Pomegranate (Punica granatum) peel is effective in a murine model of experimental Cryptosporidium parvum

Experimental Parasitology 131 (2012) 350–357

Contents lists available at SciVerse ScienceDirect

Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr

Pomegranate (Punica granatum) peel is effective in a murine model of experimental Cryptosporidium parvum Ebtisam M. Al-Mathal ⇑, Afaf M. Alsalem Department of Biology, College of Science, University of Dammam, Dammam 31311, Saudi Arabia

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

" Cryptosporidium parvum-infected

Illium from Cryptosporidium parvum-infected mice (D) and Illium from Punica granatum-treated, C. parvum-infected mice (G). The villi from untreated/infected mice were asymmetrical and showed signs of atrophy and hyperplasia. The villi from infected/P. granatum-treated mice showed improved architectural symmetry and decreased atrophy and hyperplasia.

mice showed weight loss, intestinal morbidity, and mortality. " Mice treated with Punica granatum rapidly recovered from cryptosporidiosis. " P. granatum treatments resulted in no adverse side effects. " P. granatum is a promising efficient and safe treatment for cryptosporidiosis.

a r t i c l e

i n f o

Article history: Received 24 April 2011 Received in revised form 12 April 2012 Accepted 30 April 2012 Available online 9 May 2012 Keywords: Cryptosporidium parvum Punica granatum Oocyst shedding Histopathological study

a b s t r a c t Cryptosporidiosis, a major health issue for neonatal calves, is caused by the parasite Cryptosporidium parvum, which is highly resistant to drug treatments. To date, many anti-parasitic drugs have been tested, but only a few have been shown to be partially effective in treating cryptosporidiosis. Previous studies have indicated that pomegranate (Punica granatum) possesses anti-plasmodium, anti-cestode, and antinematode activities. Therefore, the aim of this study was to evaluate the effect of P. granatum peel on suckling mice infected with experimental C. parvum. At 4 days of age, 72 neonatal albino mice were randomly divided into five groups: G1: healthy controls, G2: infected/untreated controls, G3: uninfected/distilled water-treated, G4: uninfected/P. granatum peel-treated, and G5: infected/P. granatum peel-treated. Mice were experimentally-infected by oral administration of 1  103 C. parvum oocysts per animal. On day 7 post-inoculation (pi), treated mice received an aqueous suspension of P. granatum peel orally (3 g/kg body weight). The presence of diarrhea, oocyst shedding, and weight gain/loss, and the histopathology of ileal sections were examined. Infected mice treated with the P. granatum peel suspension showed improvement in all parameters examined. Additionally, these mice did not exhibit any clinical symptoms and no deaths occurred. Oocyst shedding was very significantly reduced in the P. granatumtreated mice by day 14 pi (P < .05), and was completely eliminated by day 28 pi. The mean weight gain of the P. granatum-treated mice was significantly higher than that of the infected/untreated controls throughout the study (P < .01). Histopathological analysis of ileal sections further supported the clinical and parasitological findings. The histological architecture of villi from the P. granatum-treated mice on

Abbreviations: pi, post-innoculation; opg, oocyst per 0.01 gram feces.

⇑ Corresponding author. Address: Department of Biology, College of Science, University of Dammam, P.O. Box 10185, Dammam 31311, Saudi Arabia. Fax: +966 38469854. E-mail address: [email protected] (E.M. Al-Mathal). 0014-4894/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.exppara.2012.04.021

E.M. Al-Mathal, A.M. Alsalem / Experimental Parasitology 131 (2012) 350–357

351

day 14 pi showed visible improvement in comparison with the infected/untreated controls, including renewed brush borders, reduced numbers of C. parvum trophozoites, and reduced lymphatic infiltration. On day 28 pi, tissues of the P. granatum-treated mice were very similar to those of healthy control mice. These results suggest that P. granatum peel is a promising anti-coccidial therapeutic treatment that lacks negative side effects. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction Cryptosporidiosis is a common disease among neonatal calves caused by the protozoan parasite Cryptosporidium parvum. Infection by this parasite is one of the most serious health risks for young calves, especially those less than 4 weeks of age. Cryptosporidiosis causes diarrhea and weight loss, and can result in death (Klein, 2008). C. parvum is highly-resistant to current drug treatments (Armson et al., 2003). Though the pharmaceutical industry has made several attempts to develop an effective treatment for cryptosporidiosis, this disease still constitutes a major health problem for the livestock industry, calling for the development of a safe and effective treatment (Del Coco et al., 2009). The United States Food and Drug Administration has approved nitazoxanide, a broad-spectrum anti-parasitic agent that is an effective in vitro drug against cestodes, trematodes, nematodes, and protozoans (Rossignol and Maisonneuve, 1984) in humans. However, nitazoxanide does not show any curative qualities against C. parvum infection in calves (Schnyder et al., 2009). Paromomycin is a conventional treatment for cryptosporidiosis (Kayser et al., 2002). However, upon suspension of treatment, fecal oocysts and diarrhea reappeared in calves in field trial (Grinberg et al., 2002). Ingestion of the drug alone may be ineffective, especially against gall bladder and pancreas infections (Fayer, 1997). Halofuginone lactate is an anticoccidial drug that used in the treatment of cryptosporidiosis (Naciri et al., 1993). It seems to reduce the oocyst shedding and decreases the severity of cryptosporidiosis in calves but provides no complete cure (De Waele et al., 2010; Silverlas et al., 2009). Consequently, the available drugs are considered ineffective for the treatment of cryptosporidiosis in calves (Guitard et al., 2006; Massoud et al., 2008; Smith and Corcoran, 2004; Waters et al., 2000; Silverlas et al., 2009). The resistance of C. parvum to many antimicrobial drugs may be because it is an intracellular, rather than an extra-cytoplasmic, parasite. Considering the side effects of and resistance to many antibacterial drugs, attention has moved towards plant extracts used in traditional medicine as sources for new treatments (Calzada et al., 2006). Punica granatum L. (Punicaceae), commonly known as pomegranate, is an ancient mystical fruit used in folkloric medicine as a treatment for many diseases such as diarrhea, parasitic worm infections, urinary tract infections, and kidney stones (Navarro et al., 1996; Sudheesh and Vijayalakshmi, 2005). Studies indicate that P. granatum can slow bacterial growth and inhibit bacterium-induced toxins (Bialonska et al., 2009; Braga et al., 2005; Choi et al., 2011; Ghosh et al., 2008). Rabbits that received oral doses of aqueous P. granatum peel (100 mg/kg) for 10 consecutive days had stimulated immune systems and enhanced cellular immunity (Gracious et al., 2001). Several additional studies have demonstrated the therapeutic effects of P. granatum fruit, peel, and juice as powerful antioxidants and anti-inflammatory substances that include polyphenols and tannins (Afaq et al., 2005; Aviram et al., 2000; Aviram et al., 2002; Aviram and Dornfeld, 2001; Cerda et al., 2003; Gasemian et al.,2006; Kim et al., 2002; Suzuki et al., 2004). P. granatum also plays a role in protecting against cancer diseases (Syed et al., 2007) and its juice is effective in protecting neuron cells from Alzheimer’s disease (Wang et al., 2009).

