activity and GSH level. POM was found to increase the activities of these antioxidant enzymes, suggesting that scavenging of ROS may be due to its effective antioxidant activity, consequently resulting in reduced oxidative stress. Similarly, the study of Mohamadin et al. (2011) reported that LPS increased hepatic MDA level and decreased SOD activity and GSH level in rats (Mohamadin et al., 2011). Lin et al., reported that punicalagin and punicalin have anti-oxidant activity against acetaminophen induced liver damage in rats (Lin et al., 2001). Therefore, POM may exert its antioxidant effect through its punicalagin content. In conclusion, POM could prevent sepsis-induced ALI in rats through its antiinflammatory effects mediated through inhibition of TLR4 expression, NF-κB activity, associated TNF-α release, and neutrophil infiltration in addition to its antioxidant effects.
Conflict of interest statement: None declared.
5. References Abraham, E., 2003. Nuclear factor-kappaB and its role in sepsis-associated organ failure. J Infect Dis 187 Suppl 2, S364-S369. Camara-Lemarroy, C.R., Guzman-DE LA Garza FJ, Cordero-Perez, P., Ibarra-Hernandez, J.M., Munoz-Espinosa, L.E., Fernandez-Garza, N.E., 2015. Gemfibrozil attenuates the inflammatory response and protects rats from abdominal sepsis. Exp Ther Med 9, 10181022.
- 19 -
Cekmen, M., Otunctemur, A., Ozbek, E., Cakir, S.S., Dursun, M., Polat, E.C., Somay, A., Ozbay, N., 2013. Pomegranate extract attenuates gentamicin-induced nephrotoxicity in rats by reducing oxidative stress. Ren Fail 35, 268-274. Colombo, E.S.E.D.M., 2013. A Review on the Anti-Inflammatory Activity of Pomegranate in the Gastrointestinal Tract. Evid Based Complement Alternat Med doi: 10.1155/2013/247145. Dejager, L., Pinheiro, I., Dejonckheere, E., Libert, C., 2011. Cecal ligation and puncture: the gold standard model for polymicrobial sepsis? Trends Microbiol 19, 198-208. Dhainaut, J.F., Marin, N., Mignon, A., Vinsonneau, C., 2001. Hepatic response to sepsis: interaction between coagulation and inflammatory processes. Crit Care Med 29, S42-S47. Dikmen, M., Ozturk, N., Ozturk, Y., 2011. The antioxidant potency of Punica granatum L. Fruit peel reduces cell proliferation and induces apoptosis on breast cancer. J Med Food 14, 1638-1646. El, K.D., Jozsef, L., Pan, W., Wang, L., Petasis, N.A., Serhan, C.N., Filep, J.G., 2009. 15epi-lipoxin A4 inhibits myeloperoxidase signaling and enhances resolution of acute lung injury. Am J Respir Crit Care Med 180, 311-319. ELLMAN, G.L., 1959. Tissue sulfhydryl groups. Arch Biochem Biophys 82, 70-77. Farghali, H., Cerny, D., Kamenikova, L., Martinek, J., Horinek, A., Kmonickova, E., Zidek, Z., 2009. Resveratrol attenuates lipopolysaccharide-induced hepatitis in Dgalactosamine sensitized rats: role of nitric oxide synthase 2 and heme oxygenase-1. Nitric Oxide 21, 216-225. Haegens, A., Heeringa, P., van Suylen, R.J., Steele, C., Aratani, Y., O'Donoghue, R.J., Mutsaers, S.E., Mossman, B.T., Wouters, E.F., Vernooy, J.H., 2009. Myeloperoxidase deficiency attenuates lipopolysaccharide-induced acute lung inflammation and subsequent cytokine and chemokine production. J Immunol 182, 7990-7996. Huang, X., Tang, J., Cai, H., Pan, Y., He, Y., Dai, C., Chen, A., Yu, X., Chen, M., Zou, L., Wang, L., 2015. Anti-Inflammatory Effects of Monoammonium Glycyrrhizinate on Lipopolysaccharide-Induced Acute Lung Injury in Mice through Regulating Nuclear Factor-Kappa B Signaling Pathway. Evid Based Complement Alternat Med doi: 10.1155/2015/272474. Khan, N., Syed, D.N., Pal, H.C., Mukhtar, H., Afaq, F., 2012. Pomegranate fruit extract inhibits UVB-induced inflammation and proliferation by modulating NF-kappaB and MAPK signaling pathways in mouse skin. Photochem Photobiol 88, 1126-1134.
