- Email: [email protected]
Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction
Biosensors and Bioelectronics 64 (2015) 671–675
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction Xu Xue-tao a,n, Liang Kai-yi b, Zeng Jia-ying c a
HKUST Fok Ying Tung Graduate School, GuangZhou, GuangDong 511458, PR China Faculté des Sciences et techniques, Université du Maine Avenue Olivier Messiaen, 72085 Le Mans Cedex 9, France c South China University of Technology, PR China b
ar t ic l e i nf o
a b s t r a c t
Article history: Received 1 July 2014 Received in revised form 16 September 2014 Accepted 30 September 2014 Available online 5 October 2014
A portable and sensitive quantitative DNA detection method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA–invertase conjugation on the surface of Streptavidin-MNBs. The DNA– invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0 to 1000 fM, which is lower than some DNA detection method. In addition, the method exhibited excellent sequence selectivity and there was almost no effect of biological complex to the detection performance, which suggested our method can be successfully applied to DNA detection in real biological samples. & 2014 Elsevier B.V. All rights reserved.
Keywords: DNA detection Portable Sensitive Personal glucose meters Target recycling process
1. Introduction Simple, fast and highly sensitive detection of certain DNA sequences has become increasingly important in the field of drug development, clinical diagnosis and environmental science (Daar and Thorsteinsdottir, 2002; Rosi and Giljohann, 2006; Duan and Liu, 2010). Much effort has been made to develop sensitive and selective DNA assay. Among them, traditional techniques, including fluorescence, colorimetry, electrochemistry, surface enhanced Raman scattering (SERS), surface plasmon and light scattering and force, are employed (Stoeva and Lee, 2006; Fabris and Dante, 2007; Nakayama and Yan, 2008; Hong and Zhou, 2009; Nakayama and Sintim, 2009; Zhang and Wang, 2009; Barhoumi and Halas, 2010; Li and Deng, 2010; Xia and White, 2010; Wu and Wang, 2011; Zhu and Liu, 2011). The detection of limit is low enough for routine detection. However, most of the traditional techniques are expensive, which is not easily available to the public. What is more, sophisticated instrument and operations are required in those methods, which have limited its application. Some fluorescent and colorimetric methods have been developed for DNA detection by using only naked eyes. However, only qualitative or n
Corresponding author. E-mail address: [email protected] (X. Xue-tao).
http://dx.doi.org/10.1016/j.bios.2014.09.094 0956-5663/& 2014 Elsevier B.V. All rights reserved.
semi-quantitative detections can be conducted and the color observation may be affected by many conditions, such as temperature, humidity, the laboratory technicians and light contrast of the surroundings, which have limited its wider application. In order to obtain portable and quantitative DNA detection methods by using naked eyes, expensive or customized portable spectrometers are still needed. Therefore, it is still a great challenge to develop portable and quantitative DNA detection method which is easily available to the public and with accessible resources at home. Recently, much attention has been focused on personal glucose meter (PGM). PGM is usually used to detect the glucose concentration of diabetic patients (Montagnana and Caputo, 2009). It has the characteristics of low cost, simple operation and portability (Clark and Lyons, 1962). It can be obtained in stores with only $10 for a meter, which can be integrated into cell phones for point-ofuse. Therefore, PGM is a worldwide commercial availability to the public. However, the PGM is still limited in that it can detect only a single target, glucose. In 2011, Lu linked PGM with functional DNA sensors to achieve portable, low-cost and quantitative detection of targets beyond glucose (Xiang and Lu, 2011; Xiang and Lu, 2012). Yi Lu introduced DNA–invertase conjugates to a magic bead, by using a sandwich assay method, DNA can be portably and quantitatively detected. However, only a detection limit of about 40 pM was obtained, which was relative higher for ultralow
672
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
detection of cancer related DNA molecules (Xiang and Lu, 2012). New strategies are needed to improve the sensitivity of PGM sensor. In order to improve the sensitive for DNA assay, target amplification is usually used, especially for enzyme-assisted amplification. Among them, polymerase chain reaction (PCR) is the most widely used one, as its high sequence specificity and amplification yield (Saiki and Scharf, 1985). However, in the procedure of PCR, small contaminants can also be amplified, which leads to false-positives and the requirement for thermal cycling and experimental expertize in PCR technique have ultimately restricted its widespread application. Alternatively, a number of new methods of target amplification have been proposed (Weizmann and Beissenhirtz, 2006; Weizmann and Cheglakov, 2006; Beissenhirtz and Elnathan, 2007; He and Wu, 2010). Strand displacement amplification (SDA) is one of the most popular methods. SDA provides exponential amplification of a trace of DNA or RNA, which is an essential step for nucleic acid strand detection and quantification (Ren and Leng, 2010). This method is based on the ability of DNA polymerase to extend an oligodeoxyribonucleotide primer, which is specifically hybridized to a single-stranded DNA template. Guo et al. developed a sensitive platform based on a polymerase induced isothermal stranddisplacement polymerization reaction containing a hairpin fluorescence probe for single-strand DNA detection (Guo and Yang, 2009). A detection limit of 6.4 10 15 M was obtained, which is five orders of magnitude lower than that of methods without strand-displacement polymerization reaction. In this paper, a portable and sensitive DNA quantification method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The capture DNA was fixed onto Streptavidin-MNBs. Then target DNA (in red color) hybridized with the capture DNA and opened their loop parts, enabling a primer with DNA–invertase conjugation to attach on the stem part, which initiated a polymerization which replaced the target with the aid of the DNA polymerase I. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA–invertase conjugation on the surface of Streptavidin-MNBs. The bound DNA–invertase can be used to catalyze the hydrolysis of sucrose into glucose with millions of turnovers, which transformed the concentration of target DNA into the level of glucose for monitoring of PGM.
