Pomegranate (Punica granatum) peel is effective in a murine model of experimental Cryptosporidium parvum ultrastructural studies of the ileum

Experimental Parasitology 134 (2013) 482–494

Contents lists available at SciVerse ScienceDirect

Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr

Pomegranate (Punica granatum) peel is effective in a murine model of experimental Cryptosporidium parvum ultrastructural studies of the ileum Ebtisam M. Al-Mathal ⇑, Afaf A. Alsalem Department of Biology, College of Science, University of Dammam, Dammam 31311, Saudi Arabia

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

 C. parvum-infected mice were treated

with pomegranate peel suspension.  Suspension-treated mice showed substantial parasite decomposition and death.  Suspension treatment restored normal villi structures and eliminated acute symptoms.  Suspension treatment directly affected C. parvum at various development stages.

G: Photomicrographs of transverse sections of the ileums of infected/untreated mice Showing: C. parvum trophozoite between degenerated microvilli and evidence of complete degeneration of columnar epithelial cells with their intracellular contents spilled out into the lumen (arrow head) K: Photomicrographs of transverse sections of the ileums of infected/P. granatum-treated mice Showing: Improvement in epithelial cell structure, including an increase in the number of Golgi apparatus elements, the normal distribution of mitochondria, and many lysosomes. B: Photomicrographs of C. parvum in transverse sections of the ileums of infected/untreated mice Showing: Merozoite with a large nucleus that has penetrated the host cell and has lateral processes that extend towards the upper surface of the epithelial cell. C: Photomicrographs of C. parvum in transverse sections of the ileums of infected/P. granatum-treated mice Showing: Degenerated nucleus and cytoplasm and malformation of the FO and parasitophoric envelope (PI).

a r t i c l e

a b s t r a c t

i n f o

Article history: Received 12 October 2012 Received in revised form 27 March 2013

The current treatments for cryptosporidiosis are ineffective, and there is an urgent need to search for more effective and safer alternatives. One such alternative may be treatments derived from natural resources. The pomegranate peel has been used effectively in traditional medicine to cure diarrhea and dysentery. The purpose of this study was to examine the effectiveness of a Punica granatum (pomegran-

Abbreviations: pi, post-inoculation; TEM, transmission electron microscope; IBD, inflammatory bowel disease.

⇑ Corresponding author. Fax: +966 38469854.

E-mail address: [email protected] (E.M. Al-Mathal). 0014-4894/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.exppara.2013.05.004

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494 Accepted 2 May 2013 Available online 16 May 2013 Keywords: Cryptosporidium parvum Punica granatum Oocyst shedding Ultrastructure of villi Ultrastructure of C. parvum

483

ate) peel suspension as a treatment for Cryptosporidium parvum infection. In this study, the effects of this treatment on the ultrastructure of both the intestinal epithelial layer of infected nursling mice and the parasite were observed with a transmission electron microscope. The histological study focused on the examination of the microvilli, columnar epithelium, goblet cells, lamina propria, and crypts of Lieberkuhn. Examination of the ileums of infected mice that received the pomegranate peel suspension demonstrated that the general structure of the ileal tissue of these mice was similar to that of the control group. In the infected mice treated with the suspension, but not the infected/untreated mice, there was an improvement in all ultrastructure aspects at 28 days post-inoculation. The study of the ultrastructure of the parasite (C. parvum) in mice treated with the suspension showed that there was decomposition in the parasite to the extent that in some cases we were unable to identify the stage of the parasite due to the severe degeneration. Significant decomposition of the nutrition organ was also observed. Additionally, microgamonte and macrogamonte were not observed in the suspension-treated group, explaining the disappearance of the sexual phases of the parasite in the lumens of this group. In all, this examination demonstrated the restoration of the normal structures of villi and the disappearance of acute symptoms in the suspension-treated mice and showed that the suspension directly affected the parasite at various stages of its development and led to its decomposition and death. Ó 2013 Elsevier Inc. All rights reserved.

1. Introduction Cryptosporidium parvum is a parasitic protozoan that develops in the intestinal tract of humans and other mammals. The parasite develops within the microvillus membrane of enterocytes causing the loss of villous enterocytes and villous atrophy that lead to severe diarrhea. Cryptosporidiosis is most common in young calves and may lead to weight loss and significant morbidity (Fayer and Ungar, 1986). The intracellular but extracytoplasmic nature of Cryptosporidium presents a unique challenge in terms of chemotherapeutic control due to its unusual parasitological niche (Armson et al., 2003). Over the last several years, many anticoccidial drugs that have been examined for their efficacy as anti-cryptosporidiosis treatments, including tultrazuril, have shown little effect against Cryptosporidium (Armson et al., 1999). Many drugs have been tried as treatments against cryptosporidiosis but have shown at best limited effectiveness in treating the disease in ruminants (Waters et al., 2000; Guitard et al., 2006; Castro-Hermida and Ares-Mazás, 2003; Castro-Hermida et al., 2004; Smith and Corcoran, 2004). Nita zoxanide, paromomycin, and halofuginone lactate are the most important treatments and have shown some efficacy in reducing parasite effectiveness, but cannot completely eliminate the parasite in lambs and calves (Viu et al., 2000; Schnyder et al., 2009; Silverlas et al., 2009; De Waele et al., 2010). In fact, several studies suggest the lack of an effective treatment for cryptosporidiosis (Theodos et al., 1998; Kayser et al., 2002; Del Coco et al., 2009). New and active cures for cryptosporidiosis are urgently needed. Cures derived from alternative local medicines may lead to new effective compounds with useful activities. Pomegranate (Punica granatum L., family: Punicaceae) is a promising alternative treatment of plant origin that has antibacterial (Braga et al., 2005; Naz et al., 2007; Choi et al., 2009), antimalarial (Dell’Agli et al., 2009), and antiheminthic (Prakash et al., 1980; Akhtar and Riffat, 1985; Pradhan et al., 1992; Korayem et al., 1993; Fernandes et al., 2004) effects. Moreover, pomegranate is used frequently in local medicine for curing diarrhea (Sudheesh and Vijayalakshmi, 2005) and ulcers (Caceres et al., 1987) and as an anti-parasitic agent (Nagvi et al., 1991). Although there are some limited electron microscopy studies on the structure and pathology of Cryptosporidium (in vitro), there are very few studies on the acute impact of therapeutic materials on the ultrastructure of parasites in the lumens of infected animals (in vivo). This may be because of the difficulty and high cost of such a study. Such an ultra structural study, however, provides invaluable information about how therapeutic material affects cells of both the parasite and the host. Our last study tested the effective-