- 20 -
Kobayashi, T., Tashiro, K., Cui, X., Konzaki, T., Xu, Y., Kabata, C., Yamamoto, K., 2001. Experimental models of acute respiratory distress syndrome: clinical relevance and response to surfactant therapy. Biol Neonate 80 Suppl 1, 26-28. Lee, J.H., Won, J.H., Choi, J.M., Cha, H.H., Jang, Y.J., Park, S., Kim, H.C., Kim, D.K., 2014. protective effect of ellagic acid on concovalin A-induced hepatitis via toll-like receptor and mitogen activated protein kinase/nuclear factor κB signalling pathways. J Agric Food Chem 62, doi: 10.1021/jf503188c. Li, X.H., Gong, X., Zhang, L., Jiang, R., Li, H.Z., Wu, M.J., Wan, J.Y., 2013. Protective effects of polydatin on septic lung injury in mice via upregulation of HO-1. Mediators Inflamm doi: 10.1155/2013/354087. Lin, C.C., Hsu, Y.F., Lin, T.C., Hsu, H.Y., 2001. Antioxidant and hepatoprotective effects of punicalagin and punicalin on acetaminophen-induced liver damage in rats. Phytother Res 15, 206-212 Lingaraju, M.C., Pathak, N.N., Begum, J., Balaganur, V., Bhat, R.A., Ramachandra, H.D., Ayanur, A., Ram, M., Singh, V., Kumar, D., Kumar, D., Tandan, S.K., 2015. Betulinic acid attenuates lung injury by modulation of inflammatory cytokine response in experimentallyinduced polymicrobial sepsis in mice. Cytokine 71, 101-108. Liu, A., Wang, W., Fang, H., Yang, Y., Jiang, X., Liu, S., Hu, J., Hu, Q., Dahmen, U., Dirsch, O., 2015. Baicalein protects against polymicrobial sepsis-induced liver injury via inhibition of inflammation and apoptosis in mice. Eur J Pharmacol 748, 45-53. Macdonald, J., Galley, H.F., Webster, N.R., 2003. Oxidative stress and gene expression in sepsis. Br J Anaesth 90, 221-232. Manna, P., Sinha, M., Sil, P.C., 2007. Protection of arsenic-induced hepatic disorder by arjunolic acid. Basic Clin Pharmacol Toxicol 101, 333-338. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 47, 469-474. Mohamadin, A.M., Elberry, A.A., Elkablawy, M.A., Gawad, H.S., Al-Abbasi, F.A., 2011. Montelukast, a leukotriene receptor antagonist abrogates lipopolysaccharide-induced toxicity and oxidative stress in rat liver. Pathophysiology 18, 235-242. Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 95, 351-358. Pushpavalli, G., Kalaiarasi, P., Veeramani, C., Pugalendi, K.V., 2010. Effect of chrysin on hepatoprotective and antioxidant status in D-galactosamine-induced hepatitis in rats. Eur J Pharmacol 631, 36-41.