2. Experimental section 2.1. Chemicals All oligonucleotides were synthesized and purified by Sangon (Shanghai, China) and the sequences were showed in Table 1. All DNA oligonucleotides were diluted by TE buffer (10 mM Tris–HCl and 1.0 mM Na2EDTA, pH 8.0). They were denatured at 95 °C for 5 min naturally cooled down to room temperature before use. The polymerase Klenow fragment exo was purchased from New England Biolabs, Inc. The deoxynucleotide solution mixture
(dNTPs) was purchased from TaKaRa Bio Inc. (Dalian, China) and the DMSO was obtained from Sigma. Streptavidin-MNBs (350 nm in diameter, the aqueous suspension containing 0.05% Tween-20, 0.1% bovine serum albumin (BSA) and 10 mM EDTA at a concentration of 3.324 1011 beads mL 1) were obtained from Bangs Laboratories Inc. (Fishers, IN). Grade VII invertase was obtained from baker's yeast (Saccharomyces cerevisiae), Tween-20, sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (sulfoSMCC), Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) and bovine serum albumin (BSA) were purchase from Sigma (St. Louis, MO). Other chemicals were in analytical grade obtained from standard reagent suppliers and used directly. All solutions were prepared with Milli-Q water (resistivity ¼18 MΩ cm) from a Millipore system. 2.2. DNA–invertase conjugation Firstly, a sum of 30 mL of primer DNA (1 mM), 2 mL of of sodium phosphate buffer (1 M, pH 5.5) and 2 mL of TCEP solution (30 mM) were mixed, which was then incubated for 1 h at room temperature. The mixture was purified by Amicon-10 K for 10 times using buffer A (0.1 M NaCl, 0.05% Tween-20, 0.1 M sodium phosphate buffer, pH 7.3). Then, in order to conduct invertase conjugation, 1 mg of sulfo-SMCC was added into 400 mL of invertase solution (dissolved in buffer A), which was incubated for 1 h on a roller. The obtained mixture was purified through centrifugation and Amicon-100 K using Buffer A by 10 times. Finally, the obtained sulfoSMCC-activated invertase was mixed with the primer DNA, which was incubated for 48 h at room temperature. The mixture was purified by Amicon-100 K for 10 times using Buffer A. 2.3. Isothermal circular strand-displacement polymerization reaction Firstly, 5 mL of Streptavidin-MNBs was washed three times by using buffer A to remove the surfactants. Then, 50 mL of buffer A was added into the Streptavidin-MNBs suspension. One microliters above Streptavidin-MNBs suspension was added into a tube and 10 mL of capture DNA (10 mM in TE buffer) was added to bind on the Streptavidin-MNBs, which was placed on a roller for 30 min. It was washed using buffer A for 5 times and the Streptavidin-MNBs were separated by a magnet. Then, the primer DNA with DNA– invertase conjugation and different target DNA were mixed with the Streptavidin-MNBs. All samples were performed in 80 ml solution containing 50 mM Tris–HCl (pH 8.0) and 5 mM MgCl2 and incubated at 37 °C. Finally, 15 U of polymerase Klenow fragment exo was added and allowed to react in 37 °C for 1 h. 2.4. Measurement of PGM signal Then, the solution obtained from isothermal circular stranddisplacement polymerization reaction was transferred into a tube and 100 mL of sucrose in Buffer A (0.5 M) was added into the system and allowed to incubate for 16 h. An amount of 5 mL obtained mixture was detected by a PGM.
Table 1 Oligonucleotides designed in the present study. Name
Sequence (5′ to 3′)
Capture DNA Target DNA One base mismatch DNA Three base mismatch DNA Primer DNA
Biotin-TTTTTTTTTTCTTGGACACAGTAAAGAGAGGTGCGCCCATTGTGTCCAAGA TCTTGGACACAGTAAAGAGAGGTGCGCCCATTGTGTCCAAGA TCTTGGACACAGTAAAGACAGGTGCGCCCATTGTGTCCAAGA TCTTGGACACAGTAAAGACTCGTGCGCCCATTGTGTCCAAGA HS-TTTTTTTTTTCTTGGAC
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
673
3. Results and discussion 3.1. Principle of the portable and sensitive quantitative detection of DNA The design principle for portable and sensitive quantitative detection of DNA is schematically described in Fig. 1. Firstly, the capture DNA was fixed onto Streptavidin-MNBs. Then target DNA (in red color) hybridized with the capture DNA and opened their loop parts, enabling a primer with DNA–invertase conjugation to attach on the stem part, which initiates a polymerization which replaced the target with the aid of the Klenow fragment of Escherichia coli DNA polymerase I (denoted as “Klenow” for short), its buffer and dNTP mixture. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA–invertase conjugation on the surface of Streptavidin-MNBs. We assumed the concentration of target DNA was proportional to the amount of DNA–invertase bound to the Streptavidin-MNBs. After the washing away of unbound target DNA and DNA–invertase conjugation, the bound DNA–invertase can be used to catalyze the hydrolysis of sucrose into glucose with millions of turnovers, which transformed the concentration of target DNA into the level of glucose for monitoring of PGM.
Fig. 2. Identification of the hybridization feature capture DNA (B and C samples contain target DNA 300 and 1000 fM, respectively).