ness of an aqueous suspension of pomegranate peel against cryptosporidiosis (Al-Mathal and Alsalem, 2012), the presence of diarrhea, oocyst shedding, and weight gain/loss, and the histopathology of ileal sections were examined. Infected mice treated with the P. granatum peel suspension showed improvement in all parameters examined. Additionally, these mice did not exhibit any clinical symptoms and no deaths occurred. This study continues that work by testing the impact of pomegranate peel on the ultrastructure of both villous enterocytes and parasites in mice that are experimentally infected with C. parvum. 2. Materials and methods 2.1. Preparation of oocysts We collected C. parvum oocysts from naturally-infected calves. Oocysts were concentrated according to Heelan and Ingersoll (2002); identified with the modified Zeihl-Neelson technique (Henriksen and Pohlenz, 1981) and ELISA (Cryptosporidium bovine ELISA kit; Cypress Diagnostics, Langdrop, Belgium); and confirmed as C. parvum with polymerase chain reaction of the polythreonine gene, using C. parvum specific primers (cry 44: CTCTTAATCCAATCATTACAAC and cry 39: GAGTETAA TAATAA ACC ACTG) and according to Wu et al., 2000 (data not shown). Sedimented oocysts were collected and stored in a 2.5% potassium dichromate solution at 4 °C. Prior to experimentation, we concentrated oocysts (Heelan and Ingersoll, 2002) in a phosphate-buffered saline solution, where they were enumerated with a hemocytometer. 2.2. Plant materials We obtained P. granatum peels from fruit purchased at a local market. The Botany Department at the University of Dammam authenticated samples. Peels were cold-dried under ambient conditions, pulverized, and stored at 4 °C. 2.3. Animals We obtained pregnant, white, albino mice (Laurent et al., 1999; Sherwood et al., 1982) no more than 3 months old from the Arabian Gulf University animal home. We tested mice for infection over 10 consecutive days and housed each litter with its mother in separate cages under hygienic conditions. The mothers remained with their nurslings to feed them as needed throughout the course of the experiment. Animal fodder (General Organization of Grain Silos and Flour Mills, Dammam, Saudi Arabia) and water

484

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

were supplied ad libitum. Temperature and humidity were maintained at 20–21 °C and 30–40%, respectively. All animal protocols followed those used by the Faculty of Medicine, King Faisal University.

peel suspension-treated; and G5: infected/P. granatum peel suspension-treated. Mice were numbered and examined to ensure that none had any infection. Mice in G2 and G5 were infected at 4 days old by gastric tube administration of a dose of 1  103 C. parvum oocysts.

2.4. Experimental design 2.5. P. granatum treatments We divided nurslings into five groups (G1–G5) of 18 mice each: G1: healthy control (negative control); G2: infected/untreated; G3: uninfected/distilled water-treated; G4: uninfected/P. granatum

Therapeutic doses of P. granatum were administered to the animals in G3, G4, and G5 on Day 7, when oocysts first appeared in the

Fig. 1. Photomicrographs of transmission electron micrographs of the ileums of healthy control mice G1 (A–E), infected/untreated mice G2 (F–J), and infected/P. granatumtreated mice G5 (K–O) at day 14 post-inoculation. F: Degenerated columnar epithelium with depletion of nuclear euchromatin (arrow heads), dilated mitochondrial cristae (arrow), and malformation of the microvilli. G: C. parvum trophozoite at the site of severely degenerated tissue (arrow head), damaged intracellular junctions (arrows), and cellular contents spilled out into the lumen. H: Goblet cell with a pyknotic nucleus, hyper-secretory Golgi saccules (arrow heads), and vacuoles. I: Lamina propria with leukocyte infiltration. J: Widening of the pericellular spaces, damaged intracellular junctions (arrows), pyknotic nuclei of epithelial cells (arrow heads), and edema (stars). K: Regenerated columnar epithelium. The mitochondria have redistributed back towards normal shape, the nuclei have regained their oval shape, but the Golgi still shows atrophy. L: Regenerated microvilli. M: An almost normal goblet cell with rich mucous secretions. N: Vacuoles in the lamina propria and the nuclei are irregular with dark chromatin. O: Renewal of the crypts of Lieberkuhn with wide lumens and Paneth cells rich in secretion granules. Magnification: A, J, K, and L: 4000; B and L: 20,000; C, F, G, and H: 8000; D, I, and M: 5400; E: 2800; N: 10,000. Abbreviations: columnar epithelium (CE), mitochondria (M), nucleus (N), microvilli (MV), basement membrane (BM), golgi apparatus (G), rough endoplasmic reticulum (RER), smooth endoplasmic reticulum (SER), goblet cell (GC), lamina propria (LP), lymphocyte (LC), plasma cell (PC), macrophage (MA), eosinophil (E), crypts of lieberkuhn (CL), paneth cell (PC), central lumen (L), lysosome (LY), vacuole (V), C. parvum trophozoite (CT).

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

485

Fig. 1. (continued)

feces [hereafter called the post-inoculation (pi) day]. P. granatum doses of 3 g/kg body weight were freshly prepared as 3 g/ml P. granatum peel in distilled water and administered daily by gastric tubes 1 h before meals and for 3 consecutive weeks (Akhtar and Riffat, 1985). To determine the potency of the treatments, we gave the animals a 10-day recovery period at the end of the treatment period.

College (Universityof Dammam-Formerly known asy King Faisal University).

