- Email: [email protected]
Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring
Accepted Manuscript Title: Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring Authors: Han-xiao Liu, Li-fang Hou, Ting Chen, Wen Qu, Sha Liu, Hui-yi Yan, Xiao Wen, Jie Ping PII: DOI: Reference:
S0890-6238(17)30284-8 https://doi.org/10.1016/j.reprotox.2017.10.006 RTX 7597
To appear in:
Reproductive Toxicology
Received date: Revised date: Accepted date:
30-5-2017 19-9-2017 17-10-2017
Please cite this article as: Liu Han-xiao, Hou Li-fang, Chen Ting, Qu Wen, Liu Sha, Yan Hui-yi, Wen Xiao, Ping Jie.Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring.Reproductive Toxicology https://doi.org/10.1016/j.reprotox.2017.10.006 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title page
Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring
Han-xiao Liu 1, Li-fang Hou 1, Ting Chen, Wen Qu, Sha Liu, Hui-yi Yan, Xiao Wen, Jie Ping*
Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071, China; [email protected]
*Corresponding author: Jie Ping Address: 185, East Lake Road, Wuhan 430071, China. Tel.: +86 27 6875 9310. Fax: +86 27 8733 1670. E-mail: [email protected] 1
These authors contributed equally to this work.
Highlights:
PCI increased expression of lung structure-associated genes in offspring
Upregulation of structural genes contributes to pulmonary interstitial thickness
Destroyed lung structure results in susceptibility of offspring to inflammation
Abstract: This study aimed to investigate the association between prenatal caffeine
1
ingestion (PCI) and risk of postnatal pulmonary inflammation. Pregnant Wistar rats were administered 60 mg/kg/d caffeine intragastrically from gestational day (GD) 7 to GD 20. The results showed that PCI obviously increased intrauterine growth retardation rate to 39.2% and suppressed weight growth of the offspring. PCI also enhanced the expression of transforming growth factor β, α-smooth muscle actin, interleukin (IL)-1β, and IL-8 in lungs and caused pulmonary interstitial thickening in the offspring. Further, with lipopolysaccharide stimulation on postnatal day 77, PCI offspring showed more serious inflammatory infiltration, higher injury scores, and higher levels of IL-6 and tumor necrosis factor-α in lungs than those of the control. Our findings showed, for the first time, that PCI is a certainly threat to postnatal pulmonary inflammation. The potential mechanism is that PCI alter the expression of pulmonary interstitial thickening-associated genes in the offspring. Keywords: prenatal caffeine ingestion; IUGR; pulmonary inflammation; pulmonary interstitial thickness; IL-6; TNF-α
1 Introduction1 Pulmonary inflammation has been regarded as the “captain of the men of death” by William Osler. Although survival improved with the introduction of antibiotics and vaccines in the 20th century, pulmonary inflammation remains affect approximately
Abbreviations: PCI, prenatal caffeine ingestion; IUGR, intrauterine growth retardation; LPS, lipopolysaccharide; GD, gestational day; PND, postnatal day; HE, hematoxylin and eosin; GAPDH, glyceraldehyde phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; TGF, transforming growth factor. 2
450 million people globally (7% of the population) and results in about 4 million deaths per year [1-3]. The susceptibility to pulmonary inflammation depends partly on abnormal structural programming during lung development. Embryo period is critical for lung organogenesis and development, in which the intrauterine environment plays an essential role in regulating the structural programming of the lungs [4]. Fetal exposure to adverse intrauterine factors could attenuate lung development, and the associated structural alterations could persist into adulthood, which may predispose the offspring to later pulmonary inflammation [1, 5]. Caffeine, widely found in coffee, tea, soft beverages, food and some analgesic drugs, is consumed commonly by all age groups, including pregnant women [6, 7]. Caffeine can cross placenta freely, distribute in the fetal circulation, and lead to abnormal intrauterine environment in several ways [8, 9]. Data from our previous studies and other groups showed that prenatal caffeine ingestion (PCI) could cause