Despite the many studies conducted to examine the efficacy of P. granatum in treating many diseases and microbial infections, much remains unknown about its effects on parasitic infections. However, some studies have indicated that P. granatum has anti-cestodial, anti-nematoidal (Akhtar and Riffat, 1985; Fernandes et al., 2004; Korayem et al., 1993; Pradhan et al., 1992; Prakash et al., 1980), and anti-protozoan activities (Calzada et al., 2006; Dell’Agli et al., 2009; El-Sherbini et al., 2009). Additionally, P. granatum has been used in traditional medicine to treat diarrhea and dysentery diseases. Therefore, the present study examined the efficacy of aqueous P. granatum peel as a treatment for C. parvum infections in an experimental murine model of cryptosporidiosis.

2. Materials and methods 2.1. Preparation of oocysts C. parvum oocysts were collected from naturally-infected calves. Oocysts were concentrated according to Heelan and Ingersoll (2002) and identified by modified Zeihl Neelson (Henriksen and Pohlenz, 1981) and enzyme-linked immunosorbent assays (ELISAs) (Cryptosporidium bovine ELISA kit; Cypress Diagnostics, Langdrop, Belgium) as instructed by the manufactures. The identify of purified oocysts was confirmed as C. parvum by standard polymerase chain reaction (PCR) for polythreonine gene using C. parvum specific primers (cry 44: CTCTTAATCCAATCATTACAAC and cry 39: GAGTETAA TAATAA ACC ACTG) according to Wu et al. (2000) (data not shown). Sedimented oocysts were collected and stored in a 2.5% potassium dichromate solution at 4 °C. Prior to experimentation, oocysts were concentrated (Heelan and Ingersoll, 2002) and counted in a PBS solution using a hemocytometer. 2.2. Plant materials P. granatum peels were obtained from fruit purchased from a local market. Samples were authenticated by the Botany Department of the University of Dammam. Peels were cold-dried under ambient conditions, pulverized, and stored at 4 °C. 2.3. Animals Pregnant, white albino mice (Laurent et al., 1999; Sherwood et al., 1982), no more than 3 months old, were obtained from the animal home of the Arabian Gulf University. Mice were tested for infection over 10 consecutive days, and each litter with the mother was housed in separate cages under hygienic conditions. The mothers remained with their nurslings for the nurslings to feed as needed throughout the course of the experiment. Animal fodder (General Organization of Grain Silos and Flour Mills, Saudi Arabia, Dammam) and water were supplied Ad libitum. Temperature and humidity were maintained at 20–21 °C and 30–40%, respectively. All animal protocols were performed in accordance with the protocols of the Faculty of Medicine, King Faisal University.

352

E.M. Al-Mathal, A.M. Alsalem / Experimental Parasitology 131 (2012) 350–357

2.4. Experimental design Nurslings were divided into five groups (G1–G5) of 18 mice each: G1: healthy control (negative control); G2: infected/untreated; G3: uninfected/distilled water-treated; G4: uninfected/P. granatum peel suspension-treated; and G5: infected/P. granatum peel suspension-treated. Mice were numbered and examined to ensure the absence of any infection. Mice in G2 and G5 were infected at the age of 4 days by administration of a dose of 1  103 C. parvum oocysts by a gastric tube.

G1, G3, and G4, the infected mice in the G5 group that received the P. granatum treatments did not display any pathological symptoms. Additionally, no deaths occurred in these groups throughout the duration of the experiment. 3.2. The effect of P. granatum treatment on body weights

Therapeutic doses of P. granatum were administered to the animals in G3, G4, and G5 on day 7 post-inoculation (pi), the day oocysts appeared in the feces. P. granatum doses of 3 g/kg body weight were prepared fresh (3 g/ml P. granatum peel in distilled water) and administered daily by gastric tubes 1 h before meals for 3 consecutive weeks (Akhtar and Riffat, 1985). To determine the potency of the treatments, the animals were given a recovery period of 10 days at the end of the treatment period.

As expected, the results in Table 1 show a significant weight reduction in the infected/untreated G2 animals in comparison with the animals of the healthy control group G1 at day 14 pi (P < .01). The weight differences between these two groups continued to increase through day 38 pi (P < .01). The body weights of animals in the G5 infected/P. granatum-treated group steadily increased throughout the course of the experiment and were significantly higher than those of the G2 group beginning on day 14 pi (P < .01). This trend continued until it reached its greatest difference on day 38 pi. There were no significant differences in the weights of animals in G5 and those in the healthy control group G1 on all days of the treatment. Additionally, there were no significant differences in weights between the uninfected groups G3 and G4 and the negative control group G1.

2.6. Fecal analysis and behavioral observations

3.3. The effect of P. granatum treatment on fecal oocyst levels

Fecal samples were collected directly from the rectum and examined beginning on day 4 pi. Oocyst shedding was scored using a hemocytometer on days 7, 14, 21, and 28 pi. The percent reduction of oocysts was determined based on the number of oocysts per gram of feces before and after treatment. Diarrhea and lack of energy in mice were the main symptoms of the clinical effect of Cryptosporidium infection in mice.