2.6. Histopathological analysis

The ultrastructures of the ileums of mice in the control group (G1) on days 14 pi are shown in Fig. 1A–D. The columnar epithelium with rich mitochondria had well-developed apical microvilli, while goblet cells appeared to have rich mucous secretions (Fig. 1C). The lamina propria contained lymphocytes, plasma cells, macrophages, and eosinophils (together, these cells form the gutassociated lymphoid tissue (Fig. 1D). The crypts of Lieberkuhn were lined with epithelial cells, and some Paneth cells were found within the epithelial cell lining and had abundant rough endoplasmic reticulum and large secretory granules with protein cores sur-

We humanely sacrificed three mice from each group at 14 and 28 days after pi. At that time, small parts of the ileums were excised, fixed in 4% glutaraldehyde with a 0.2 M cacodylate buffer (pH 7.2), post-fixed in 1% osmium tetraoxide for 4 h at 4 °C, dehydrated, and embedded in resin. Semi-thin sections were stained with toluidine blue and ultra-thin sections were stained with uranyl acetate and lead citrate. All were examined with a transmission electron microscope (TEM; Model Jeol-JEM-100 C X II; Medicine

3. Results 3.1. Examination of the ileal ultrastructure by transmission electron microscopy

486

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

Fig. 1. (continued)

rounded by lysosomes. Ultrastructures of the ileums of mice in the control group (G1) on days 28 pi showed the similar normal structure (data not shown). The ultrastructure of the ileums of infected mice (group G2) at day 14 pi (Fig. 1F–J) showed decomposition of the columnar epithelium (absorptive) with depletion of the nuclear chromatin and dilated cisternae of the Golgi apparatus. There was also malformation of the microvilli, with the microvilli losing their regularity and appearing as small blebs (Fig. 1F). C. parvum was observed at sharp histological decomposition tissue, intracellular junctions were found to be damaged, and malformation of most of cellular organelles was revealed (Fig. 1G). There were many alterations in goblet cells (Fig. 1H), including pyknotic nuclei, decreases in mucous secretion at the cell apices, and hypersecretory saccules of the Golgi apparatus. Further, many vacuoles were observed in the cytoplasm. Examination of the lamina propria (Fig. 1I) revealed slight edema and the presence of many different types of leukocytes, including lymphocytes and macrophages. In the crypts of Lieberkuhn (Fig. 1J), there was noticeable widening

of the pericellular space, damaged intercellular junctions, and a slight edematous region that surrounded the crypts. At day 28 pi, the ileal ultrastructure of the G2 group (Fig. 2F–J) showed highly damaged columnar epithelial cells with pyknotic nuclei, complete degeneration of the cell membranes, exposed cytoplasm, damage to the mitochondria that included the loss of cristae, fragmentation of the rough endoplasmic reticulum, and the depression of ribosomes (Fig. 2F). The microvilli were torn, and many no longer had a lumen. Goblet cells lost most of their organelles, had dead nuclei, and lacked mucous secretions (Fig. 2H), while the lamina propria showed dilated blood vessels and the agglutination of many inflammatory cells (Fig. 2I). The damage to the crypts of Lieberkuhn was increased compared to day 14 pi as the spaces between cells were extended, the crypts had lost their regular structure, and there were vacuoles in the cytoplasm (Fig. 2J). Compared to ultrastructure of the ileal villi of the G2 mice, the ultrastructure of the ileal villi of the infected mice that received the pomegranate peel suspension (the G5 group) was substantially less

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

487

Fig. 2. Photomicrographs of transverse sections of the ileums of infected/untreated mice G2 (F–J), and infected/P. granatum-treated mice G5 (K–O) at day 28 post-inoculation. F: Columnar epithelial cell with complete degeneration of the cytoplasm, mitochondria that have lost their cristae, many vacuoles in the cytoplasm, rough endoplasmic reticulum that has been fractured into small fragments, and ribosomes that are scattered in the cytoplasm (stars). G: C. parvum trophozoite between degenerated microvilli and evidence of complete degeneration of columnar epithelial cells with their intracellular contents spilled out into the lumen (arrow head). H: Goblet cell with a pyknotic nucleus and limited mucous secretions. I: Severe edema in the lamina propria (arrow) . J: Crypts of Lieberkuhn that have lost their regular structure and demonstrate lymphocyte infiltration (arrow), some vacuoles in the cytoplasm of the epithelial cells, and widening of the intracellular spaces. K: Improvement in epithelial cell structure, including an increase in the number of Golgi apparatus elements, the normal distribution of mitochondria, and many lysosomes. L: Improvement in the microvilli as they have regained their regular shape and length. M: Goblet cell with limited secretions, a normal nucleus, and atrophy of the Golgi apparatus elements (arrow). N: Improvement in the lamina propria with some inflammatory cells still present. O: Regenerated crypts of Lieberkuhn epithelium with regular nuclei. Magnification: F, K, and M: 5400; L: 20,000; I and N: 4000; G and H: 8000; J and O: 2800. Abbreviations: mitochondria (M), nucleus (N), microvilli (MV), golgi apparatus (G), vacuoles (V), goblet cell (GC), lamina propria (LP), lysosomes (LY).

damaged and had better general architecture at day 14 pi (Fig. 1K– O). Epithelial cells of the G5 group showed remarkable recovery and returned to their regular form, as evidenced by their nuclei regaining their regularity and becoming darker, the return of normal mitochondrial distribution, and microvilli being of normal length. However, hypertrophy of the Golgi apparatus was still apparent (Fig. 1L). Goblet cells were thick with mucous secretions (Fig. 1M), but the lamina propria was still vacuolated and contained many inflammatory cells with irregular dark nuclei (Fig. 1N). The crypts of Lieberkuhn regained their normal shape and had a wide lumen, and there was an increase in the number

of secretory granules in the Paneth cells. At day 28 pi, the ultrastructure of the G5 group was further improved. In fact, the cellular ultrastructure was completely normal in the G5 group at day 28, and the acute symptoms of infection had disappeared (Fig. 2K– O). Specifically, there was regeneration of the epithelial cells, the presence of well-developed Golgi apparatus elements, a normal distribution of mitochondria, and many lysosomes in the cytoplasm. Microvilli were of normal shape and length, and the lamina propria and crypts of Lieberkuhn were normal in structure. At days 14 and 28 pi, the ileal ultrastructure of the control group (G3) mice given distilled water and the mice treated with