3.2. Target hybridization with capture DNA on Streptavidin-MNBs In order to identify the hybridization feature capture DNA, three samples were prepared. Sample A was capture DNA modified onto the Streptavidin-MNBs together with detection DNA; samples B and C contained different concentration of target DNA and detection DNA. As shown in Fig. 2, the difference of signal to above three samples was obvious, which indicated the detection capability of the capture DNA and our designed method. 3.3. Optimization of experimental parameters The performance of our DNA detection method was determined by both the efficiency of target recycling process and the read out of PGM. In order to obtain an optimal performance, the temperature, the dosage of DNA polymerase, incubation time and amount of DNA–invertase conjugation were optimized. 3.3.1. Optimization of temperature The temperature has a significant effect on the performance of our proposed method, as the enzyme activity and the DNA hybridization are highly depended on the temperature. In order to get the optimum temperature, we carried out DNA detection at different temperature (15, 25, 37, 45 and 60 °C). We obtained a peak signal at 37 °C, which are showed in Fig. 1 of ESI. Therefore, 37 °C was selected for subsequent detection. 3.3.2. Optimization for the dosage of DNA polymerase DNA polymerase played a key role in the detection of DNA, which affects the efficiency of target recycling process. Therefore, the effective of dosage of DNA polymerase to the signal of PGM was investigated. As shown in Fig. 3, the signal intensity of PGM increased sharply with the increasing dosage of DNA polymerase. There was a peak at the dosage of 15U and the signal of PGM began to decrease when the dosage over than 15U. Therefore, a dosage of 15U of DNA polymerase was selected for subsequent detection.
Fig. 1. Schematic illustration of portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction.
3.3.3. Optimization of incubation time for mixture and MBs The performance of DNA detection was strongly affected by the incubation time of mixture and MBs. As shown in Fig. 4, the signal of PGM elevated gradually with the increasing of incubation time (in the presence of 100, 500 and 1000 fM target DNA) at the early stage and a maximum was obtained at 60 min. In order to obtain the best signal-to-background level, 60 min was selected as the incubation time for sequent detection.
674
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
Fig. 3. Relationship between the amount of DNA polymerase and signal. The concentration of target DNA from below to up is 100, 500 and 1000 fM target DNA.
Fig. 4. Relationship between the incubation time and signal. The concentration of target DNA from below to up is 100, 500 and 1000 fM target DNA.
3.3.4. Optimization the amount of DNA–invertase conjugation The amount of DNA–invertase conjugation can affect the performance of DNA detection method. Insufficient of DNA– invertase conjugation may lead to the decrease of sensitivity and excessive of DNA–invertase conjugation may produce a higher background. Therefore, different amount of DNA–invertase conjugation (5, 10, 50,100, 200 and 300 mL) were used for the detection of target DNA. The signals of different amount of DNA– invertase conjugation were showed in Fig. 2 of ESI. The signal increased with the increasing of DNA–invertase conjugation amount until 100 mL and there was a peak at the amount of 100 mL. When the amount of DNA–invertase conjugation was higher than 100 mL, the signal decreased slightly, which may caused by the increasing of the background signal. Therefore, an amount of 100 mL of DNA–invertase conjugation was selected for the following study.
Fig. 5. Relationship between the concentration of target DNA and signal. Condition: Each data point represents an average of 3 measurements (each error bar indicates the standard deviation).
DNA concentration and intensity of signal increased monotonically (nearly linearly) with the concentration of target DNA (As shown in Fig. 5). There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0–1000 fM. A correlation coefficient of 0.989 was obtained and the relative standard deviation (RSD) was 4.6% for a concentration of 0.5 pM target DNA (n¼ 5), which was comparable or even better than some of other reported methods. Such an attractive detection limit of our sensing strategy can be primarily attributed to three aspects: the amplification of target recycling process, the enrichment effect of Streptavidin-MNBs and the million turnovers of sucrose hydrolysis into glucose. With the aid of target recycling process, numerous capture DNA can be opened, which increased the sensitivity dramatically. Substantial target DNA and detection DNA in solution were collected onto the surface of StreptavidinMNBs and one sucrose on the detection DNA turns into millions of glucose for monitoring of PGM. 3.5. Selectivity In order to evaluate the specificity of this strategy, we then challenged our assay to different mismatched targets. As shown in Fig. 6, the signal intensity of PGM for one base mismatch DNA, three bases mismatch DNA were similar to that of black
3.4. Sensing performance for target DNA In order to evaluate the performance of our proposed method for target DNA detection, we challenged the proposed method with a series of concentrations of target DNA, covering a range of nearly 3 orders of magnitude (5.0–1000 fM). Improved signal of personal glucose meter was observed with the increase of target
Fig. 6. The signal intensity of PGM to (1) hybridization buffer, (2) single base mismatch DNA, (3) three bases mismatch DNA and (4) target DNA.
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
Table 2 Recovery tests for different concentration of target DNA in human serum. Sample ID
Added value of DNA/pM
Detected/pM
Recovery/%
1 2 3
5 80 100
5.3 7 0.9 78.17 4.5 105.4 7 8.8
106.0 97.6 105.4
hybridization buffer, demonstrating that the designed assay was specific for the target DNA. 3.6. Feasibility in complex biological matrices In order to evaluate the practical application of proposed DNA detection method, we challenged it to complex biological matrixes such as serum, using the same experimental procedures as those for target DNA detection in buffer solution. Serum is what remains from whole blood after coagulation. It does not contain target DNA. The signal of PGM detected in hybridization buffer, 20% human serum and 50% human serum did not show significant difference, indicating very little interference of complex matrices on the method. Furthermore, our method was challenged to different amount of target DNA in 20% human serum for recovery tests. The results were summarized in Table 2. Satisfactory values between 97.6 and 106% were obtained for the recovery experiments, which indicated that the possible interference from the serum on the target DNA detection was negligible. The above results demonstrate that our proposed DNA detection method can be successfully applied to DNA detection in real biological samples. 3.6.1. Study of stability for target DNA detection The stability of proposed method has been investigated. There are mainly two steps in our proposed method, which are the isothermal circular strand-displacement polymerization reaction and measurement by using PGM. The stability of our sensor is determined by the stability of DNA–invertase conjugation, capture DNA coated Streptavidin-MNBs. In order to study the stability, the DNA–invertase conjugation, capture DNA coated StreptavidinMNBs are prepared and employed to the detection of target DNA after stored 7, 14 and 30 days. The results show that there are not significant differences with the fresh prepared sample (the signal is 375712.4, 366 7 13.6, 3587 16.6 and 385 715.8 mg/dL, respectively), indicating a good stability of our proposed method.