intrauterine growth retardation (IUGR) in rats, and the IUGR offspring exhibited inhibited weight growth and abnormal development of multiple organs [6, 10, 11]. In addition, clinical and experimental studies reported that IUGR offspring are prone to develop pulmonary inflammation in later life [12, 13]. Therefore, we speculated that PCI could potentiate the susceptibility to pulmonary inflammation in adult offspring. The PCI rat model was established in this study to investigate the association between PCI and adult pulmonary inflammation in the offspring. IUGR rate, postnatal weight growth, pulmonary interstitial thickening, and the interstitial thickening-related gene expression in the offspring were analyzed. Further, after lipopolysaccharide (LPS) 3
stimulation, the production of critical pro-inflammatory cytokines in the offspring was determined. This work will be beneficial in elucidating the developmental toxicity of caffeine and in explaining the susceptibility to adult pulmonary inflammation in PCIinduced IUGR offspring. 2 Materials and methods 2.1 Chemicals and reagents. Caffeine was obtained from Sigma-Aldrich Co., Ltd. (St Louis, MO, USA). Trizol was purchased from Life Technologies (Gaithersburg, MD, USA). Reverse transcription and RT-qPCR kits were supplied by TaKaRa Biotechnology (Dalian, Liaoning, China). All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). IL-6 and TNF-α ELISA kits was purchased from eBioscience (San Diego, USA). All chemicals and reagents were analytical grade. 2.2 Animals and treatments. Wistar female rats weighing 180-220g and male rats weighing 260-300g were purchased from the Experimental Center of the Hubei Medical Scientific Academy (No. 2008-0005, Hubei, China). Rats were maintained under specific pathogen-free conditions in the Center for Animal Experimentation of Wuhan University (Wuhan, Hubei, China), which has been accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC). All animal protocols were prepared according to the Guidelines for Animal Research and approved by the Ethical and Research Committee of Medical College of Wuhan University. After a one-week acclimation period, 2 females were placed with one male in a 4
cage overnight for mating. The day was declared as gestational day (GD) 0 if a vaginal smear with sperm cells was observed. The pregnant rats were randomized into two groups. From GD 7 to GD 20, the rats in caffeine group were intragastrically administered caffeine 60 mg/kg/d. Control rats were administered with the same volume of saline. After the pregnant rats delivered naturally (Postnatal day (PND) 0), pups were weighed and normalized to 8 pups per litter to assure adequate and standardized nutrition. The IUGR rate was diagnosed when the animal had a body weight of less than the mean body weight minus 2 standard deviations of the control group. Then the pups were weaned on PND 21. The female offspring were then normally fed until PND 77. Body weight was recorded weekly, and the corresponding body weight growth rate was calculated as follows: Body weight growth rate (%) = [(body weight of postnatal week x − body weight of postnatal week 1)]/body weight of postnatal week 1× 100%. On PND 77, half of the female offspring (8-10 rats per group) were stimulated by LPS for 2 hours, and then sacrificed to collect lung samples. Lungs of 3 offspring per group were randomly selected and fixed in phosphate-buffered 10% neutral formalin solution for histological examination. The lungs of others were immediately frozen in liquid nitrogen, and then stored at -80 °C for further analysis. 2.3 Histological examination. The fixed pulmonary tissues were dehydrated and then processed via the paraffin slice technique. Sections approximately 4 μm thick were stained with hematoxylin and eosin (HE) and observed under light microscope (100×, Olympus BX-53 Tokyo, Japan). Based on inflammatory infiltration and hemorrhage, pathological-injury scoring was 5