488

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

Fig. 2. (continued)

the pomegranate peel suspension but not inoculated (G4) was normal except for limited swelling in the lamina propria of the G4 group (data not shown). 3.2. Examination of C. parvum stages by transmission electron microscopy Fig. 3 illustrates that the different stages of C. parvum were observed. The parasite appears stuck to the brush border of the ileum

in all the infected groups. In group G2, type 2 meronts developed inside the cell but outside the cytoplasm (intracellular but extracytoplasmic) and were surrounded by a paracytophorous vacuole membrane that contained four sporozoites (Fig. 3A). The feeder organelle was observed at the zone where the parasite sticks to the cell. The early merozoite phase in which the parasite penetrates the host cell was observed and was notable for the presence of hillocks emerging from the two sides of the parasite that were directed at the upper surface of the epithelial cell (Fig. 3B). Be-

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

489

Fig. 3. Photomicrographs of C. parvum stages in transverse sections of ileums of infected/untreated mice (Group G2). A: Type 2 meront that is intracellular but extracytoplasmic and surrounded by the paracytophorous vacuole membrane. The feeder organelle is located at the attachment surface between the parasite and the brush border. B: Developing trophozoite with a large nucleus that has penetrated the host cell and has lateral processes that extend towards the upper surface of the epithelial cell. C: A well-developed merozoite surrounded by the remaining schizont envelope. The apical complex is very distinct at the end of the parasite. D: Trophozoite as long as the microvilli and located between them. E: Early stage type 1 meront that contains a merozoite bud and a residual body. F: Well-developed, type 1 meront, with eight merozoites. G: Different stages of C. parvum among the microvilli (arrow heads). H: Immature microgamont, with marginal nuclei. I: Mature microgamont, containing microgametes. J: Macrogamont, with distinct wall-forming bodies in the cytoplasm. K: Thin-walled oocyst, which contains an inner membrane that surrounds sporozoites. L: Thick-walled oocysts, free and between MV. Magnification: A, C, E, F, H, I, J, and K: 28,000; B: 4,000; D: 54,000; G and L: 80,000. Abbreviations: parasitophoric envelope (PI), feeding organelle (FO), microvilli (MV), sporozoite (SP), nucleus (NU), nucleolus (NO), apical complex (AC), mitochondria (M), parasitophoric vacuole (PV), electrondense collar (EDC), merozoite (ME), merozoite bud (MB), residual body (RB), microgamete (MI), polysaccharide granules(PGs), wall-forming bodies (WFs), lipid body (LP), oocyst wall (OW), outer wall layer (OO), and inner wall layer (IO).

tween microvilli, fully-developed merozoites were observed surrounded by the remaining envelope of the chizont (Fig. 3C). Each merozoite had an apical complex at one of its ends. The trophozoite stage of C. parvum was observed intracellular but extracytoplasmic, and trophozoites were approximately the same length as the microvilli (Fig. 3D) and contained a well-developed electron-dense collar on both sides of their feeder organelles at the attachment area between the parasite and epithelial cell. Also, an early stage of type 1 meronts was observed (Fig. 3E), and this stage contained merozoite buds and the remnants of the residual body. Mature

stage C. parvum meronts (Fig. 3F) contained eight merozoites surrounded by the paracytophorous vacuole membrane. The immature microgamonts (Fig. 3H) contained small, numerous, and compact nuclei that were arranged at the peripheral membrane and near centrally-located residual bodies. Mature microgamont were distinguished by portions of six microgametes that had separated from the residual body (Fig. 3I). The macrogamonts (Fig. 3J) were oval with distinctive large nuclei, lipid bodies, polysaccharide granules, and wall-forming bodies in the cytoplasm that were next to the residual bodies. The thin-walled oocysts of C. parvum were

490

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

Fig. 3. (continued)

freely distributed among microvilli (Fig. 3K), and their oval-shaped cysts were distinguishable by their doubled-walled inner membranes that surrounded the sporozoites. The outer layer of the wall was a paracytophorous vacuole membrane and the electron-dense collar was well-developed on both sides of the feeder organelle, which was located at the attachment border with the host cell. Thick-walled oocysts were freely distributed among the microvilli, were oval to ball-shaped, and were surrounded by thick, double, oocyst walls (Fig. 3L). The electron microscopic examination of the ileums of mice that received the pomegranate peel suspension demonstrated that the treatment had an impact on the inner structure of the parasite and led to defects in the cytoplasm of the parasite (Fig. 4A–F). At day 14 pi, decomposition of the cytoplasm, degeneration of the nuclear membrane, and dilation of the feeder organelle were observed in a trophozoite (Fig. 4A). Deformation of the paracytophorous vacuole membrane and a completely degenerated nucleus were observed in another trophozoite (Fig. 4B). A

merozoite showed decomposition of the cytoplasm in the shape of a slit passing through the cytoplasm and the nucleus and dilation of the feeding organelle (Fig. 4C). On the 28th day pi, the decomposition in a trophozoite was more severe. In fact, the decomposition was to the extent that the stages of Cryptosporidium were distorted to the point that there was ambiguity in the features and contents of each stage, with an agglomeration of features from different stages being present in the same parasite. This made it difficult to identify the stage a parasite was in (Fig. 4D–F). One parasite did not have a feeder organelle even though it had developed between microvilli (Fig. 4F). There was no evidence of the presence of any of the sexual stages in the ileums of the G5 mice.

4. Discussion Few studies have used TEM to observe the histopathological changes in intestinal epithelial cells after C. parvum infection or

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

491

Fig. 4. Photomicrographs of C. parvum stages in ileal transverse sections of infected/P. granatum-treated mice (Group G5). A: Trophozoite with degenerated cytoplasm (arrow head) and decomposition of the feeder organelle (FO). B: Degenerated nucleus and cytoplasm and malformation of the FO and paracytophorous vacuole membrane (PI). C: Severe ‘‘slit’’ in the cytoplasm that passes through the nucleus of the trophozoite. D and E: Complete malformation of a stage of C. parvum to the degree that the stage cannot be identified. F: A parasite between microvilli (MV) that lacks internal features and has a degenerated PI. Magnification: A: 20,000; B, C and F: 40,000; D: 54,000; E: 28,000.