4. Conclusion In summary, a portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA– invertase conjugation on the surface of Streptavidin-MNBs. The DNA–invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. A low limit of detection was obtained owning to following reasons: the amplification of target recycling process, the enrichment effect of Streptavidin-MNBs and the million turnovers of sucrose hydrolysis into glucose. In addition, the method exhibited excellent sequence selectivity, being able to differentiate a single mismatch in the target DNA. What is more,
675
there was almost no effect of biological complex to the detection performance, which suggested that our method can be successfully applied to DNA detection in real biological samples.
Appendix A. Supplementary information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.09.094.
References Barhoumi, A., Halas, N.J., 2010. Label-free detection of DNA hybridization using surface enhanced Raman spectroscopy. J. Am. Chem. Soc. 132 (37), 12792–12793. Beissenhirtz, M.K., Elnathan, R., et al., 2007. The aggregation of Au nanoparticles by an autonomous DNA machine detects viruses. Small 3 (3), 375–379. Clark Jr., L.C., Lyons, C., 1962. Electrode systems for continuous monitoring in cardiovascular surgery. Ann. N. Y. Acad. Sci. 102, 29–45. Daar, A.S., Thorsteinsdottir, H., et al., 2002. Top ten biotechnologies for improving health in developing countries. Nat. Genet. 32 (2), 229–232. Duan, X., Liu, L., et al., 2010. Cationic conjugated polymers for optical detection of DNA methylation, lesions, and single nucleotide polymorphisms. Acc. Chem. Res. 43 (2), 260–270. Fabris, L., Dante, M., et al., 2007. A heterogeneous PNA-based SERS method for DNA detection. J. Am. Chem. Soc. 129 (19), 6086–6087. Guo, Q., Yang, X., et al., 2009. Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction. Nucleic Acids Res. 37 (3), e20. He, J.L., Wu, Z.S., et al., 2010. Fluorescence aptameric sensor for strand displacement amplification detection of cocaine. Anal. Chem. 82 (4), 1358–1364. Hong, M., Zhou, X., et al., 2009. Nanoparticle-based, fluorous-tag-driven DNA detection. Angew. Chem. Int. Ed. Engl. 48 (50), 9503–9506. Li, J., Deng, T., et al., 2010. Rolling circle amplification combined with gold nanoparticle aggregates for highly sensitive identification of single-nucleotide polymorphisms. Anal. Chem. 82 (7), 2811–2816. Montagnana, M., Caputo, M., et al., 2009. Overview on self-monitoring of blood glucose. Clin. Chim. Acta 402 (1–2), 7–13. Nakayama, S., Sintim, H.O., 2009. Colorimetric split G-quadruplex probes for nucleic acid sensing: improving reconstituted DNAzyme's catalytic efficiency via probe remodeling. J. Am. Chem. Soc. 131 (29), 10320–10333. Nakayama, S., Yan, L., et al., 2008. Junction probes-sequence specific detection of nucleic acids via template enhanced hybridization processes. J. Am. Chem. Soc. 130 (38), 12560–12561. Ren, R., Leng, C., et al., 2010. Detection of DNA and indirect detection of tumor cells based on circular strand-replacement DNA polymerization on electrode. Chem. Commun. (Camb.) 46 (31), 5758–5760. Rosi, N.L., Giljohann, D.A., et al., 2006. Oligonucleotide-modified gold nanoparticles for intracellular gene regulation. Science 312 (5776), 1027–1030. Saiki, R.K., Scharf, S., et al., 1985. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230 (4732), 1350–1354. Stoeva, S.I., Lee, J.S., et al., 2006. Multiplexed DNA detection with biobarcoded nanoparticle probes. Angew. Chem. Int. Ed. Engl. 45 (20), 3303–3306. Weizmann, Y., Beissenhirtz, M.K., et al., 2006. A virus spotlighted by an autonomous DNA machine. Angew. Chem. Int. Ed. Engl. 45 (44), 7384–7388. Weizmann, Y., Cheglakov, Z., et al., 2006. Autonomous fueled mechanical replication of nucleic acid templates for the amplified optical detection of DNA. Angew. Chem. Int. Ed. Engl. 45 (14), 2238–2242. Wu, Z., Wang, H., et al., 2011. Terminal protection of small molecule-linked DNA: A versatile biosensor platform for protein binding and gene typing assay. Anal. Chem. 83 (8), 3104–3111. Xia, F., White, R.J., et al., 2010. An electrochemical supersandwich assay for sensitive and selective DNA detection in complex matrices. J. Am. Chem. Soc. 132 (41), 14346–14348. Xiang, Y., Lu, Y., 2011. Using personal glucose meters and functional DNA sensors to quantify a variety of analytical targets. Nat. Chem. 3 (9), 697–703. Xiang, Y., Lu, Y., 2012. Using commercially available personal glucose meters for portable quantification of DNA. Anal. Chem. 84 (4), 1975–1980. Zhang, Y., Wang, Y., et al., 2009. Electrochemical DNA biosensor based on the proximity-dependent surface hybridization assay. Anal. Chem. 81 (5), 1982–1987. Zhu, S., Liu, Z., et al., 2011. Nucleic acid detection using single-walled carbon nanohorns as a fluorescent sensing platform. Chem. Commun. (Camb.) 47 (21), 6099–6101.