performed according to a previously reported criteria [14]: 0 for no inflammation infiltration and hemorrhage, 1 for it in 25% of the field, 2 for it in 50% of the field, 3 for it in 75% of the field, and 4 for it throughout the field. 3 visions of each section were randomly chosen, and the scores were summed for calculating the total score. 2.4 Real-time PCR analysis. Total RNA was isolated from pulmonary tissues using TRIzol reagent according to the manufacturer's protocol. The concentration and purity of the RNA samples were assessed by spectrophotometric analysis, and the RNA concentration was adjusted to 1μg/μl. Single-strand cDNA was synthesized using the reverse transcription kit. PCR assays were conducted in 96-well optical reaction plates using the QuantStudio 6 Flex from Applied Biosystems (Foster City, CA, USA) in a total volume of 20 μl reaction mixture containing: 1 μl of cDNA template, 0.4 μl of 10μM each primer, 10 μl of 2 × SYBRGreen, 0.4 μl of ROX and 7.8μl of DEPC-H2O. The cycling conditions were as follows: pre-denaturation, 95 °C for 30 s; denaturation, 95 °C for 10 s; annealing, 60 °C for 30 s; 40 cycles. Relative mRNA expression was calculated by ΔΔCt method using glyceraldehyde phosphate dehydrogenase (GAPDH) as the reference gene. The primer sequences were listed in Table 1. 2.5 ELISA assay for pulmonary interleukin (IL)-6 and tumor necrosis factor (TNF)α) detection. Pulmonary tissues were homogenized using a tissue rotator in phosphate buffer solution. The homogenates were centrifuged at 3000 × rpm at 4 °C for 15 min. The supernatants were collected for IL-6 and TNF-α analysis by ELISA assay kits following 6
the manufacturer's protocol. 2.6 Statistical analysis. SPSS 17 (SPSS Science Inc., Chicago, Illinois) was used for data analyses. All measurement data were expressed as the mean ± SEM and evaluated with Student's t test or with two-factor analysis of variance as appropriate. Values of p < 0.05 were considered statistically significant. 3 Results 3.1 PCI induced IUGR. PCI significantly increased the IUGR rate to 39.2% (p < 0.01, Figure 1 A) on PND 0. Body weight is an important index for offspring development. The results showed that the body weight of female offspring in PCI group was clearly lower than that of the control from PND 0 to PND 77 (p < 0.05, Figure 1B), but the growth rates of PCI offspring were higher compared with the control (p < 0.05, Figure 1C). In addition, the body weight of PCI offspring with or without IUGR was analyzed and compared separately with the control offspring. The results showed that the PCI offspring with IUGR showed a significantly lower body weight and higher weight growth rate, as compared to the control offspring (p < 0.05, Figures 1D and E). The PCI offspring without IUGR also exhibited reduced body weight and increased weight growth rate, but the difference was not significant (Figures 1F and G). Although the growth rate was higher in rats with IUGR, the weight of PCI offspring with IUGR was still clearly lower than both the weight of control offspring and the weight of PCI offspring without IUGR at PND 77. 7
3.2 PCI induced histological changes in offspring lungs. HE staining revealed that PCI caused histological changes in the lungs of the offspring on PND 77 before LPS stimulation. As compared with the control (Figure 2A), thickened alveoli septum with increased pulmonary interstitium were observed in lungs of PCI offspring (Figure 2B). The histological changes were then semiquantitatively analyzed by pathological-injury scoring, which also showed higher injury scores in PCI group (p < 0.05, Figure 2E). To investigate the effects of PCI on pulmonary inflammation development, we further established acute inflammatory model with LPS and demonstrated evident inflammatory injuries characterized by the presence of interstitial edema, hemorrhage, thickening of the alveolar wall, decreased alveoli number, and inflammatory cell infiltration in the lungs of both control (Figure 2C) and PCI offspring (Figure 2D). Following LPS stimulation, offspring in both groups also exhibited increased pathological-injury scoring in lungs. In addition, as compared to the control, PCI offspring exhibited more severe inflammatory changes (more hemorrhage and inflammatory cell infiltration, much greater thickening of the alveolar wall, and more obvious decrease of the alveoli number) in lungs. The results from pathological-injury scoring also showed more serious inflammation in PCI offspring than control (p < 0.05, Figure 2E). 3.3 PCI altered gene expression of structural cytokines in offspring lungs. According to the HE staining results, the mRNA expression levels of transforming growth factor (TGF-β), α-smooth muscle actin (α-SMA), IL-8, and IL-1β, which were related to pulmonary interstitial thickness, were detected. Consistent with the HE 8