Fecal oocyst shedding was observed on days 7 and 14 pi in both infected groups (G2 and G5, Table 2). However, the number of fecal oocysts continued to increase in the feces of the infected/untreated animals of group G2, while oocyst shedding decreased in group G5 animals as early as day 14 (P < .05). By day 21 pi, fecal oocyst shedding was undetectable in the P. granatum-treated mice while it continued to increase in the untreated G2 mice. Importantly, mice from G5 remained free of oocyst shedding on day 38 pi, 10 days after treatment with P. granatum ceased.

2.5. P. granatum treatments

2.7. Body weight measurements All nursing animals were weighed on days 1, 7, 14, 21, 28, and 38 pi. 2.8. Histopathological analysis Three mice were sacrificed from each group on days 14 and 28 pi, from which small sections of ileum were excised and fixed in 10% formalin. Specimens were dehydrated, cleared, and embedded in paraffin wax from which 3 lm sections were cut on a rotary microtome. Sections were stained with Harris hematoxylin and eosin and photographed with a digital-camera microscope (Eclipse E200-coolpix-4500, Nikon, Tokyo, Japan). 2.9. Statistical analysis Statistical significance was determined using t-tests (Man Whitney), Chi-square tests, and one-way analysis of variance. Data are presented as means ± standard error (SE) using Statistical SPSS for Windows, issue 15.8 with P 6 .05 as significant and P 6 .01 as very significant. 3. Results 3.1. Infection and behavioral observations Fecal oocyst shedding was observed in the infected groups G2 and G5 beginning on day 7 pi. Pathological symptoms were observed with maximum severity on day 21 pi in the infected group G2. The symptoms included a lack of energy, diarrhea, and soiling of the back area with feces. During the experiment 5 of 18 (27.78%) infected/untreated G2 mice died. Similar to the uninfected mice of

3.4. Histopathological analysis As expected, ileum sections of untreated mice infected with C. parvum oocysts (G2) showed dramatic hisotological changes on Table 1 Mean (mean ± SE) body weights (g). Groups Day

Group G1

Group G2

Group G3

Group G4

Group G5

Day 1 7 days pi 14 days pi 21 days pi

2.03 ± .19 4.27 ± .35 6.57 ± .19 8.87 ± .74

1.90 ± .02 3.25 ± .16 4.17 ± .15 5.63 ± .54

2.30 ± .29 4.93 ± .39 6.83 ± .18 9.75 ± .55

2.23 ± .18 4.30 ± .40 7.2 ± .4 10.29 ± .77

2.27 ± .44 4.33 ± .35 6.97 ± .52 9.57 ± 1.49

G1, negative control;G2, infected/untreated;G3, uninfected/distilled water-treated;G4, uninfected/P. granatum peel suspention- treated;G5, infected/P. granatum peel suspention- treated.

Table 2 Mean (mean ± SE) oocyst shedding (oocystsn0.01 g feces). Time

7 days pi 14 days pi 21 days pi 28 days pi

Group G2 (Infected/untreated)

Group G5 (Infected/P. granatum treated)

Mean ± SE

Mean ± SE

% Reductiona

± ± ± ±

235.67 ± 8.25 ± 0.00 ± 0.00 0.00 ± 0.00

– 100 100

G2: infected/untreated. G5: infected/P. granatum peel suspention- treated. a % Reduction = opg before treatment–opg after treatment  100 opg before treatment.

E.M. Al-Mathal, A.M. Alsalem / Experimental Parasitology 131 (2012) 350–357

days 14 and 28 pi (Figs. 1 and 2). As compared to healthy G1 mice (Fig. 1A–C), ileum sections from the infected/untreated group G2 at day 14 pi (Fig. 1D–F) showed classical cryptosporidiosis-associated pathological changes in villi architecture, including a shortage of villi, hyperplasia, and villi degeneration and atrophy. Epithelial cells at the tips of the microvilli were denuded. Bleeding as a result of dilated blood vessels and capillaries and lymphocytic infiltration in the lamina propria was present. Additionally, the lamina propria was exposed in some of the microvilli and the muscularis layer was thinner (Fig. 1D). Separation from the lamina propria and edema were also observed by day 14 pi in the infected G2 mice. C. parvum trophozoites were present on the brush border (Fig. 1E). Severe edema was also noted in the crypts of Lieberkühn with lymphocytic infiltration. Damage of the connective tissues between the muscularis was observed (Fig. 1F). By day 28 pi (Fig. 2D–F) the pathological changes induced by C. parvum infection were even greater in the untreated G2 mice. Specifically, there was increased degeneration and atrophy of the villi, tearing of the villi tips, and development of several vacuoles in the columnar epithelium

353

(Fig. 2D). Additional pathology included severe degeneration of the brush border, increased C. parvum trophozoites suspended on the exterior edge of the villi, and decreased numbers of villi goblet cells and Paneth cells (Fig. 2E). Infected ileum sections also displayed dilation and degeneration of the submucosa and vacuolation of the outer longitudinal muscle (Fig. 2F). The histopathological changes in the ileal villi of mice that were infected with C. parvum oocysts and treated with P. granatum (G5) were less dramatic on day 14 pi (Fig. 1G–I) as compared to that of the G2 mice (Fig. 1D–F). The histological architecture of the villi showed improved villi symmetry, lengthened villi, improvement in the cellular structure of the absorptive cells, reduced bleeding, and sustained lymphocytic infiltration in the lamina propria as compared to G2. Improved muscularis health was indicated by retained cohesion and increased thickness (Fig. 1G). As compared to the ileum of infected/untreated G2 mice, the ileum of G5 mice had renewed brush borders, reduced cell degeneration and pyknotic nuclei, reduced numbers of C. parvum trophozoites, and decreased lymphatic infiltration (Fig. 1H). Furthermore, restoration of the

Fig. 1. Photomicrographs of traverse sections of ileum from healthy control mice G1 (A–C), infected/untreated mice G2 (D–F), and infected/P. granatum-treated mice G5 (G–I) on day 14 pi. Mucosa (M), villi (V), crypts of Lieberkühn (CL), submucosa (SM), inner circle muscle (IC), outer longitudinal muscle (OL), serosa (S), columnar epithelium absorptive cells (AC), goblet cells (GC), brush border (BB), lamina propria (LP), Paneth cells (PC), D- Changes in the symmetrical architecture of villi with atrophy and hyperplasia in all villi (red arrow). Tearing is visible at the villi tips (black arrow). Bleeding is present (arrow heads), lymphocytic infiltration into the lamina propria (red arrow). E–A section of the villi shows degeneration of most of the columnar epithelium (arrow) and pyknotic nuclei (red arrow). C. parvum trophozoites (CT) are attached to the external tip of the columnar epithelium (arrow head) and the BB is lacking. F- Sever edema with vaculation (head of the arrows) in the connective tissues of the SM. Some lymphocytic infiltration can also be seen (arrow) in the CL. H- Improvement and reduced degeneration in the AC, restoration of the BB (arrow), and limited C. parvum trophozoites (arrow head). I- Cell renewal in the CL and PCs (head arrow). Restoration of the architecture of the SM. Original magnifications: A, D, and G: 600; B, E, and H: 3000; C and I: 1000; and F: 1500.