tested if and how therapeutic materials mitigate these changes. In the current study, sections of mouse ileal tissue were examined by TEM for both the pathological cellular changes in villous tissue caused by the infection and the alteration of these changes by pomegranate peel treatment. TEM examination illustrated the extent of the damage the infection inflicted on the ileums of the infected group (G2), with infection causing the degeneration of enterocyte and the loss of microvilli and the normal architecture. This damage was most likely caused by the Cryptosporidium trophozoite and the substantial infiltration of lymphocytes. Other researchers have recorded similar results (Tzipori, 1983; Heine et al., 1984). The hemorrhage and the lymphocytic infiltration in the lamina propria may be attributed to the C. parvum infection of the gut inducing T-cell migration into the lamina propria. This also activates lymphocytes and macrophages to eliminate the par-

asite (Waters and Harp, 1996). Most of the epithelial cells had pyknotic nuclei, and their separation from the lamina propria was observed. The lamina propria was observed to have some edema, which can be explained by the infection causing cellular atrophy and fluffing. This along with inflammation in the mucosa can lead to a decrease in the absorption of fluids and water and electrolyte imbalances in the intestines (Blikslager et al., 2001; Zadrozny et al., 2006). Bertini et al. (1998) observed similar pathological changes in the intestinal epithelium of children afflicted with inflammatory bowel disease (IBD), including some expansion of the endoplasmic net, short microvilli, and the appearance of lysosomes. Interestingly, it is believed by some that infection by C. parvum causes IBD (Waters et al., 2000). The examination by TEM showed that the infection disrupted intracellular links and caused the widening of the spaces between cells. This damage explains how C. parvum

492

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

infection affects cell and intestinal permeability and the transfer of ions. The infection also affects the absorption of water and sodium chloride and can lead to diarrhea (Jody et al., 2004; Warren et al., 2008). The histological findings of the ileums of the mice in the infected/treated group (G5) were noticeably better than those of the infection only group (G2) at both 14 and 28 days pi. It was observed that the villi had returned to regular shape and recovered their brush border and that the cells had increased amounts of cytoplasm and had nuclei with normal-looking chromatin. While the mitochondria were concentrated under the nucleus at day 14 pi in the G5 group, there was normal mitochondrial distribution in the cytoplasm at day 28 pi in this group. This improvement can be explained by a decrease in the number of the trophozoites, the recovery of the brush border to regular form (even in places where the parasite was still present), and the increase in Paneth cells and their secretory granules. Paneth cells are thought to increase the defensive level of the intestinal mucous because they play a role in the production of antibodies against microbes (Kaiser and Diamond, 2000; Bourlioux et al., 2003). This is interesting because pomegranate peel is known to support immunity (Ross et al., 2001; Abdel-Aziz et al., 2006). The clear improvement observed in this histological study after the administration of the pomegranate peel suspension may be due to the suspension inducing severe deformation in the different stages of the parasite, including causing the absence of the feeder organelle. Without this organelle, the parasites are unable to feed, which could leads to tears in the paracytophorous vacuole membrane and probably the death of the parasite. This in turn would lead to the lack of sexual stage parasites. Indeed, no sexual stage parasites were observed in the ileums of infected mice that received the pomegranate peel suspension. The effectiveness of the aqueous suspension of pomegranate peel in treating cryptosporidiosis is likely caused by phenol compounds such as organic acids (Choi et al., 2009; Gasemian et al., 2006), that have an attenuating effect on the growth of enteropathogenic microbes (Anderson et al., 1992; Hsiao and Siebert, 1999; Nakai and Siebert, 2003). Specifically, organic acids have inhibitive effects on C. parvum infections (Watarai et al., 2008). This is supported by the fact that the hydroxyl group in the phenol compounds increases the toxicity of the compounds to microbes (Cowan, 1999). The tannins that exist in pomegranate peel also have a strong impact on microbes (which in fact exceeds the impact of alkaloids) (Segura et al., 1990). The organic acids in pomegranate peel are known to impair the development of the stages of Cryptosporidium (Watarai et al., 2008). The antiparasitic effects of pomegranate peel may also be in part due to the treatment inducing the organization of the necessary cellular functions of a host cell and the cell’s subsequent resistance to infection (Belal et al., 2009). Further, the extract also has anti-inflammatory properties and is known to have greater effects than other anti-inflammatory treatments because it contains more effective and less toxic elements, including flavonoids (Borrelli and Izzo, 2000). Together, these reports seem to indicate that the extract has differential effects on protozoa and mammalian cells. This is in agreement with a report that indicated the antioxidants in the extract affected mammalian cells and protozoa differently (Izumi et al., 2008). Our findings are in accordance with previous studies that demonstrated the effectiveness of pomegranate peel as an antiprotozoal agent. Dell’Agli et al. (2009) reported the effectiveness of an alcoholic extract of pomegranate peel against Plasmodium berghei. Pomegranate peel has also shown to be effective against other parasitic protozoa (Calzada et al., 2006; Amaral et al., 2006; El-Sherbini et al., 2009).The current study also demonstrates the safety of this treatment as the tissues and cells of the intestinal epithelium of the suspension-treated but not infected animals (group