staining results, before LPS stimulation, the expression levels of IL-1β, IL-8, TGF-β, and α-SMA were obviously increased in PCI offspring as compared with the control (p < 0.05, Figure 3A). Following LPS stimulation, comparatively more increases of the expression of those genes were observed in control offspring than those of the PCI offspring. Additionally, there were higher expression of IL-1β (p < 0.05, Figure 3 B), lower expression of IL-8 and TGF-β (p < 0.05, Figure 3B), and similar expression of α-SMA in PCI offspring as compared with the control. IL-6 and TNF-α were thought as the two major cytokines mediating pulmonary inflammation development. The expression levels of IL-6 and TNF-α in lungs were also detected. The results showed that PCI offspring exhibited higher expression levels of TNF-α and IL-6 in lungs both before and after LPS stimulation, as compared to the control offspring, but the difference was not significant (Figures 3A and B). 3.4 PCI increased inflammatory cytokine production in offspring lungs. The production of IL-6 and TNF-α were widely used for diagnosis of the LPSinduced inflammation. To explore the effect of PCI on the production of inflammatory cytokines, we further determined the levels of IL-6 and TNF-α in lungs of the offspring on PND 77. Before LPS stimulation, there were no statistical difference in pulmonary contents of IL-6 and TNF-α between PCI offspring and control (Figures 4 A and B). Following LPS stimulation, offspring in both groups exhibited increased production of IL-6 and TNF-α in lungs. The IL-6 and TNF-α concentrations of PCI offspring were obviously higher than that of the control (p < 0.05 Figures 4 A and B). 4 Discussion 9
In our previous studies, different doses of caffeine (20, 60 and 180 mg/kg/d) were used to establish IUGR rat model and revealed a clear dose-dependent effects of PCI on adverse fetal development-related parameters [15, 16]. To achieve the typical IUGR model and to avoid excessive numbers of absorbed or stillborn fetuses, the middle dose of 60 mg/kg/d caffeine was chosen in this study. According to the World Health Organization, caffeine intake of 300 mg/d (5 mg/kg/d) in pregnant women was associated with increased risk for IUGR [17]. Using the dose conversion between human and rat (1:6.17) [18], the dose of 5 mg/kg/d in human is equivalent to 31 mg/kg/d caffeine in rats. The 60 mg/kg/d caffeine used in this study is higher than 31 mg/kg/d but less than the lowest dose usually needed to induce malformations in rats (80 mg/kg/d) [19]. Therefore, the dose of caffeine used in this study should be reasonable. In fact, no resorbed fetuses and miscarriage have been observed in the present study. LPS, which is widely used to achieve the acute pulmonary inflammation model, could induce pulmonary injury rapidly [20-23]. Hence, rats were scarified 2 h after LPS stimulation on PND 77 (adulthood in rats) in this study. It was reported that respiratory inflammation was associated with more deleterious pathological damage, higher expression of inflammatory markers, and higher recruitment of cells in females than in males [24, 25]. Because Female X-chromosome mosaicism for inflammatory gene expression could contribute to the responses to LPS, the females are more sensitive to LPS stimulation [26]. Therefore, female offspring were used in this study. In a number of studies, pulmonary inflammation induced by LPS was mainly featured with destroyed alveolar structure, thickened pulmonary interstitium, and the infiltration of 10