354

E.M. Al-Mathal, A.M. Alsalem / Experimental Parasitology 131 (2012) 350–357

Fig. 2. Photomicrographs of traverse sections of ileum from healthy control mice G1 (A–C), infected/untreated mice G2 (D–F), and infected/P. granatum-treated mice G5 (G–I) on days 28 pi. Mucosa (M), villi (V), crypts of Lieberkühn (CL), submucosa (SM), inner circle muscle (IC), outer longitudinal muscle (OL), serosa (S), columnar epithelium absorptive cells (AC), brush border (BB), lamina propria (LP), Paneth cells (PC), D- Nude tip of the villi (head of arrow). E- Necrosis of the absorptive cells and multiple vacuolations in the cytoplasm of the columnar epithelium (arrow) , sever damage of the BB, and increased numbers of C. parvum trophozoites (CT) (heads of the arrows). FDegeneration of the epithelial cells lining the CLs (arrow head). Dilation and degeneration were also noted in the SM (arrow). G- Some villi regained their structure (arrow). HRestored size of the BB (arrow) and reduced numbers of C. parvum trophozoites (CT; (head of arrow). I- Improved structure of CL, increased presence of PCs (head of arrow), restored structure of the SM, and cohesion of the IC and OL. A: 500; B, E, and H: 3000; C and F: 1500x; D and G: 600; and I: 1000.

submucosa structure was observed (Fig. 1I). Renewal of cells in the crypts of Lieberkühn was visible; however, some signs of degeneration in the crypts and vacuolation were present. On day 28 pi, further improvement was observed in the ileum of G5 mice in the restoration of the symmetrical architecture of the villi, absence of hyperplasia in some of the villi (Fig. 2G), visible improvement in the absorptive cells, the presence of areas with pale pigmentation, and restoration of the bush border. Additionally, there was a visible reduction in Cryptosporidium trophozoites and reduced lymphocytic infiltration, with only limited cloudy swellings at the top of the villi and some dilation in the capillaries (Fig. 2H). P. granatum treatment also restored the cohesion of the inner circular muscle, while the outer longitudinal muscle showed fewer signs of degeneration and visible vacuolation. In general, the tissue histology of the G5 mice was very similar to that of the healthy control mice by day 28 pi (Fig. 2I). Ileum sections from uninfected G3 and G4 mice showed very similar histologies to that of the healthy control G1 mice on days 14 and 28 pi (data not shown). All layers, including the mucosa (M), sub mucosa (SM), muscularis (M), and serosa, were unaffected by the treatments with distilled water and P. granatum. Additionally,

the columnar epithelia, brush borders, and lamina propria were also healthy as depicted by limited hyperplasia in the villous epithelia. Therefore, our data indicate that P. granatum treatments did not negatively affect the health of the mice, and more importantly, P. granatum treatments greatly reduced the negative effects of cryptosporidiosis and eliminated the infections.

4. Discussion Here, a murine model of cryptosporidiosis was used to determine the efficacy of aqueous P. granatum peel as a treatment for C. parvum infections. Oocyst shedding, body-weight changes, and histological changes are useful for determining the pathology of C. parvum infections (Enemark et al., 2003; Guitard et al., 2006). Therefore, in this study, we examined these parameters during the course of C. parvum infections with and without P. granatum treatments. Similar to previous studies, fecal C. parvum oocyst shedding occurred in all infected mice 7 days after inoculation (Certad et al., 2007; Fayer, 1997). The most significant pathological manifestations

E.M. Al-Mathal, A.M. Alsalem / Experimental Parasitology 131 (2012) 350–357

of cryptosporidiosis observed in the infected animals were diminished activity and the presence of diarrhea, weight loss, and mortality as indicated in previous studies (de Graaf et al., 1999; Fayer, 2004). Watery diarrhea is considered a significant symptom of cryptosporidiosis (Fayer, 1997; Naciri et al., 1999; Schnyder et al., 2009; Trotz-Williams et al., 2007). No deaths and none of these symptoms were observed in the infected mice that were treated with P. granatum (G5). Weight reduction is a major pathological impact of cryptosporidiosis. As previously reported (Guitard et al., 2006; Mancassola et al., 1995), the infected/untreated G2 animals experienced significant weight loss throughout the duration of the experiment as compared to the healthy control mice. However, Sasahara et al. (2003) did not observe any variance in the weights of uninfected and C. parvum-infected neonatal mice 7 days after infection. This finding may be due to the limited length of the experiment. Several additional studies have indicated that C. parvum infection negatively impacts feeding and weight gain in infants and nursling animals such as calves (Checkley et al., 1997; Enemark et al., 2003; Molbak et al., 1997). Weight loss may be due to poor absorption arising from mucosal surface loss, chronic mal absorption, (Sloper et al., 1982), and infections secondary to infections with C. parvum (Brantley et al., 2003). Infected mice that were treated with P. granatum (G5) showed significant symptomatic improvements and significant weight gains during the treatment period (P < .05). Therefore, P. granatum may have a direct and powerful impact on the parasite that consequently minimizes the pathology associated with C. parvum infection resulting in improved nutrient absorption and increased appetites resulting in weight gain. As expected, there was a continual increase in fecal oocyst shedding in the infected/untreated group G2 throughout the duration of the experiment. This was likely due to the compromised immunity of the infected animals (Takeuchi et al., 2008) that allowed for sustained activity and proliferation of the parasite. Importantly, C. parvum-infected mice that were treated with P. granatum peel showed a complete elimination in fecal oocyst shedding by day 21 pi. The reduction and elimination of fecal oocyst shedding in response to P. granatum treatment seen here may be attributable to a direct effect on parasite growth in the intestines, the production of the sexual phases, and/or the formation of oocysts. Additionally, P. granatum peel contains major phenolic compounds, such as organic acids (Choi et al., 2011; Gasemian et al., 2006), that can directly inhibit C. parvum infections. Organic acids have an attenuating effect on the growth of enteropathogenic microbes (Anderson, 1992; Hsiao and Siebert, 1999; Nakki and Siebert, 2003). Specifically, organic acids have inhibitive effects on C. parvum infections (Watarai et al., 2008) and can reduce parasite vitality (Kniel et al., 2003). Furthermore, aqueous suspensions of P. granatum can stimulate rabbit immune systems (Gracious et al., 2001; Ross et al., 2001). Martin-Gomez et al. (2006) indicated a positive association between reduced oocyst shedding and increased antibodies. Additionally, the hydroxyl group of the phenolic compounds in P. granatum can increase toxicity against all organisms (Choi et al., 2011; Cowan, 1999). Therefore, P. granatum treatments may have both anti-parasitic and immune-modulatory affects. The histopathological changes observed in the ileum tissues of the infected/untreated group G2 have been previously observed (Capet et al., 1999; Guitard et al., 2006; Leitch and He, 1999; Maruyama et al., 2007; Motta et al., 2002; Peruci et al., 2006; Robinson et al., 2008; Tzipori et al., 1994). These pathological changes are attributed to C. parvum displacing brush borders causing an asymmetrical loss of epithelial cells resulting in shortening and fusing of the villi. The villi atrophy seen during cryptosporidiosis may be caused by toxins secreted by C. parvum that directly damage epithelial cells (Heine et al., 1984; Tzipori, 2002). C. parvum infection results in T-cell migration to the lamina propria.