- 21 -
Sadik, N.A., Shaker, O.G., 2013. Inhibitory effect of a standardized pomegranate fruit extract on Wnt signalling in 1, 2-dimethylhydrazine induced rat colon carcinogenesis. Dig Dis Sci 58, 2507-2517. Sakaguchi, S., Furusawa, S., 2006. Oxidative stress and septic shock: metabolic aspects of oxygen-derived free radicals generated in the liver during endotoxemia. FEMS Immunol Med Microbiol 47, 167-177. Salkowski, C.A., Detore, G., Franks, A., Falk, M.C., Vogel, S.N., 1998. Pulmonary and hepatic gene expression following cecal ligation and puncture: monophosphoryl lipid A prophylaxis attenuates sepsis-induced cytokine and chemokine expression and neutrophil infiltration. Infect Immun 66, 3569-3578. Schierwagen, C., Bylund-Fellenius, A.C., Lundberg, C., 1990. Improved method for quantification of tissue PMN accumulation measured by myeloperoxidase activity. J Pharmacol Methods 23, 179-186. Shukla, M., Gupta, K., Rasheed, Z., Khan, K.A., Haqqi, T.M., 2008. Consumption of hydrolyzable tannins-rich pomegranate extract suppresses inflammation and joint damage in rheumatoid arthritis. Nutrition 24, 733-743. Srivastava, A., Maggs, J.L., Antoine, D.J., Williams, D.P., Smith, D.A., Park, B.K., 2010. Role of reactive metabolites in drug-induced hepatotoxicity. Handb Exp Pharmacol165194. Viladomiu, M., Hontecillas, R., Lu, P., Bassaganya-Riera, J., 2013. Preventive and prophylactic mechanisms of action of pomegranate bioactive constituents. Evid Based Complement Alternat Med 2013, doi: 10.1155/2013/789764. Wang, H.L., Xing, Y.Q., Xu, Y.X., Rong, F., Lei, W.F., Zhang, W.H., 2013. The protective effect of lidocaine on septic rats via the inhibition of high mobility group box 1 expression and NF-kappaB activation. Mediators Inflammdoi: 10.1155/2013/570370. Wang, J.H., Redmond, H.P., Watson, R.W., Bouchier-Hayes, D., 1995. Role of lipopolysaccharide and tumor necrosis factor-alpha in induction of hepatocyte necrosis. Am J Physiol 269, G297-G304. Watson, M.R., Wallace, K., Gieling, R.G., Manas, D.M., Jaffray, E., Hay, R.T., Mann, D.A., Oakley, F., 2008. NF-kappaB is a critical regulator of the survival of rodent and human hepatic myofibroblasts. J Hepatol 48, 589-597. Yan, J., Li, S., Li, S., 2014. The role of the liver in sepsis. Int Rev Immunol 33, 498-510. Yang, F., Li, X., Wang, L.K., Wang, L.W., Han, X.Q., Zhang, H., Gong, Z.J., 2014. Inhibitions of NF-kappaB and TNF-alpha result in differential effects in rats with acute on chronic liver failure induced by d-Gal and LPS. Inflammation 37, 848-857.
- 22 -
Yao, Y.M., Yan, X.J., Yao, F.H., Cheng, M.H., Dong, N., Yu, Y., Sheng, Z.Y., 2003. [Changes in Toll-like receptor 2 and 4 gene expression in vital organs in septic rats and their regulation mechanisms]. Zhongguo Wei Zhong Bing Ji Jiu Yi Xue 15, 646-650. Yaylak, F., Canbaz, H., Caglikulekci, M., Dirlik, M., Tamer, L., Ogetman, Z., Polat, Y., Kanik, A., Aydin, S., 2008. Liver tissue inducible nitric oxide synthase (iNOS) expression and lipid peroxidation in experimental hepatic ischemia reperfusion injury stimulated with lipopolysaccharide: the role of aminoguanidine. J Surg Res 148, 214-223. Zhang, S., Yang, N., Ni, S., Li, W., Xu, L., Dong, P., Lu, M., 2014. Pretreatment of lipopolysaccharide (LPS) ameliorates D-GalN/LPS induced acute liver failure through TLR4 signaling pathway. Int J Clin Exp Pathol 7, 6626-6634. Zhao, L., Chen, Y.H., Wang, H., Ji, Y.L., Ning, H., Wang, S.F., Zhang, C., Lu, J.W., Duan, Z.H., Xu, D.X., 2008. Reactive oxygen species contribute to lipopolysaccharide-induced teratogenesis in mice. Toxicol Sci 103, 149-157.
- 23 -
Figure legends: Figure (1): Effect of pomegranate extract on CLP-induced changes in liver functions parameters in serum
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and serum was collected 24 h after CLP to measure ALT (A), AST (B), ALP (C), γ-GT (D) and total bilirubin (E). Data are expressed as mean ± SEM, n=6. *, # p0.05, significantly different from sham and CLP groups, respectively using oneway ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. ALT, alanine transaminase; ALP, alkaline phosphatase; AST, aspartate transaminase; CLP, cecal ligation and puncture; γ-GT, gamma-glutamyl transferase and POM; pomegranate.