inflammatory cells [27-29]. The severity of these morphologic injuries is used as a key indicator to measure the inflammation degree in lung [30]. In the present study, PCI offspring following LPS stimulation displayed more evident inflammatory injuries and higher injury scores, indicating a more serious pulmonary inflammation in PCI offspring than control. In addition to the morphologic injuries, the production of IL-6 and TNF-α, which are known as the main two pulmonary inflammatory mediators, were also widely used as a “gold standard” for diagnosis of the LPS-induced inflammation [28-30]. Peters MC et.al and van der Poll et.al reported that IL-6 plays a role in regulating poor pulmonary condition and is essential during pulmonary inflammation development [31, 32]. In addition, TNF-α is known to mediate the acute phase reaction, which is critical for LPS-caused immune responses [33]. Our pre-experiments showed that the concentrations of IL-6 and TNF-α in serum before and after stimulation were both below the detection limit of the ELISA kits (IL-6: 31.0 pg/ml; TNF-α: 39.1 pg/ml). Thus, the levels of IL-6 and TNF-α were only detected in lungs. Although no apparent statistic difference in pulmonary IL-6 and TNF-α mRNA expression between PCI and control groups was observed before and after LPS stimulation, PCI significantly augmented the contents of IL-6 and TNF-α in lungs, as compared with control. These findings further confirmed that the pulmonary inflammation was more severe in PCI offspring with LPS stimulation than control. In the present study, IUGR rate was obviously increased in PCI group. The offspring with IUGR exhibited low body weight and high growth rate until adulthood, which, based on the findings of our and other groups, is closely related to altered 11
development pattern of multiple organs functionally and structurally [34-37]. IUGR has already been linked to poor pulmonary structure, which in turn increase risk of inflammation [38]. In human, clinical studies have established a clear connection between changes of pulmonary structure and pulmonary inflammatory diseases. Pulmonary interstitial thickness is a definite trigger of usual interstitial pneumonia, nonspecific interstitial pneumonia, centrilobular emphysema, pulmonary inflammatory fibrosis, chronic obstructive pulmonary disease, and asthma [39-44]. The experimental studies further confirmed that the pulmonary interstitial thickness and the alveolar destruction could potentiate the susceptibility of pulmonary inflammation [45]. In this study, HE staining revealed that PCI could cause pulmonary interstitial thickness before LPS stimulation, indicating a pulmonary inflammation-predisposing structure in PCI offspring. TGF-β is known as a key mediator in augmenting the pulmonary interstitium through induction of fibrillogenesis [46]. Studies reported that over-expression of the TGF-β gene or enhanced protein expression of TGF-β could increase Smad2/3 and p38 MAPK signaling in pulmonary arterial smooth muscle cells, and induce fibrotic activity of muscle cells and the associated pulmonary thickening [47-49]. The expression of αSMA plays a critical role in developmental changes of airway wall structure by promoting smooth muscle proliferation [50]. During airway wall remodeling, two proinflammatory cytokines, the IL-8 and the IL1-β, are known to the potent promoter of inflammatory hyperplasia [51, 52]. The enhanced expression levels of IL-8 and IL1β could induce angiogenesis in lungs, which in turn caused pulmonary thickening and 12
inflammatory infiltration [53, 54]. Moreover, researchers reported that the increase in the expression of TGF-β, α-SMA, IL1-β, and IL-8 could result in chronic airway thickening [46, 55-57]. In the present study, before stimulation, the expression levels of TGF-β, α-SMA, IL1-β, and IL-8 in lungs of PCI offspring were clearly higher than that of control. These findings provided a potential mechanism of PCI-induced pulmonary inflammation susceptibility, which is that PCI caused structural changes in lung through upregulating the expression of remodeling-associated genes. It was reported that the expression of these genes are regulated by the DNA methylation modification at the level of transcription [58-60]. Our previous studies demonstrated that PCI can change the expression of DNA methyltransferase and the DNA methylation patterns of multiple genes during fetal development [10, 11]. Hence, DNA methylation mechanism may be involved in PCI induced changes of the remodeling-associated gene expression. In addition, both human and animal studies reported that prenatal abnormal environment exposure may cause structural (altered lung development) and functional (skewed immune development) changes, which may predispose the offspring to inflammatory stimulation [5]. It is well known that caffeine has definitely immunosuppressive effect [61]. Hence, PCI induced immune skewing might also be potentially involved in the susceptibility of PCI offspring to LPS stimulation.