355

The infection also stimulates lymphocytes and macrophages as a part of the host defense mechanism against the parasites (Waters and Harp, 1996). Necrosis and separation from the lamina propria of most of the epithelial cells and edema occurred due to parasiteinduced atrophy of the epithelial cells. These changes, accompanied by mal absorption and inflammation of the mucus membrane, induce a change in the transmission of water and electrolytes in the intestines (Blikslager et al., 2001; Zadrozny et al., 2006). A decrease in goblet cells was observed and is in agreement with previous studies, indicating the loss of absorbent cells and goblet cells that is common after C. parvum infections (Maruyama et al., 2007; Sasahara et al., 2003). Following treatment with P. granatum, the ileal villi of mice infected with C. parvum regained their symmetrical architecture and brush borders were restored. Additionally, the cytoplasmic densities and chromatin structures in the nucleus returned to normal following treatment with P. granatum. These data suggest that P. granatum treatments have positive influences on ileal tissue health in addition to its effects on C. parvum infections. This improvement of the ileum tissue of mice treated with P. granatum can be attributed to the remarkable decrease in the number of C. parvum trophozoites on the brush border, suspension of parasite production, and restoration of the natural structure of the villi. These changes and the increased number of goblet cells are indications of elevated immunity in the intestinal mucosa since these cells play a role in the production of anti-microbial antibodies (Bourlioux et al., 2003; Kaiser and Diamond, 2000). The dose of P. granatum peel used in this experiment (3 g/kg body weight) was effective in treating mice infected with experimental C. parvum and has been used previously without causing any side effects (Akhtar and Riffat, 1985). Aqueous extracts of P. granatum at doses of 2, 3, and 10 g/kg body weight is effective for treating chickens naturally-infected with Heterakis gallinarum (Fernandes et al., 2004). Some preliminary toxicity data showed non-toxic effects of P. granatum at high doses (Cerda et al., 2003; Vidal et al., 2003). Here, we showed that uninfected mice treated with P. granatum had no changes in behavior, weight gain, or intestinal histopathology, thus confirming that P. granatum treatments result in no ill side effects. 5. Conclusions The potency of aqueous suspensions of P. granatum peel in the treatment of C. parvum has been established in all measurement parameters used in this study. Infected mice that were treated with P. granatum showed continuous weight gain and improved intestinal histopathology throughout the course of the experiment. Furthermore, P. granatum-treated mice stopped shedding fecal oocysts by day 21, and were infection-free 10 days after P. granatum treatments ceased. The data presented here indicate that P. granatum peel is a promising treatment for C. parvum-induced cryptosporidiosis that does not induce any side effects. Further in-depth studies are needed to elucidate the mechanism of action of P. granatum peel and to identify the active compounds. Acknowledgment The authors would like to thank the King Abdul Aziz City for Science and Technology for supporting this study with Grant No. 5015-AP. References Afaq, F., Saleem, M., Krueger, C.G., Reed, J.D., Mukhtar, H., 2005. Anthocyanin- and hydrolyzable tannin-rich Pomegranate fruit extract modulates MAPK and NF–