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction Xu Xue-tao a,n, Liang Kai-yi b, Zeng Jia-ying c a
HKUST Fok Ying Tung Graduate School, GuangZhou, GuangDong 511458, PR China Faculté des Sciences et techniques, Université du Maine Avenue Olivier Messiaen, 72085 Le Mans Cedex 9, France c South China University of Technology, PR China b
ar t ic l e i nf o
a b s t r a c t
Article history: Received 1 July 2014 Received in revised form 16 September 2014 Accepted 30 September 2014 Available online 5 October 2014
A portable and sensitive quantitative DNA detection method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA–invertase conjugation on the surface of Streptavidin-MNBs. The DNA– invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0 to 1000 fM, which is lower than some DNA detection method. In addition, the method exhibited excellent sequence selectivity and there was almost no effect of biological complex to the detection performance, which suggested our method can be successfully applied to DNA detection in real biological samples. & 2014 Elsevier B.V. All rights reserved.
Keywords: DNA detection Portable Sensitive Personal glucose meters Target recycling process
1. Introduction Simple, fast and highly sensitive detection of certain DNA sequences has become increasingly important in the field of drug development, clinical diagnosis and environmental science (Daar and Thorsteinsdottir, 2002; Rosi and Giljohann, 2006; Duan and Liu, 2010). Much effort has been made to develop sensitive and selective DNA assay. Among them, traditional techniques, including fluorescence, colorimetry, electrochemistry, surface enhanced Raman scattering (SERS), surface plasmon and light scattering and force, are employed (Stoeva and Lee, 2006; Fabris and Dante, 2007; Nakayama and Yan, 2008; Hong and Zhou, 2009; Nakayama and Sintim, 2009; Zhang and Wang, 2009; Barhoumi and Halas, 2010; Li and Deng, 2010; Xia and White, 2010; Wu and Wang, 2011; Zhu and Liu, 2011). The detection of limit is low enough for routine detection. However, most of the traditional techniques are expensive, which is not easily available to the public. What is more, sophisticated instrument and operations are required in those methods, which have limited its application. Some fluorescent and colorimetric methods have been developed for DNA detection by using only naked eyes. However, only qualitative or n
Corresponding author. E-mail address: [email protected] (X. Xue-tao).
http://dx.doi.org/10.1016/j.bios.2014.09.094 0956-5663/& 2014 Elsevier B.V. All rights reserved.
semi-quantitative detections can be conducted and the color observation may be affected by many conditions, such as temperature, humidity, the laboratory technicians and light contrast of the surroundings, which have limited its wider application. In order to obtain portable and quantitative DNA detection methods by using naked eyes, expensive or customized portable spectrometers are still needed. Therefore, it is still a great challenge to develop portable and quantitative DNA detection method which is easily available to the public and with accessible resources at home. Recently, much attention has been focused on personal glucose meter (PGM). PGM is usually used to detect the glucose concentration of diabetic patients (Montagnana and Caputo, 2009). It has the characteristics of low cost, simple operation and portability (Clark and Lyons, 1962). It can be obtained in stores with only $10 for a meter, which can be integrated into cell phones for point-ofuse. Therefore, PGM is a worldwide commercial availability to the public. However, the PGM is still limited in that it can detect only a single target, glucose. In 2011, Lu linked PGM with functional DNA sensors to achieve portable, low-cost and quantitative detection of targets beyond glucose (Xiang and Lu, 2011; Xiang and Lu, 2012). Yi Lu introduced DNA–invertase conjugates to a magic bead, by using a sandwich assay method, DNA can be portably and quantitatively detected. However, only a detection limit of about 40 pM was obtained, which was relative higher for ultralow
672
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
detection of cancer related DNA molecules (Xiang and Lu, 2012). New strategies are needed to improve the sensitivity of PGM sensor. In order to improve the sensitive for DNA assay, target amplification is usually used, especially for enzyme-assisted amplification. Among them, polymerase chain reaction (PCR) is the most widely used one, as its high sequence specificity and amplification yield (Saiki and Scharf, 1985). However, in the procedure of PCR, small contaminants can also be amplified, which leads to false-positives and the requirement for thermal cycling and experimental expertize in PCR technique have ultimately restricted its widespread application. Alternatively, a number of new methods of target amplification have been proposed (Weizmann and Beissenhirtz, 2006; Weizmann and Cheglakov, 2006; Beissenhirtz and Elnathan, 2007; He and Wu, 2010). Strand displacement amplification (SDA) is one of the most popular methods. SDA provides exponential amplification of a trace of DNA or RNA, which is an essential step for nucleic acid strand detection and quantification (Ren and Leng, 2010). This method is based on the ability of DNA polymerase to extend an oligodeoxyribonucleotide primer, which is specifically hybridized to a single-stranded DNA template. Guo et al. developed a sensitive platform based on a polymerase induced isothermal stranddisplacement polymerization reaction containing a hairpin fluorescence probe for single-strand DNA detection (Guo and Yang, 2009). A detection limit of 6.4 10 15 M was obtained, which is five orders of magnitude lower than that of methods without strand-displacement polymerization reaction. In this paper, a portable and sensitive DNA quantification method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The capture DNA was fixed onto Streptavidin-MNBs. Then target DNA (in red color) hybridized with the capture DNA and opened their loop parts, enabling a primer with DNA–invertase conjugation to attach on the stem part, which initiated a polymerization which replaced the target with the aid of the DNA polymerase I. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA–invertase conjugation on the surface of Streptavidin-MNBs. The bound DNA–invertase can be used to catalyze the hydrolysis of sucrose into glucose with millions of turnovers, which transformed the concentration of target DNA into the level of glucose for monitoring of PGM.