G4) appeared as healthy as those of the control group G1. This is in agreement with the findings of Jurenka and ASCPMT (2008) and Toklu et al. (2009). Further, others have reported that pomegranate is safe even when used at high doses for long periods of time (Cerda et al., 2003; Vidal et al., 2003). C. parvum is considered a unique parasite due to its unusual parasitological niche (based on the place where it develops). Specifically, the front end of a free sporozoite hangs to the surface of an epithelial cell and is thus intracellular but extracytoplasmic. This can be clearly observed in the TEM sections. The process of a sporozoite contacting the epithelial cell and intruding into the cellular envelope is the fatal step of a C. parvum infection. CastroHermida et al. (2008) believe that galactose-N-acetyl-galactosamine, a glycoprotein, on both the upper surface of the epithelium and the sporozoite surface is responsible for this contact and intrusion. In any event, many researchers have speculated that this unique niche of being an intracellular but extracytoplasmic parasite is why C. parvum is so hard to treat. In fact, it is thought that this is why most chemotherapeutic agents are ineffective against this parasite as the location of the parasite prevents it from being exposed to therapeutic agents (Fayer, 1997; Tzipori and Griffiths, 1998; Armson et al., 2003). The stages of C. parvum were monitored and described in the infected group (G2) at 14 and 28 days pi. All of the thick wall oocysts, thin wall oocysts, sporozoites, type 1 meronts, type 2 meronts, trophozoites, microgamonte, and macrogamonte were recorded and described. This description of these stages is in agreement with earlier descriptions (Current and Reese, 1986; Yang et al., 1996; Fayer, 1997; Rosales et al., 1998; Tzipori, 2002; Borowski et al., 2010). For the first time, two hillocks on the C. parvum wall were observed as the parasite approached the upper surface of an epithelial cell. We think that these structures link with special receivers on the upper surface of the host cells. This is supported by Fayer’s Theory (Fayer, 1997), which states that special receivers likely contribute to the linkage that occurs between a parasite and its host cell. The damage caused by the pomegranate peel suspension treatment on the different C. parvum stages was monitored. We observed decomposition of synthetic distortions in the parasites to the extent that in some cases the parasite stage was unidentifiable. A large amount of decomposition of the nutrition organelles was also observed. In some cases, a nutrition organelle was not present in a parasite, even though the parasite had been developing among microvilli 14 days pi. Furthermore, microgamonte and macrogamonte were not observed in the ileal sections of the treated group (G5). In all, this data indicate that the pomegranate peel had a direct impact on the parasite at various stages of its development that eventually resulted in parasite decomposition and death. Further, parasite death went hand in hand with intestinal tissue recovery as the lack of parasites allowed for the intestine to recover. To the best of our knowledge, this study is the first to examine the fine cellular changes of C. parvum after treatment using TEM. The study demonstrated that the pomegranate peel suspension was able to directly impact the different stages of C. parvum and eventually caused the death of the parasite. At the same time, the treatment had a positive impact on the inner structure of the intestinal epithelial cells. In summary, the above demonstrates the effectiveness, efficacy, and safety of an aqueous suspension of pomegranate peel in the treatment of cryptosporidiosis. Acknowledgments The authors thank the King Abdul Aziz City for Science and Technology for supporting this study with grant no. 50-15-AP.

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

References Abdel-Aziz, M.M., Abbas, A.T., Elbakry, K.A., Toson, E.A., El-Sherbiny, M., 2006. Immune response on mice infected with Schistosoma mansoni and treated with myrrh. J. Med. Sci. 6, 858–861. Akhtar, M.S., Riffat, S., 1985. Efficacy of Punica granatum, linn. (ANAR) fruit (rinds) against naturally acquired nematodal and cestodal infections in sheep. J. Pharm. Pb. Univ. Lhr. 6, 17–22. Amaral, F., Ribeiro, M., Barbosa-Filho, J., Reis, A., Nascimento, F., Macedo, R., 2006. Plants and chemical constituents with giardicidal activity. Braz. J. Pharmacogn. 16, 696–720. Al-Mathal, E.M., Alsalem, A.A., 2012. Pomegranate (Punica granatum) peel is effective in a murine model of experimental Cryptosporidium parvum. Exp. Parasitol. 131, 350–357. Anderson, M.E., 1992. Efficacies of acetic, lactic and two mixed acids in reducing numbers of bacteria on surfaces of lean meat. J. Food Saf. 12, 139–147. Armson, A., Meloni, B.P., Reynoldson, J.A., Thompson, R.C., 1999. Assessment of drugs against Cryptosporidium parvum using a simple in vitro screening method. FEMS Microbiol. Lett. 178, 227–233. Armson, A., Thompson, R.C.A., Reynoldson, J.A., 2003. A review of chemotherapeutic approaches to the treatment of Cryptosporidiosis. Expert Rev. Anti Infect. Ther. 2, 297–305. Belal, S.K.M., Abdel-Rahman, A.H., Mohamed, D.S., Osman, H.E.H., Hassan, N.A., 2009. Protective effect of Pomegranate fruit juice against Aeromonas hydrophilainduced intestinal histopathological changes in mice. World Appl. Sci. J. 7, 245– 254. Bertini, M., Sbabati, A., Danielle, C.D., Schmitz, J., 1998. Scanning electron microscopy in childhood inflammatory bowel diseas. Scanning Microsc. 12, 495–502. Blikslager, A., Hunt, E., Guerrant, R., Rhoads, M., Argenzio, R., 2001. Glutamine transporter in crypts compensates for loss of villus absorption in bovine cryptosporidiosis. Am. J. Physiol. Gastrointest. Liver Physiol. 281, 645–653. Borowski, H., Thompson, R.C., Armstrong, T., Clode, P.L., 2010. Morphological characterization of Cryptosporidium parvum life-cycle stages in an vitro model system. Parasitol. J. 137, 13–26. Borrelli, F., Izzo, A.A., 2000. The plant kingdom as a source of anti-ulcer remedies. Phytother. Res. Dec. 14, 581–591. Bourlioux, P., Koletzko, B., Guarner, F., Braesco, V., 2003. The intestine and its microflora are partners for the protection of the host: report on the Danone Symposium ‘‘The Intelligent Intestine’’, held in Paris, June 14, 2002. Am. J. Clin. Nutr. 78, 675–683. Braga, L.C., Shupp, J.W., Cumings, C., Jett, M., Takahashi, J.A., Carmo, I., ChartoneSouza, E., Nascimento, A.M., 2005. Pomegranate extract inhibits Staphylococcus aureus growth and subsequent enterotoxin production. J. Ethnopharmacol. 96, 335–339. Caceres, A., Giron, L.M., Alverado, S.R., Torres, M.F., 1987. Screening of antimicrobial activity of plants popularly used in Guatemala for treatment of dermatomucosal diseases. J. Ethnopharmacol. 20, 223–237. Castro-Hermida, J.A., Ares-Mazás, M.E., 2003. In vitro and in vivo efficacy of alphacyclodextrin for treatment of experimental cryptosporidiosis. Vet. Parasitol. 114, 237–245. Castro-Hermida, J.A., Pors, I., Otero-Espinar, F., Luzardo-Alvarez, A., Ares-Mazás, E., Chartier, C., 2004. Efficacy of alpha-cyclodextrin against experimental cryptosporidiosis in neonatal goats. Vet. Parasitol. 120, 35–41. Castro-Hermida, J., GarcÍa-Presedo, I., González-Warleta, M., Mezo, M., Fenoy, S., ˘ guila, C., 2008. Activity of an anti-inflammatory drug against Rueda, C., A Cryptosporidium in neonatal lambs. Vet. Parasitol. 155, 308–313. Calzada, F., Yepez-Mulia, L., Aguilar, A., 2006. In vitro susceptibility of Entamoeba histolytica and Giardia lamblia to plants used in Mexican traditional medicine for the treatment of gastrointestinal disorders. J. Ethnopharmacol. 108, 367– 370. Cerda, B., Liorach, R., Ceron, J., Espin, J.C., Tomas-Barberm, F.A., 2003. Evaluation of the bioavailability and metabolism in the rat of punicala an antioxidant polyphenol from pomegranate juice. Eur. J. Nutr. 42 (1), 18–28. Choi, J., Kang, O., Lee, Y., Chae, H., Oh, C., Brice, O., Kim, M., Sohn, D., Kim, H., Park, H., Shin, D., Rho, J., Kwon, D., 2009. In Vitro and in vivo antibacterial activity of Punica granatum peel ethanol extract against Salmonella.. Evid. Based Complement. Altern. Med. 2011, 12–25 [article ID 690518]. Cowan, M.M., 1999. Plant products as antimicrobial agents. Clin. Microbiol. Rev. 12, 564–582. Current, W.L., Reese, N.C., 1986. A comparison of endogenous development of three isolates of Cryptosporidium in suckling mice. J. Protozool. 33, 98–108. Del Coco, V.F., Córdoba, M.A., Basualdo, J.A., 2009. Cryptosporidiosis: an emerging zoonosis. Rev. Argent. Microbiol. 41, 185–196. Dell’Agli, M., Galli, G., Corbett, Y., Taramelli, D., Lucantoni, L., Habluetzel, A., Maschi, O., Caruso, D., Giavarini, F., Romeo, S., Bhattacharya, D., Bosisio, E., 2009. Antiplasmodial activity of Punica granatum L. fruit rind. J. Ethnopharmacol. 125, 279–285. De Waele, V., Speybroeck, N., Berkvens, D., Mulcahy, G., Murphy, T.M., 2010. Control of cryptosporidiosis in neonatal calves: use of halofuginone lactate in two different calf rearing systems. Prev. Vet. Med. 96, 143–151. El-Sherbini, G.T., El Gozamy, B.R., Abdel-Hady, N.M., Morsy, T.A., 2009. Efficacy of two plant extracts against vaginal trichomoniasis. J. Egypt. Soc. Parasitol. 39, 47–58.