356

E.M. Al-Mathal, A.M. Alsalem / Experimental Parasitology 131 (2012) 350–357

kappaB pathways and inhibits skin tumoriogenesis in CD-1 mice. Int. J. Cancer 113, 423–433. Akhtar, M.S., Riffat, S., 1985. Efficacy of Punica granatum, Linn. (ANAR) fruit (Rinds) against naturally acquired nematodal and cestodal infections in sheep. J. Pharm. Pb. Univ. Lhr. 6, 17–24. Anderson, M.E., 1992. Efficacies of acetic, lactic and two mixed acids in reducing numbers of bacteria on surfaces of lean meat. J. Food Safety 12, 139–147. Armson, A., Thompson, R.C.A., Reynoldson, J.A., 2003. A review of chemotherapeutic approaches to the treatment of Cryptosporidiosis. Expert Rev. Anti-infec. Thera. 2, 297–305. Aviram, M., Dornfeld, L., 2001. Pomegranate juice consumption inhibits serum angiotensin converting enzyme activity and reduces systolic blood pressure. Atherosclerosis 158, 195–198. Aviram, M., Dornfeld, L., Kaplan, M., Coleman, R., Gaitini, D., Nitecki, S., Hofman, A., Rosenblat, M., Volkova, N., Presser, D., Attias, J., Hayek, T., Fuhrman, B., 2002. Pomegrante juice flavonoids inhibit low-density lipoprotein oxidation and cardiovascular diseases: studies in atherosclerotic mice and in humans. Drug. Exp. Clin. Res. 28, 49–62. Aviram, M., Dornfeld, L., Roseblat, M., Volkova, N., Kaplan, M., Colemon, R., Hayek, T., Presser, D., Fuhrman, B., 2000. Pomegranate juice consumption reduces oxidative stress, atherogenic modifications to LDL, and platelet aggregation: studies in humans and in atherosclerotic apolipoprotein E-deficient mice. Am. J. Clin. Nutr. 71, 1062–1076. Bialonska, D., Kasimsetty, S., Schrader, K., Ferreira, D., 2009. The effect of pomegranate (Punica granatum L.) byproducts and ellagitannins on the growth of human gut bacteria. J. Agric. Food Chem. 57, 8344–8349. Blikslager, A., Hunt, E., Guerrant, R., Rhoads, M., Argenzio, R., 2001. Glutamine transporter in crypts compensates for loss of villus absorption in bovine cryptosporidiosis. Am. J. Physiol.-Gastr L 281, 645–653. Bourlioux, P., Koletzko, B., Guarner, F., Braesco, V., 2003. The intestine and its microflora are partners for the protection of the host: report on the Danone Symposium ‘‘The Intelligent Intestine’’, held in Paris, June 14, 2002. Am. J. Clin. Nutr. 78, 675–683. Braga, L.C., Shupp, J.W., Cumings, C., Jett, M., Takahashi, J.A., Carmo, I., ChartoneSouza, E., Nascimento, A.M., 2005. Pomegranate extract inhibits Staphylococcus aureus growth and subsequent enterotoxin production. J. Ethnopharmacol. 96, 335–339. Brantley, R.K., Williams, K.R., Silva, T.M.J., Sistrom, M., Thielman, N.M., Ward, H., Lima, A.A.M., Guerrant, R.L., 2003. AIDS-associated diarrhea and wasting in Northeast Brazil is associated with subtherapeutic plasma levels of antiretroviral medications and with both bovine and human subtypes of Cryptosporidium parvum. Braz. J. Infect. Dis. 7, 16–22. Calzada, F., Yepez-Mulia, L., Aguilar, A., 2006. In vitro susceptibility of Entamoeba histolytica and Giardia lamblia to plants used in Mexican traditional medicine for the treatment of gastrointestinal disorders. J. Ethnopharmacol. 108, 367–370. Capet, C., Kapel, N., Huneau, J.F., Magne, D., Tricottet, R.V., Benhamou, Y., Tome, D., Gobert, J.G., 1999. Cryptosporidium parvum infection in suckling rats: impairment of mucosal permeability and Na(+)–glucose cotransport. Exp. Parasitol. 91, 119–125. Cerda, B., Llorach, R., Ceron, J., Espin, J.C., Tomas-Barberan, F.A., 2003. Evaluation of the bioavailability and metabolism in the rat of punicalagin, an antioxidant polyphenol from pomegranate juice. Eur. J. Nutr. 42, 18–28. Certad, G., Nqouanesavanh, T., Guyot, K., Gantois, N., Chassat, T., Mouray, A., Fleurisse, L., Pinon, A., Cailliez, J.C., Dei-Cas, E., Creusy, C., 2007. Cryptosporidium parvum, a potential cause of colic adenocarcinoma. Infect. Agent Cancer 2, 22. Checkley, W., Gilman, R.H., Epstein, L.D., Suarez, M., Diaz, J.F., Cabrera, L., Black, R.E., Sterling, C.R., 1997. Asymptomatic and symptomatic cryptosporidiosis: their acute effect on weight gain in Peruvian children. Am. J. Epidemiol. 145, 156– 163. Choi, J., Kang, O., Lee, Y., Che, H., Oh, C., Brice, O., Kim, M., Sohn, D., Kim, H., Park, H., Shin, D., 2011. In Vitro and in vivo antibacterial activity of Punica granatum peel ethanol extract against Salmonella. Evid. Based Complement. Alternat. Med. 2011, 690518-1–690518-8. Cowan, M.M., 1999. Plant products as antimicrobial agents. Clin. Microbiol. Rev. 12, 564–582. Del Coco, V.F., Córdoba, M.A., Basualdo, J.A., 2009. Cryptosporidiosis: an emerging zoonosis. Rev. Argent Microbiol. 41, 185–196. de Graaf, D.C., Vanopdenbosch, E., Ortega-Mora, L.M., Abbassi, H., Peeters, J.E., 1999. Areview of the importance of cryptosporidiosis in farm animals. Int. J. Parasitol. 29, 1269–1287. Dell’Agli, M., Galli, G., Corbett, Y., Taramelli, D., Lucantoni, L., Habluetzel, A., Maschi, O., Caruso, D., Giavarini, F., Romeo, S., Bhattacharya, D., Bosisio, E., 2009. Antiplasmodial activity of Punica granatum L. fruit rind. J. Ethnopharmacol. 125, 279–285. De Waele, V., Speybroeck, N., Berkvens, D., Mulcahy, G., Murphy, T.M., 2010. Control of cryptosporidiosis in neonatal calves: Use of halofuginone lactate in two different calf rearing systems. Prev. Vet. Med. 96, 143–151. El-Sherbini, G.T., El Gozamy, B.R., Abdel-Hady, N.M., Morsy, T.A., 2009. Efficacy of two plant extracts against vaginal trichomoniasis. J. Egypt Soc. Parasitol. 39, 47– 58. Enemark, H.L., Bille-Hansen, V., Lind, P., Heegaard, P.M.H., Vigre, H., Ahrens, P., Thamsborg, S.M., 2003. Pathogenicity of Cryptosporidium parvum-evaluation of an animal infection model. Vet. Parasitol. 113, 35–57. Fayer, R., 1997. Cryoptosporidium and Cryoptosporidiosis. CRC Press LLC, Boca Raton, Florida.