2. Experimental section 2.1. Chemicals All oligonucleotides were synthesized and purified by Sangon (Shanghai, China) and the sequences were showed in Table 1. All DNA oligonucleotides were diluted by TE buffer (10 mM Tris–HCl and 1.0 mM Na2EDTA, pH 8.0). They were denatured at 95 °C for 5 min naturally cooled down to room temperature before use. The polymerase Klenow fragment exo was purchased from New England Biolabs, Inc. The deoxynucleotide solution mixture
(dNTPs) was purchased from TaKaRa Bio Inc. (Dalian, China) and the DMSO was obtained from Sigma. Streptavidin-MNBs (350 nm in diameter, the aqueous suspension containing 0.05% Tween-20, 0.1% bovine serum albumin (BSA) and 10 mM EDTA at a concentration of 3.324 1011 beads mL 1) were obtained from Bangs Laboratories Inc. (Fishers, IN). Grade VII invertase was obtained from baker's yeast (Saccharomyces cerevisiae), Tween-20, sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (sulfoSMCC), Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) and bovine serum albumin (BSA) were purchase from Sigma (St. Louis, MO). Other chemicals were in analytical grade obtained from standard reagent suppliers and used directly. All solutions were prepared with Milli-Q water (resistivity ¼18 MΩ cm) from a Millipore system. 2.2. DNA–invertase conjugation Firstly, a sum of 30 mL of primer DNA (1 mM), 2 mL of of sodium phosphate buffer (1 M, pH 5.5) and 2 mL of TCEP solution (30 mM) were mixed, which was then incubated for 1 h at room temperature. The mixture was purified by Amicon-10 K for 10 times using buffer A (0.1 M NaCl, 0.05% Tween-20, 0.1 M sodium phosphate buffer, pH 7.3). Then, in order to conduct invertase conjugation, 1 mg of sulfo-SMCC was added into 400 mL of invertase solution (dissolved in buffer A), which was incubated for 1 h on a roller. The obtained mixture was purified through centrifugation and Amicon-100 K using Buffer A by 10 times. Finally, the obtained sulfoSMCC-activated invertase was mixed with the primer DNA, which was incubated for 48 h at room temperature. The mixture was purified by Amicon-100 K for 10 times using Buffer A. 2.3. Isothermal circular strand-displacement polymerization reaction Firstly, 5 mL of Streptavidin-MNBs was washed three times by using buffer A to remove the surfactants. Then, 50 mL of buffer A was added into the Streptavidin-MNBs suspension. One microliters above Streptavidin-MNBs suspension was added into a tube and 10 mL of capture DNA (10 mM in TE buffer) was added to bind on the Streptavidin-MNBs, which was placed on a roller for 30 min. It was washed using buffer A for 5 times and the Streptavidin-MNBs were separated by a magnet. Then, the primer DNA with DNA– invertase conjugation and different target DNA were mixed with the Streptavidin-MNBs. All samples were performed in 80 ml solution containing 50 mM Tris–HCl (pH 8.0) and 5 mM MgCl2 and incubated at 37 °C. Finally, 15 U of polymerase Klenow fragment exo was added and allowed to react in 37 °C for 1 h. 2.4. Measurement of PGM signal Then, the solution obtained from isothermal circular stranddisplacement polymerization reaction was transferred into a tube and 100 mL of sucrose in Buffer A (0.5 M) was added into the system and allowed to incubate for 16 h. An amount of 5 mL obtained mixture was detected by a PGM.
Table 1 Oligonucleotides designed in the present study. Name
Sequence (5′ to 3′)
Capture DNA Target DNA One base mismatch DNA Three base mismatch DNA Primer DNA
Biotin-TTTTTTTTTTCTTGGACACAGTAAAGAGAGGTGCGCCCATTGTGTCCAAGA TCTTGGACACAGTAAAGAGAGGTGCGCCCATTGTGTCCAAGA TCTTGGACACAGTAAAGACAGGTGCGCCCATTGTGTCCAAGA TCTTGGACACAGTAAAGACTCGTGCGCCCATTGTGTCCAAGA HS-TTTTTTTTTTCTTGGAC
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
673
3. Results and discussion 3.1. Principle of the portable and sensitive quantitative detection of DNA The design principle for portable and sensitive quantitative detection of DNA is schematically described in Fig. 1. Firstly, the capture DNA was fixed onto Streptavidin-MNBs. Then target DNA (in red color) hybridized with the capture DNA and opened their loop parts, enabling a primer with DNA–invertase conjugation to attach on the stem part, which initiates a polymerization which replaced the target with the aid of the Klenow fragment of Escherichia coli DNA polymerase I (denoted as “Klenow” for short), its buffer and dNTP mixture. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA–invertase conjugation on the surface of Streptavidin-MNBs. We assumed the concentration of target DNA was proportional to the amount of DNA–invertase bound to the Streptavidin-MNBs. After the washing away of unbound target DNA and DNA–invertase conjugation, the bound DNA–invertase can be used to catalyze the hydrolysis of sucrose into glucose with millions of turnovers, which transformed the concentration of target DNA into the level of glucose for monitoring of PGM.
Fig. 2. Identification of the hybridization feature capture DNA (B and C samples contain target DNA 300 and 1000 fM, respectively).