493

Fayer, R., Ungar, B.L.P., 1986. Cryptosporidium spp. and cryptosporidiosis. Microbiol. Rev. 50, 458–483. Fayer, R., 1997. Cryoptosporidium and Cryoptosporidiosis. CRC Press LLC, Boca Raton, Florida. Fernandes, R.M., Rodrigues, M.L.A., Borba, H.R., Fernandes, M.Z.C.M., de Amorim, A., 2004. Ausência da atividade anti-helmíntica de plantas em frangos de corte naturalmente infectados com Heterakis gallinarum (Schranck, 1788) Madsen, 1949. Ciencia Rural 34, 1629–1682. Gasemian, A., Mehrabian, S., Majd, A., 2006. Pell Extracts of two Iranian cultivars of Pomegranate (Punica granatum) have antioxidant and antimutagenic activities. Pak. J. Bio. Sci. 9 (7), 1402–1405. Guitard, J., Menotti, J., Desveaux, A., Alimardani, P., Porcher, R., Derouin, F., Kapel, N., 2006. Experimental study of the effects of probiotics on Cryptosporidium parvum infection in neonatal rats. Parasitol. Res. 99, 522–527. Heelan, J.S., Ingersoll, F.W., 2002. Essentials of Human Parasitology. Delmar Thomson, Albany, New York. Heine, J., Pohlenz, J.F.L., Moon, H.W., Woode, G.N., 1984. Enteric lesions and diarrhea in gnotobiotic calves monoinfected with Cryptosporidium species. J. Infect. Dis. 150, 768–775. Henriksen, S.A., Pohlenz, J.F.L., 1981. Staining of cryptosporidia by a modified ZiehlNeelsen technique. Acta Vet. Scand. 22, 594–596. Hsiao, C.P., Siebert, K.J., 1999. Modeling the inhibitory effects of organic acids on bacteria. Inter. J. Food Microbiol. 47, 189–201. Izumi, E., Morello, L.G., Ueda-Nakamura, T., Yamada-Ogatta, S.F., Filho, B.P., Cortez, D.A., Ferreira, I.C., Morgado-Diaz, J.A., Nakamura, C.V., 2008. Trypanosoma cruzi: antiprotozoal activity of parthenolide obtained from Tanacetum parthenium (L.) Schultz Bip. (Asteraceae, Compositae) against epimastigote and amastigote forms. Exp. Parasitol. 118, 324–330. Gookin, Jody L., Chiang, S., Allen, J., Armstrong, M.U., Stauffer, Stephen H., Finnegan, C., Murtaugh, Michael P., 2004. NF-kB-mediated expression of iNOS promotes epithelial defense against infection by Cryptosporidium parvum in neonatal piglets. Am. J. Physiol. Gastrointest. Liver Physiol. 287, 571–581. Jurenka, J., ASCPMT, 2008. Therapeutic applications of pomegranate (Punica granatum L.): a review. Altern. Med. Rev. 13, 128–144. Kaiser, V., Diamond, G., 2000. Expression of mammalian defensin genes. J. Leukoc. Biol. 68, 779–784. Kayser, O., Waters, W.R., Woods, K.M., Upton, S.J., Keithly, J.S., Laatsch, H., Kiderlen, A.F., 2002. Evaluation of in vitro and in vivo activity of benzindazole-4,9quinones against Cryptosporidium parvum. J. Antimicrob. Chemother. 50, 975– 980. Korayem, A.M., Hasabo, S.A., Ameen, H.H., 1993. Effects and mode of action of some plant extracts on certain plant parasitic nematodes. Anzeiger Fur Schadllingskunde 66, 32–36. Laurent, F., McCole, D., Eckmann, L., Kagnoff, M.F., 1999. Pathogenesis of Cryptosporidium parvum infection. Microbes Infect. 1, 141–148. Nagvi, S.A., Khan, M.S., Vohora, S.B., 1991. Antibacterial, antifungal, and antihelminthic investigations on Indian medicinal plants. Fitoterpia. 62, 221– 228. Nakai, S.A., Siebert, K.J., 2003. Validation of bacterial growthinhibition models based on molecular properties of organic acids. Int. J. Food Microbiol. 86, 248–255. Naz, S., Siddiqi, R., Ahmad, S., Rasool, S.A., Sayeed, S.A., 2007. Antibacterial activity directed isolation of compounds from Punica granatum. J. Food Sci. 72, 341–345. Pradhan, K.D., Thakur, D.K., Sudhan, N.A., 1992. Therapeutic efficacy of Punica granatum and Cucurbita maxima against clinical cases of nematodiasis in calves. Indian J. Indigenous Med. 9, 53–55. Prakash, V., Singhal, K.C., Gupta, R.R., 1980. Anthelminthic activity of Punica granatum and Artemisia siversiana. Indian J. Pharmacol. 12, 61A–80A. Rosales, M.J., Arnedo, T., Mascaró, C., 1998. Ultrastructural details of Cryptosporidium parvum development in calf intestine. Mem. Inst. Oswaldo Cruz. 93, 847–850. Ross, G.R., Selvasubramanian, S., Jayasundar, S., 2001. Immunomodulatory activity of Punica granatum in rabbits-a preliminary study. J. Ethnopharmacol. 78, 85– 87. Schnyder, M., Kohler, L., Hemphill, A., Deplazes, P., 2009. Prophylactic and therapeutic efficacy of nitazoxanide against Cryptosporidium parvum in experimentally challenged neonatal calves. Vet. Parasitol. 160, 149–154. Segura, J.J., Morales-Ramos, L.H., Verde-Star, J., Guerra, D., 1990. Growth inhibition of Entamoeba histolytica and E. invadens produced by pomegranate root (Punica granatum L). Arch. Invest. Med. (Mex.) 21, 235–239. Sherwood, D., Angus, K.W., Snodgrass, D.R., Tzipori, S., 1982. Experimental cryptosporidiosis in laboratory mice. Infect. Immun. 38, 471–475. Silverlas, C., Bjorkman, C., Egenvall, A., 2009. Systematic review and meta-analyses of the effects of halofuginone against calf cryptosporidiosis. Prev. Vet. Med. 91, 73–84. Smith, H.V., Corcoran, G.D., 2004. New drugs and treatment for cryptosporidiosis. Curr. Opin. Infect. Dis. 17, 557–564. Sudheesh, S., Vijayalakshmi, N.R., 2005. Flavonoides from Punica granatumpotential antiperoxidative agents. Fitoterapia 76, 181–186. Theodos, C.M., Griffiths, J.K., Donfro, J., Fairfield, A., Tzipori, S., 1998. Efficacy of nitazoxanide against Cryptosporidium parvum in cell culture and in animal models. Antimicrob. Agents Chemother. 42, 1959–1996. Toklu, H., Serhirli, Ö., Özyurt, H., Mayadagli, A.A., Eksioglu-Demiralp, E., Cetinel, S., Sahin, H., Yegen, B., Ulusoyludumlu, M., Gökmen, V., Sener, G., 2009. Punica granatum peel extract protects against ionizing radiation-induced enteritis and leukocyte apoptosis in rats. J. Radiat. Res. 50, 345–353.