Fayer, R., 2004. Cryptosporidium: a water-borne zoonotic parasite. Vet. Parasitol. 126, 37–56. Fernandes, R.M., Rodrigues, M.L.A., Borba, H.R., Fernandes, M.Z.C.M., de Amorim, A., 2004. Ausência da atividade anti-helmíntica de plantas em frangos de corte naturalmente infectados com Heterakis gallinarum (Schranck,1788) Madsen, 1949. Ciencia Rural 34, 1629–1682. Gasemian, A., Mehrabian, S., Majd, A., 2006. Peel extracts of two Iranian cultivars of pomegranate (Punica granatum) have antioxidant and antimutagenic activities. Pak. J. Biol. Sci. 9, 1402–1405. Ghosh, A., Das, B., Roy, A., Mandal, B., Chandra, G., 2008. Antibacterial activity of some medicinal plant extracts. J. Nat. Med. 62, 259–262. Gracious, R.R., Selvasubramanian, S., Jayasundar, S., 2001. Immunomodulatory activity of Punica granatum in rabbits-a preliminary study. J. Ethnopharmacol. 78, 85–87. Guitard, J., Menotti, J., Desveaux, A., Alimardani, P., Porcher, R., Derouin, F., Kapel, N., 2006. Experimental study of the effects of probiotics on Cryptosporidium parvum infection in neonatal rats. Parasitol. Res. 99, 522–527. Heelan, J.S., Ingersoll, F.W., 2002. Essentials of Human Parasitology. Delmar Thomson, Albany, New York. Heine, J., Pohlenz, J.F.L., Moon, H.W., Woode, G.N., 1984. Enteric lesions and diarrhea in gnotobiotic calves monoinfected with Cryptosporidium species. J. Infec. Dis. 150, 768–775. Henriksen, S.A., Pohlenz, J.F.L., 1981. Staining of cryptosporidia by a modified Ziehl– Neelsen technique. Acta. Vet. Scand. 22, 594–596. Hsiao, C.P., Siebert, K.J., 1999. Modeling the inhibitory effects of organic acids on bacteria. Int. J. Food Microbiol. 47, 189–201. Kaiser, V., Diamond, G., 2000. Expression of mammalian defensin genes. J. Leukocyte Biol. 68, 779–784. Kayser, O., Waters, W.R., Woods, K.M., Upton, S.J., Keithly, J.S., Laatsch, H., Kiderlen, A.F., 2002. Evaluation of in vitro and in vivo activity of benzindazole-4,9quinones against Cryptosporidium parvum. J. Antimicrob. Ch. 50, 975–980. Kim, N.D., Mehta, R., Yu, W., Neeman, I., Livney, T., Amichay, A., Poirier, D., Nicholls, P., Ki, A., Jiang, W., Mansel, R., Ramachandran, C., Rabi, T., Kaplan, B., Lansky, E., 2002. Chemopreventive and adjuvant therapeutic potential of pomegranate (Punica granatum) for human breast cancer. Breast Cancer Res. Tr. 71, 203–217. Klein, P., 2008. Preventive and therapeutic efficacy of halofuginone-lactate against Cryptosporidium parvum in spontaneously infected calves: a centralised, randomised, double-blind, placebo-controlled study. Vet. J. 177, 429–431. Kniel, K.E., Sumner, S.S., Lindsay, D.S., Hackney, C.R., Pierson, M.D., Zajac, A.M., Golden, D.A., Fayer, R., 2003. Effect of organic acids and hydrogen peroxide on Cryptosporidium parvum viability in fruit juices. J. Food Protect. 66, 1650–1657. Korayem, A.M., Hasabo, S.A., Ameen, H.H., 1993. Effects and mode of action of some plant extracts on certain plant parasitic nematodes. Anz. Schadl. 66, 32–36. Laurent, F., McCole, D., Eckmann, L., Kagnoff, M.F., 1999. Pathogenesis of Cryptosporidium parvum infection. Microbes Infect. 1, 141–148. Leitch, G.J., He, Q., 1999. Reactive nitrogen and oxygen species ameliorate experimental cryptosporidiosis in the neonatal BALB/c mouse model. Infect. Immun. 67, 5885–5891. Mancassola, R., Reperant, J.M., Naciri, M., Chartier, C., 1995. Chemoprophylaxis of Cryptosporidium parvum infection with paromomycin in kids and immunological study. Antimicrob. Agents. Ch. 39, 75–78. Martín-Gómez, S., Álvarez-Sánchez, M.A., Rojo-Vázquez, F.A., 2006. A newborn mouse Cryptosporidium parvum infection model: its application to the study of therapeutic and prophylactic measures for controlling cryptosporidiosis in ruminants. Parasitol. Res. 99, 1–6. Maruyama, H., Tanaka, M., Hashimoto, M., Inoue, M., Sasahara, T., 2007. The suppressive effect of Mekabu fucoidan on an attachment of Cryptosporidium parvum oocysts to the intestinal epithelial cells in neonatal mice. Life Sci. 80, 775–781. Massoud, A.M., Hafez, A.O., Abdel-Gawad, A.G., El-Shazly, A.M., Morsy, T.A., 2008. Mirazid alone or combined with Paromomycin in treating cryptosporidiosis parvum in immunocompetent hospitalized patients. J. Egypt. Soc. Parasitol. 38, 399–418. Molbak, K., Andersen, M., Aaby, P., Hojlyng, N., Jakobsen, M., Sodemann, M., da Silva, A.P., 1997. Cryptosporidium infection in infancy as a cause of malnutrition: a community study from Guinea–Bissau, west Africa. Am. J. Clin. Nutr. 65, 149– 152. Motta, I., Gissot, M., Kanellopoulos, J., Ojcius, D., 2002. Absence of weight loss during Cryptosporidium infection in susceptible mice deficient in Fas-mediated apoptosis. Microbes Infec. 4, 821–827. Naciri, M., Lefay, M.P., Mancassola, R., Poirier, P., Chermette, R., 1999. Role of Cryptosporidium parvum as a pathogen in neonatal diarrhoea complex in suckling and dairy calves in france. Vet. Parasitol. 85, 245–257. Naciri, M., Mancassola, R., Yvore, P., Peeters, J.E., 1993. The effect of halofuginone lactate on experimental Cryptosporidium parvum infections in calves. Vet. Parasitol. 45, 199–207. Navarro, V., Villarreal, L.M.A., Rojas, G., Lozoya, X., 1996. Antimicrobial evaluation of some plants used in Mexican traditional medicine for the treatment of infectious diseases. J. Ethnopharmacol. 53, 143–147. Pradhan, K.D., Thakur, D.K., Sudhan, N.A., 1992. Therapeutic efficacy of Punica granatum and Cucurbita maxima against clinical cases of nematodiasis in calves. Indian J. Indigenous Med. 9, 53–55. Prakash, V., Singhal, K.C., Gupta, R.R., 1980. Anthelmintic activity of Punica granatum and Artemisia siversiana. Indian J. Pharmacol. 12, 61A–80A.