3.2. Target hybridization with capture DNA on Streptavidin-MNBs In order to identify the hybridization feature capture DNA, three samples were prepared. Sample A was capture DNA modified onto the Streptavidin-MNBs together with detection DNA; samples B and C contained different concentration of target DNA and detection DNA. As shown in Fig. 2, the difference of signal to above three samples was obvious, which indicated the detection capability of the capture DNA and our designed method. 3.3. Optimization of experimental parameters The performance of our DNA detection method was determined by both the efficiency of target recycling process and the read out of PGM. In order to obtain an optimal performance, the temperature, the dosage of DNA polymerase, incubation time and amount of DNA–invertase conjugation were optimized. 3.3.1. Optimization of temperature The temperature has a significant effect on the performance of our proposed method, as the enzyme activity and the DNA hybridization are highly depended on the temperature. In order to get the optimum temperature, we carried out DNA detection at different temperature (15, 25, 37, 45 and 60 °C). We obtained a peak signal at 37 °C, which are showed in Fig. 1 of ESI. Therefore, 37 °C was selected for subsequent detection. 3.3.2. Optimization for the dosage of DNA polymerase DNA polymerase played a key role in the detection of DNA, which affects the efficiency of target recycling process. Therefore, the effective of dosage of DNA polymerase to the signal of PGM was investigated. As shown in Fig. 3, the signal intensity of PGM increased sharply with the increasing dosage of DNA polymerase. There was a peak at the dosage of 15U and the signal of PGM began to decrease when the dosage over than 15U. Therefore, a dosage of 15U of DNA polymerase was selected for subsequent detection.
Fig. 1. Schematic illustration of portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction.
3.3.3. Optimization of incubation time for mixture and MBs The performance of DNA detection was strongly affected by the incubation time of mixture and MBs. As shown in Fig. 4, the signal of PGM elevated gradually with the increasing of incubation time (in the presence of 100, 500 and 1000 fM target DNA) at the early stage and a maximum was obtained at 60 min. In order to obtain the best signal-to-background level, 60 min was selected as the incubation time for sequent detection.
674
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
Fig. 3. Relationship between the amount of DNA polymerase and signal. The concentration of target DNA from below to up is 100, 500 and 1000 fM target DNA.
Fig. 4. Relationship between the incubation time and signal. The concentration of target DNA from below to up is 100, 500 and 1000 fM target DNA.
3.3.4. Optimization the amount of DNA–invertase conjugation The amount of DNA–invertase conjugation can affect the performance of DNA detection method. Insufficient of DNA– invertase conjugation may lead to the decrease of sensitivity and excessive of DNA–invertase conjugation may produce a higher background. Therefore, different amount of DNA–invertase conjugation (5, 10, 50,100, 200 and 300 mL) were used for the detection of target DNA. The signals of different amount of DNA– invertase conjugation were showed in Fig. 2 of ESI. The signal increased with the increasing of DNA–invertase conjugation amount until 100 mL and there was a peak at the amount of 100 mL. When the amount of DNA–invertase conjugation was higher than 100 mL, the signal decreased slightly, which may caused by the increasing of the background signal. Therefore, an amount of 100 mL of DNA–invertase conjugation was selected for the following study.
Fig. 5. Relationship between the concentration of target DNA and signal. Condition: Each data point represents an average of 3 measurements (each error bar indicates the standard deviation).
DNA concentration and intensity of signal increased monotonically (nearly linearly) with the concentration of target DNA (As shown in Fig. 5). There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0–1000 fM. A correlation coefficient of 0.989 was obtained and the relative standard deviation (RSD) was 4.6% for a concentration of 0.5 pM target DNA (n¼ 5), which was comparable or even better than some of other reported methods. Such an attractive detection limit of our sensing strategy can be primarily attributed to three aspects: the amplification of target recycling process, the enrichment effect of Streptavidin-MNBs and the million turnovers of sucrose hydrolysis into glucose. With the aid of target recycling process, numerous capture DNA can be opened, which increased the sensitivity dramatically. Substantial target DNA and detection DNA in solution were collected onto the surface of StreptavidinMNBs and one sucrose on the detection DNA turns into millions of glucose for monitoring of PGM. 3.5. Selectivity In order to evaluate the specificity of this strategy, we then challenged our assay to different mismatched targets. As shown in Fig. 6, the signal intensity of PGM for one base mismatch DNA, three bases mismatch DNA were similar to that of black
3.4. Sensing performance for target DNA In order to evaluate the performance of our proposed method for target DNA detection, we challenged the proposed method with a series of concentrations of target DNA, covering a range of nearly 3 orders of magnitude (5.0–1000 fM). Improved signal of personal glucose meter was observed with the increase of target
Fig. 6. The signal intensity of PGM to (1) hybridization buffer, (2) single base mismatch DNA, (3) three bases mismatch DNA and (4) target DNA.
X. Xue-tao et al. / Biosensors and Bioelectronics 64 (2015) 671–675
Table 2 Recovery tests for different concentration of target DNA in human serum. Sample ID
Added value of DNA/pM
Detected/pM
Recovery/%
1 2 3
5 80 100
5.3 7 0.9 78.17 4.5 105.4 7 8.8
106.0 97.6 105.4
hybridization buffer, demonstrating that the designed assay was specific for the target DNA. 3.6. Feasibility in complex biological matrices In order to evaluate the practical application of proposed DNA detection method, we challenged it to complex biological matrixes such as serum, using the same experimental procedures as those for target DNA detection in buffer solution. Serum is what remains from whole blood after coagulation. It does not contain target DNA. The signal of PGM detected in hybridization buffer, 20% human serum and 50% human serum did not show significant difference, indicating very little interference of complex matrices on the method. Furthermore, our method was challenged to different amount of target DNA in 20% human serum for recovery tests. The results were summarized in Table 2. Satisfactory values between 97.6 and 106% were obtained for the recovery experiments, which indicated that the possible interference from the serum on the target DNA detection was negligible. The above results demonstrate that our proposed DNA detection method can be successfully applied to DNA detection in real biological samples. 3.6.1. Study of stability for target DNA detection The stability of proposed method has been investigated. There are mainly two steps in our proposed method, which are the isothermal circular strand-displacement polymerization reaction and measurement by using PGM. The stability of our sensor is determined by the stability of DNA–invertase conjugation, capture DNA coated Streptavidin-MNBs. In order to study the stability, the DNA–invertase conjugation, capture DNA coated StreptavidinMNBs are prepared and employed to the detection of target DNA after stored 7, 14 and 30 days. The results show that there are not significant differences with the fresh prepared sample (the signal is 375712.4, 366 7 13.6, 3587 16.6 and 385 715.8 mg/dL, respectively), indicating a good stability of our proposed method.