5 Conclusion Our study showed, for the first time, that PCI contributed to the increased risk of pulmonary inflammation in the adult female offspring and the underlying mechanism 13
may involve the enhanced expression of the pulmonary interstitial thickeningassociated genes. This study provided evidence for exploring the fetal origin of pulmonary destruction and pulmonary inflammation susceptibility for caffeine-induced IUGR offspring. Further analysis will be needed to explore the molecular mechanisms of the effects of caffeine on TGF-β and α-SMA expression in IUGR offspring. Conflicts of Interest: The authors declare no conflict of interest. Acknowledgments: This work was supported by Grants from the National Natural Science Foundation of China (No. 81673215, 81273107), the Outstanding Youth Science Fund of Hubei Province (No. 2012FFA017), and the Applied Fundamental Research Project of Wuhan (No. 2017060201010199).
References [1] O. Ruuskanen, E. Lahti, L.C. Jennings, D.R. Murdoch, Viral pneumonia, Lancet, 377 (2011) 1264-1275. [2] R. Lodha, S.K. Kabra, R.M. Pandey, Antibiotics for community-acquired pneumonia in children, Cochrane Database Syst Rev, (2013) CD004874. [3] G.B. Nair, M.S. Niederman, Community-acquired pneumonia: an unfinished battle, Med Clin North Am, 95 (2011) 1143-1161. [4] R. Harding, M.L. Cock, S. Louey, B.J. Joyce, M.G. Davey, C.A. Albuquerque, S.B. Hooper, G.S. Maritz, The compromised intra-uterine environment: implications for future lung health, Clin Exp Pharmacol Physiol, 27 (2000) 965-974. [5] D.I. Suh, H.Y. Chang, E. Lee, S.I. Yang, S.J. Hong, Prenatal Maternal Distress and Allergic Diseases in Offspring: Review of Evidence and Possible Pathways, Allergy Asthma Immunol Res, 9 (2017) 200-211. [6] V. Sengpiel, E. Elind, J. Bacelis, S. Nilsson, J. Grove, R. Myhre, M. Haugen, H.M. Meltzer, J. Alexander, B. Jacobsson, A.L. Brantsaeter, Maternal caffeine intake during pregnancy is associated with birth weight but not with gestational length: results from a large prospective observational cohort study, BMC Med, 11 (2013) 42. [7] M.A. Heckman, J. Weil, E. Gonzalez de Mejia, Caffeine (1, 3, 7-trimethylxanthine) in foods: a comprehensive review on consumption, functionality, safety, and regulatory matters, J Food Sci, 75 (2010) R77-87. 14
[8] R. Wierzejska, M. Jarosz, M. Siuba, W. Sawicki, Comparison of maternal and fetal blood levels of caffeine and its metabolite. A pilot study, Ginekol Pol, 85 (2014) 500-503. [9] D.C. Greenwood, N.J. Thatcher, J. Ye, L. Garrard, G. Keogh, L.G. King, J.E. Cade, Caffeine intake during pregnancy and adverse birth outcomes: a systematic review and dose-response metaanalysis, Eur J Epidemiol, 29 (2014) 725-734. [10] D.M. Wu, Z. He, L.P. Ma, L.L. Wang, J. Ping, H. Wang, Increased DNA methylation of scavenger receptor class B type I contributes to inhibitory effects of prenatal caffeine ingestion on cholesterol uptake and steroidogenesis in fetal adrenals, Toxicol Appl Pharmacol, 285 (2015) 8997. [11] J. Ping, J.F. Wang, L. Liu, Y.E. Yan, F. Liu, Y.Y. Lei, H. Wang, Prenatal caffeine ingestion induces aberrant DNA methylation and histone acetylation of steroidogenic factor 1 and inhibits fetal adrenal steroidogenesis, Toxicology, 321 (2014) 53-61. [12] A. Sasi, V. Abraham, M. Davies-Tuck, G.R. Polglase, G. Jenkin, S.L. Miller, A. Malhotra, Impact of intrauterine growth restriction on preterm lung disease, Acta Paediatr, 104 (2015) e552556. [13] D. Wignarajah, M.L. Cock, K.E. Pinkerton, R. Harding, Influence of intrauterine growth restriction on airway development in fetal and postnatal sheep, Pediatr Res, 51 (2002) 681-688. [14] K.M. Smith, J.D. Mrozek, S.C. Simonton, D.R. Bing, P.A. Meyers, J.E. Connett, M.C. Mammel, Prolonged partial liquid ventilation using conventional and high-frequency ventilatory techniques: gas exchange and lung pathology in an