- 24 -
Figure (2): Effect of pomegranate extract on CLP-induced changes in oxidative stress biomarkers in hepatic tissues
- 25 -
- 26 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to measure GSH (A); SOD (B) and MDA (C). Data are expressed as mean ± SEM, n=6. *,
#
p0.05, significantly different from sham and CLP groups, respectively using
one-way ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; GSH, reduced glutathione; MDA, malondialdehyde; POM; pomegranate and SOD, superoxide dismutase.
- 27 -
Figure (3): Effect of pomegranate extract on CLP-induced changes in mRNA expression and activity of MPO in hepatic tissues.
- 28 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to assess relative mRNA expression of MPO (A) and MPO activity (B). Data are expressed as mean ± SEM, n=6. *,
#
p0.05, significantly different from sham, CLP group respectively using one-way
ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; MPO, myeloperoxidase and POM, pomegranate.
- 29 -
Figure (4): Effect of pomegranate extract on CLP-induced changes in histopathological examination of liver.
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and liver tissues were collected 24 h after CLP for histopathological examination of the liver using H&E (X100) stain, n=6. Sham and POM rats revealed normal liver architecture. CLP caused a marked inflammatory cells infiltration, hepatocellular necrosis, and central vein dilation and congestion. The administration of POM prior to CLP attenuated the histopathological changes induced by CLP. CLP, cecal ligation and puncture and POM, pomegranate.
- 30 -
Figure (5): Effect of pomegranate extract on CLP-induced changes in TLR4 mRNA expression in addition to DNA binding activity of NF-κB p65 in hepatic tissues.
- 31 -
- 32 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to assess relative mRNA expression of TLR 4 (A) and NF-κB p65 DNA binding activity (B). Data are expressed as mean ± SEM, n=6. *, # p0.05, significantly different from sham and CLP groups, respectively using oneway ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; NF-κB, nuclear factor-Kappa B; POM, pomegranate and TLR, toll-like receptor-4.
- 33 -
Figure (6): Effect of pomegranate extract on CLP-induced changes in protein expression of NF-κB subunit p65 in hepatic tissues.
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP for immunohistochemical examination of transcription factor NF-κB subunit p65 using light microscope (X400), n=3. CLP, cecal ligation and puncture; NF-κB, nuclear factor-Kappa B and POM, pomegranate.
- 34 -
Figure (7): Effect of pomegranate extract on CLP-induced changes in mRNA and protein expression of TNF-α in hepatic tissues.
- 35 -
- 36 -
POM (800 mg/kg, orally) was given for two weeks before induction of CLP and hepatic tissues were collected 24 h after CLP to assess relative mRNA expression of TNF-α (A) and TNF-α protein level (B). Data are expressed as mean ± SEM, n=6. *,
#
p0.05, significantly different from sham, CLP group respectively using one-way
ANOVA followed by Tukey-Kramer multiple comparisons post hoc test. CLP, cecal ligation and puncture; TNF-α, tumor necrosis factor-alpha and POM, pomegranate.
- 37 -
Table (1): Primers used for quantitative RT-PCR: Primer sense
Sequence
Amplicon size
AGTTGGTG GAGCGATTTGTC 121
Rn18 S antisense
GAACGCCACTTGTCC CTCTA
sense
TGTTCCTTTCCTGCCTGAGA 129
TLR4 antisense
GGTTCTTGGTTGAATAAGGGATG
sense
ATGTGGAACTGGCAGAGGAG 195
TNF-α antisense
TGGAACTGATGAGAGG GAG
sense
CTGGAGAGTTGTGCTGGAAG 75
MPO antisense
CGATTCAGTTTGGCAGGAGT
MPO, myeloperoxidase; Rn18 S, 18S ribosomal RNA; TLR, toll-like receptor-4; TNF-α, tumor necrosis factor-α.
- 38 -
Table (2): Effect of pomegranate extract on CLP-induced mortality
Mortality percent
Sham
POM
CLP
CLP+POM
0
0
69.4*
11.1#
POM (800 mg/kg, orally) was given for two weeks before induction of CLP. 24 h after CLP, percentage of mortality was assessed. Data are expressed as mean ± SEM. *,
#
p0.05, significantly different from sham, CLP group, respectively using
Kruskal-Wallis test was used
followed by Dunn's post hoc test for non-parametric
measurement at p0.05, n=18. Pomegranate (POM); cecal ligation and puncture (CLP)
- 39 -