4. Conclusion In summary, a portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA– invertase conjugation on the surface of Streptavidin-MNBs. The DNA–invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. A low limit of detection was obtained owning to following reasons: the amplification of target recycling process, the enrichment effect of Streptavidin-MNBs and the million turnovers of sucrose hydrolysis into glucose. In addition, the method exhibited excellent sequence selectivity, being able to differentiate a single mismatch in the target DNA. What is more,
675
there was almost no effect of biological complex to the detection performance, which suggested that our method can be successfully applied to DNA detection in real biological samples.
Appendix A. Supplementary information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.09.094.
References Barhoumi, A., Halas, N.J., 2010. Label-free detection of DNA hybridization using surface enhanced Raman spectroscopy. J. Am. Chem. Soc. 132 (37), 12792–12793. Beissenhirtz, M.K., Elnathan, R., et al., 2007. The aggregation of Au nanoparticles by an autonomous DNA machine detects viruses. Small 3 (3), 375–379. Clark Jr., L.C., Lyons, C., 1962. Electrode systems for continuous monitoring in cardiovascular surgery. Ann. N. Y. Acad. Sci. 102, 29–45. Daar, A.S., Thorsteinsdottir, H., et al., 2002. Top ten biotechnologies for improving health in developing countries. Nat. Genet. 32 (2), 229–232. Duan, X., Liu, L., et al., 2010. Cationic conjugated polymers for optical detection of DNA methylation, lesions, and single nucleotide polymorphisms. Acc. Chem. Res. 43 (2), 260–270. Fabris, L., Dante, M., et al., 2007. A heterogeneous PNA-based SERS method for DNA detection. J. Am. Chem. Soc. 129 (19), 6086–6087. Guo, Q., Yang, X., et al., 2009. Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction. Nucleic Acids Res. 37 (3), e20. He, J.L., Wu, Z.S., et al., 2010. Fluorescence aptameric sensor for strand displacement amplification detection of cocaine. Anal. Chem. 82 (4), 1358–1364. Hong, M., Zhou, X., et al., 2009. Nanoparticle-based, fluorous-tag-driven DNA detection. Angew. Chem. Int. Ed. Engl. 48 (50), 9503–9506. Li, J., Deng, T., et al., 2010. Rolling circle amplification combined with gold nanoparticle aggregates for highly sensitive identification of single-nucleotide polymorphisms. Anal. Chem. 82 (7), 2811–2816. Montagnana, M., Caputo, M., et al., 2009. Overview on self-monitoring of blood glucose. Clin. Chim. Acta 402 (1–2), 7–13. Nakayama, S., Sintim, H.O., 2009. Colorimetric split G-quadruplex probes for nucleic acid sensing: improving reconstituted DNAzyme's catalytic efficiency via probe remodeling. J. Am. Chem. Soc. 131 (29), 10320–10333. Nakayama, S., Yan, L., et al., 2008. Junction probes-sequence specific detection of nucleic acids via template enhanced hybridization processes. J. Am. Chem. Soc. 130 (38), 12560–12561. Ren, R., Leng, C., et al., 2010. Detection of DNA and indirect detection of tumor cells based on circular strand-replacement DNA polymerization on electrode. Chem. Commun. (Camb.) 46 (31), 5758–5760. Rosi, N.L., Giljohann, D.A., et al., 2006. Oligonucleotide-modified gold nanoparticles for intracellular gene regulation. Science 312 (5776), 1027–1030. Saiki, R.K., Scharf, S., et al., 1985. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230 (4732), 1350–1354. Stoeva, S.I., Lee, J.S., et al., 2006. Multiplexed DNA detection with biobarcoded nanoparticle probes. Angew. Chem. Int. Ed. Engl. 45 (20), 3303–3306. Weizmann, Y., Beissenhirtz, M.K., et al., 2006. A virus spotlighted by an autonomous DNA machine. Angew. Chem. Int. Ed. Engl. 45 (44), 7384–7388. Weizmann, Y., Cheglakov, Z., et al., 2006. Autonomous fueled mechanical replication of nucleic acid templates for the amplified optical detection of DNA. Angew. Chem. Int. Ed. Engl. 45 (14), 2238–2242. Wu, Z., Wang, H., et al., 2011. Terminal protection of small molecule-linked DNA: A versatile biosensor platform for protein binding and gene typing assay. Anal. Chem. 83 (8), 3104–3111. Xia, F., White, R.J., et al., 2010. An electrochemical supersandwich assay for sensitive and selective DNA detection in complex matrices. J. Am. Chem. Soc. 132 (41), 14346–14348. Xiang, Y., Lu, Y., 2011. Using personal glucose meters and functional DNA sensors to quantify a variety of analytical targets. Nat. Chem. 3 (9), 697–703. Xiang, Y., Lu, Y., 2012. Using commercially available personal glucose meters for portable quantification of DNA. Anal. Chem. 84 (4), 1975–1980. Zhang, Y., Wang, Y., et al., 2009. Electrochemical DNA biosensor based on the proximity-dependent surface hybridization assay. Anal. Chem. 81 (5), 1982–1987. Zhu, S., Liu, Z., et al., 2011. Nucleic acid detection using single-walled carbon nanohorns as a fluorescent sensing platform. Chem. Commun. (Camb.) 47 (21), 6099–6101.