animal model of respiratory distress syndrome, Crit Care Med, 25 (1997) 1888-1897. [15] Y. Liu, D. Xu, J. Feng, H. Kou, G. Liang, H. Yu, X. He, B. Zhang, L. Chen, J. Magdalou, H. Wang, Fetal rat metabonome alteration by prenatal caffeine ingestion probably due to the increased circulatory glucocorticoid level and altered peripheral glucose and lipid metabolic pathways, Toxicol Appl Pharmacol, 262 (2012) 205-216. [16] D. Xu, B. Zhang, G. Liang, J. Ping, H. Kou, X. Li, J. Xiong, D. Hu, L. Chen, J. Magdalou, H. Wang, Caffeine-induced activated glucocorticoid metabolism in the hippocampus causes hypothalamic-pituitary-adrenal axis inhibition in fetal rats, PloS one, 7 (2012) e44497. [17] J.J. Guilbert, The world health report 2002 - reducing risks, promoting healthy life, Educ Health, 16 (2003) 230. [18] S. Reagan-Shaw, M. Nihal, N. Ahmad, Dose translation from animal to human studies revisited, FASEB J, 22 (2008) 659-661. [19] A. Nehlig, G. Debry, Potential teratogenic and neurodevelopmental consequences of coffee and caffeine exposure: a review on human and animal data, Neurotoxicol Teratol, 16 (1994) 531-543. [20] M. Zeng, W. Sang, S. Chen, R. Chen, H. Zhang, F. Xue, Z. Li, Y. Liu, Y. Gong, H. Zhang, X. Kong, 4-PBA inhibits LPS-induced inflammation through regulating ER stress and autophagy in acute lung injury models, Toxicol Lett, 271 (2017) 26-37. [21] J.M. Lee, C.D. Yeo, H.Y. Lee, C.K. Rhee, I.K. Kim, D.G. Lee, S.H. Lee, J.W. Kim, Inhibition of neutrophil elastase contributes to attenuation of lipopolysaccharide-induced acute lung injury during neutropenia recovery in mice, J Anesth, (2017). [22] N. Li, Y. Song, W. Zhao, T. Han, S. Lin, O. Ramirez, L. Liang, Small interfering RNA targeting NF-kappaB attenuates lipopolysaccharide-induced acute lung injury in rats, BMC Physiol, 16 (2016) 7. [23] Y. Zhang, H. Liu, J. Yao, Y. Huang, S. Qin, Z. Sun, Y. Xu, S. Wan, H. Cheng, C. Li, X. Zhang, 15
Y. Ke, Manipulating the air-filled zebrafish swim bladder as a neutrophilic inflammation model for acute lung injury, Cell Death Dis, 7 (2016) e2470. [24] W.Q. Gan, S.F. Man, D.S. Postma, P. Camp, D.D. Sin, Female smokers beyond the perimenopausal period are at increased risk of chronic obstructive pulmonary disease: a systematic review and meta-analysis, Respir Res, 7 (2006) 52. [25] G.J. Casimir, N. Lefevre, F. Corazza, J. Duchateau, Sex and inflammation in respiratory diseases: a clinical viewpoint, Biol Sex Differ, 4 (2013) 16. [26] R. Chandra, S. Federici, G. Hasko, E.A. Deitch, Z. Spolarics, Female X-chromosome mosaicism for gp91phox expression diversifies leukocyte responses during endotoxemia, Crit Care Med, 38 (2010) 2003-2010. [27] X. Niu, F. Liu, W. Li, W. Zhi, H. Zhang, X. Wang, Z. He, Cavidine Ameliorates Lipopolysaccharide-Induced Acute Lung Injury via NF-kappaB Signaling Pathway in vivo and in vitro, Inflammation, (2017). [28] G. Zhu, X. Xin, Y. Liu, Y. Huang, K. Li, C. Wu, Geraniin attenuates LPS-induced acute lung injury via inhibiting NF-kappaB and activating Nrf2 signaling pathways, Oncotarget, 8 (2017) 22835-22841. [29] L. Shao, D. Meng, F. Yang, H. Song, D. Tang, Irisin-mediated protective effect on LPS-induced acute lung injury via suppressing inflammation and apoptosis of alveolar epithelial cells, Biochem Biophys Res Commun, 487 (2017) 194-200. [30] X. Chen, X. Zhang, J. Zhang, Y. Gao, Z. Yang, S. Li, H. Dai, Attenuation of acute lung injury in a rat model by Semen Cassiae, BMC Complement Altern Med, 17 (2017) 234. [31] T. van der Poll, C.V. Keogh, X. Guirao, W.A. Buurman, M. Kopf, S.F. Lowry, Interleukin-6 gene-deficient mice show impaired defense against pneumococcal pneumonia, J Infect Dis, 176 (1997) 439-444. [32] M.C. Peters, K.W. McGrath, G.A. Hawkins, A.T. Hastie, B.D. Levy, D.T. Mauger, S.A. Comhair, S.C. Erzurum, M.W. Johansson, N.N. Jarjour, A.M. Coverstone, M. Castro, F. Holguin, S.E. Wenzel, P.G. Woodruff, E.R. Bleecker, J.V. Fahy, L. National Heart, P. Blood Institute Severe Asthma Research, Plasma interleukin-6 concentrations, metabolic dysfunction, and asthma severity: a cross-sectional analysis of two cohorts, Lancet Respir Med, 4 (2016) 574-584. [33] V.V. Novochadov, D.M. Frolov, A.I. Shchyogolev, Characteristics of Lung Injury in Rats after Inhalation of