E.M. Al-Mathal, A.M. Alsalem / Experimental Parasitology 131 (2012) 350–357 Robinson, P., Martin, P., Garza, A., D’Souza, M., Mastrangelo, M.A., Tweardy, D., 2008. Substance P receptor antagonism for treatment of cryptosporidiosis in immunosuppressed mice. J. Parasitol. 94, 1150–1154. Ross, G.R., Selvasubramanian, S., Jayasundar, S., 2001. Immunomodulatory activity of Punica granatum in rabbits–a preliminary study. J. Ethnopharmacol. 78, 85– 87. Rossignol, J.F., Maisonneuve, H., 1984. Nitazoxanide in the treatment of Taenia saginata and Hymenolepis nana infections. Am. J. Trop. Med. Hyg. 33, 511–512. Sasahara, T., Maruyama, H., Aoki, M., Kikuno, R., Sekiguchi, T., Takahashi, A., Satoh, Y., Kitasato, H., Takayama, Y., Matsuhisa, I.M., 2003. Apoptosis of intestinal crypt epithelium after Cryptosporidium parvum infection. J. Infect. Ch. 9, 278–281. Schnyder, M., Kohler, L., Hemphill, A., Deplazes, P., 2009. Prophylactic and therapeutic efficacy of nitazoxanide against Cryptosporidium parvum in experimentally challenged neonatal calves. Vet. Parasitol. 160, 149–154. Sherwood, D., Angus, K.W., Snodgrass, D.R., Tzipori, S., 1982. Experimental cryptosporidiosis in laboratory mice. Infect. Immun. 38, 471–475. Silverlas, C., Bjorkman, C., Egenvall, A., 2009. Systematic review and meta-analyses of the effects of halofuginone against calf cryptosporidiosis. Prev. Vet. Med. 91, 73–84. Sloper, K.S., Dourmashkin, R.R., Bird, R.B., Slavin, G., Webster, A.D.B., 1982. Chronic malabsorption due to cryptosporidiosis in a child with immunoglobulin deficiency. Gut 23, 80–82. Smith, H.V., Corcoran, G.D., 2004. New drugs and treatment for cryptosporidiosis. Curr. Opin. Infect. Dis. 17, 557–564. Sudheesh, S., Vijayalakshmi, N.R., 2005. Flavonoides from Punica granatum– potential antiperoxidative agents. Fitoterapia 76, 181–186. Suzuki, T., Hashimoto, T., Yabu, Y., Kido, Y., Kimitoshi, K., Nihei, C.I., Hato, M., Suzuki, S.I., Amano, Y., Nagai, K., Hosokawa, T., Minagawa, N., Ohta, N., Kita, K., 2004. Direct evidence for cyanide-insensitive quinol oxidase (alternative oxidase) in apicomplexan parasite Cryptosporidium parvum: phylogenetic and therapeutic implications. Biochem. Biophys. Res. Commn. 313, 1044–1052. Syed, D.N., Afaq, F., Mukhtar, H., 2007. Pomegranate derived products for cancer chemoprevention. Semin. Cancer Boil. 17, 377–385.

357

Takeuchi, D., Jones, V.C., Kobayashi, M., Suzuki, F., 2008. Cooperative role of macrophages and neutrophils in host antiprotozoan resistance in mice acutely infected with Cryptosporidium parvum. Infect. Immun. 76, 3657–3663. Trotz-Williams, L., Martin, S., Leslie, K., Duffield, T., Nydam, D., Peregrine, A., 2007. Calf-level risk factors for neonatal diarrhea and shedding of Cryptosporidium parvum in ontario dairy calves. Prev. Vet. Med. 82, 12–28. Tzipori, S., 2002. Introduction. Cryptosporidiosis: current trends and challenges. Microbes Infect. 4, 1045. Tzipori, S., Rand, W., Griffiths, J., Widmer, G., Crabb, J., 1994. Evaluation of an animal model system for cryptosporidiosis: therapeutic efficacy of paromomycin and hyperimmune bovine colostrum-immunoglobulin. Clin. Diagn. Lab. Immun. 1, 450–463. Vidal, A., Fallarero, A., Pena, B.R., Medina, M.E., Gra, B., Rivera, F., Gutierrez, Y., Vuorela, P.M., 2003. Studies on the toxicity of Punica granatum L. (Punicaceae) whole fruit extract. J. Ethnopharmacol. 89, 295–300. Wang, C., Wu, Y., Qin, J., Sun, H., He, H., 2009. Induced susceptibility of host is associated with an impaired antioxidant system following infection with Cryptosporidium parvum in Se-deficient mice. PLoS One 4, e4628. Watarai, S., Tana, T., Koiwa, M., 2008. Feeding activated charcoal from bark containing wood vinegar liquid (nekka-rich) is effective as treatment for cryptosporidiosis in calves. J. Dairy Sci. 91, 1458–1463. Waters, W.R., Harp, J.A., 1996. Cryptosporidium parvum infection in T-cell receptor (TCR)-alpha- and TCR-delta-deficient mice. Infect. Immun. 64, 1854–1857. Waters, W.R., Frydman, B., Marton, L.J., Valasinas, A., Reddy, V.K., Harp, J.A., Wannemuehler, M.J., Yarlett, N., 2000. [(1)N, (12)N]Bis(Ethyl)-cis-6,7dehydrospermine: a new drug for treatment and prevention of Cryptosporidium parvum infection of mice deficient in T-cell receptor alpha. Antimicrob. Agents Ch. 44, 2891–2894. Wu, Z., Nagano, I., Matsuo, A., Uga, S., Kimata,I., Iseki, M., Takahashi, Y., 2000.14, 3339. Zadrozny, L.M., Stauffer, S.H., Armstrong, M.U., Jones, S.L., Gookin, J.L., 2006. Neutrophils do not mediate the pathophysiological sequelae of Cryptosporidium parvum infection in neonatal piglets. Infect. Immun. 74, 5497–5505.