494

E.M. Al-Mathal, A.A. Alsalem / Experimental Parasitology 134 (2013) 482–494

Tzipori, S., 1983. Cryptosporidiosis in animals and humans. Microbiol. Rev. 47, 84– 96. Tzipori, S., 2002. Introduction. cryptosporidiosis: current trends and challenges. Microbes Infect. 4, 1045. Tzipori, S., Griffiths, J.K., 1998. Natural history and biology of Cryptosporidium parvum. Adv. Parasitol. 40, 5–36. Vidal, A., Fallarero, A., Pena, B.R., Medina, M.E., Gra, B., Rivera, F., Gutierrez, Y., Vuorela, P.M., 2003. Studies on the toxicity of Punica granatum L. (Punicaceae) whole fruit extract. J. Ethnopharmacol. 89, 295–300. Viu, M., Quílez, J., Sánchez-Acedo, C., del Cacho, E., López-Bernad, F., 2000. Field trial on the therapeutic efficacy of paromomycin on natural Cryptosporidium parvum infections in lambs. Vet. Parasitol. 90, 163–170. Warren, C., Destura, R., Sevilleja, J., Barroso, L., Carvalho, H., Barrett, L., O’Brien, A., Guerrant, R., 2008. Detection of epithelial cell injury and quantification of infection in the HCT8 Organoid Model of Cryptosporidiosis. J. Infect. Dis. 198, 143–149. Watarai, S., Tana, T., Koiwa, M., 2008. Feeding activated charcoal from bark containing wood vinegar liquid (nekka-rich) is effective as treatment for cryptosporidiosis in calves. J. Dairy Sci. 91, 1458–1463.

Waters, W.R., Harp, J.A., 1996. Cryptosporidium parvum infection in T-cell receptor (TCR)-alpha- and TCR-delta-deficient mice. Infect. Immun. 64, 1854–1857. Waters, W.R., Frydman, B., Marton, L.J., Valasinas, A., Reddy, V.K., Harp, J.A., Wannemuehler, M.J., Yarlett, N., 2000. [(1)N, (12)N]Bis(Ethyl)-cis-6,7dehydrospermine: a new drug for treatment and prevention of Cryptosporidium parvum infection of mice deficient in T-cell receptor alpha. Antimicrob. Agents Chemother. 44, 2891–2894. Wu, Z., Nagano, I., Matsuo, A., Uga, S., Kimata, I., Iseki, M., Takahashi, Y., 2000. Specific PCR primers for Cryptosporidium parvum with extra high sensitivity. Mol. Cell. Prob. 14, 33–39. Yang, S., Healey, M.C., Du, C., Zhang, J., 1996. Complete development of Cryptosporidium parvum in bovine fallopian tube epithelial cells. Infect. Immun. 64, 349–354. Zadrozny, L.M., Stauffer, S.H., Armstrong, M.U., Jones, S.L., Gookin, J.L., 2006. Neutrophils do not mediate the pathophysiological sequelae of Cryptosporidium parvum infection in neonatal piglets. Infect. Immun. 74, 5497–5505.