Ultradisperse Bacterial LPS in Lipophilic and Hydrophilic Phases, Bull Exp Biol Med, 159 (2015) 438-442. [34] S.U. Devaskar, A. Chu, Intrauterine Growth Restriction: Hungry for an Answer, Physiology (Bethesda), 31 (2016) 131-146. [35] A.R.A. McDougall, V. Wiradjaja, A. Azhan, A. Li, N. Hale, M.E. Wlodek, S.B. Hooper, M.J. Wallace, M. Tolcos, Intrauterine Growth Restriction Alters the Postnatal Development of the Rat Cerebellum, Dev Neurosci, (2017). [36] C. Zhang, D. Xu, H. Luo, J. Lu, L. Liu, J. Ping, H. Wang, Prenatal xenobiotic exposure and intrauterine hypothalamus-pituitary-adrenal axis programming alteration, Toxicology, 325 (2014) 74-84. [37] J. Fan, W.X. Zhang, Y.S. Rao, J.L. Xue, F.F. Wang, L. Zhang, Y.E. Yan, Perinatal Nicotine Exposure Increases Obesity Susceptibility in Adult Male Rat Offspring by Altering Early Adipogenesis, Endocrinology, 157 (2016) 4276-4286. [38] M.A. Alcazar, K. Dinger, E. Rother, I. Ostreicher, C. Vohlen, C. Plank, J. Dotsch, Prevention 16
of early postnatal hyperalimentation protects against activation of transforming growth factorbeta/bone morphogenetic protein and interleukin-6 signaling in rat lungs after intrauterine growth restriction, J Nutr, 144 (2014) 1943-1951. [39] C.A. Yi, K.S. Lee, J. Han, M.P. Chung, M.J. Chung, K.M. Shin, 3-T MRI for differentiating inflammation- and fibrosis-predominant lesions of usual and nonspecific interstitial pneumonia: comparison study with pathologic correlation, AJR Am J Roentgenol, 190 (2008) 878-885. [40] T. Fujimoto, T. Matsumoto, S. Shoji, Disorganizing-fibrosing processes in alveolar walls of interstitial pneumonia, "alveolopneumonitis": a morphopathological study, Tohoku J Exp Med, 158 (1989) 237-251. [41] A. Ciledag, B. Cirit Kocer, N. Kokturk, A. Kaya, G. Celik, N. Numanoglu, A rare cause of interstitial lung disease: Hermansky-Pudlak syndrome, Tuberk Toraks, 59 (2011) 85-88. [42] S. Glaser, R. Meyer, C.F. Opitz, R. Hetzer, R. Ewert, Pulmonary interstitial and vascular abnormalities following cardiac transplantation, Transplant Proc, 40 (2008) 3585-3589. [43] M.J. Kang, C.M. Yoon, B.H. Kim, C.M. Lee, Y. Zhou, M. Sauler, R. Homer, A. Dhamija, D. Boffa, A.P. West, G.S. Shadel, J.P. Ting, J.R. Tedrow, N. Kaminski, W.J. Kim, C.G. Lee, Y.M. Oh, J.A. Elias, Suppression of NLRX1 in chronic obstructive pulmonary disease, The Journal of clinical investigation, 125 (2015) 2458-2462. [44] J.C. Hogg, The pathology of asthma, APMIS, 105 (1997) 735-745. [45] Q. Deng, J. Zhang, Y. Gao, X. She, Y. Wang, Y. Wang, X. Ge, MLN4924 protects against bleomycin-induced pulmonary fibrosis by inhibiting the early inflammatory process, Am J Transl Res, 9 (2017) 1810-1821. [46] D.M. Brass, I.V. Yang, M.P. Kennedy, G.S. Whitehead, H. Rutledge, L.H. Burch, D.A. Schwartz, Fibroproliferation in LPS-induced airway remodeling and bleomycin-induced fibrosis share common patterns of gene expression, Immunogenetics, 60 (2008) 353-369. [47] P. Dalvi, H. Sharma, T. Konstantinova, M. Sanderson, A.O. Brien-Ladner, N.K. Dhillon, Hyperactive TGF-beta Signaling in Smooth Muscle Cells Exposed to HIV-protein(s) and Cocaine: Role in Pulmonary Vasculopathy, Scientific reports, 7 (2017) 10433. [48] E. Bouros, E. Filidou, K. Arvanitidis, D. Mikroulis, P. Steiropoulos, G. Bamias, D. Bouros, G. Kolios, Lung fibrosis-associated soluble mediators and bronchoalveolar lavage from idiopathic pulmonary fibrosis patients promote the expression of fibrogenic factors in subepithelial lung myofibroblasts, Pulm Pharmacol Ther, (2017). [49] S.A. Papiris, I.P. Tomos, A. Karakatsani, A. Spathis, I. Korbila, A. Analitis, L. Kolilekas, K. Kagouridis, S. Loukides, P. Karakitsos, E.D. Manali, High levels of IL-6 and IL-8 characterize early-on idiopathic pulmonary fibrosis acute exacerbations, Cytokine, (2017). [50] T. Yamada, E. Suzuki, F. Gejyo, T. Ushiki, Developmental changes in the structure of the rat fetal lung, with special reference to the airway smooth muscle and vasculature, Arch Histol Cytol, 65 (2002) 55-69. [51] L. Keglowich, M. Roth, M. Philippova, T. Resink, G. Tjin, B. Oliver, D. Lardinois, S. DessusBabus, R. Gosens, K. Hostettler Haack, M. Tamm, P. Borger, Bronchial smooth muscle cells of asthmatics promote angiogenesis through elevated secretion of CXC-chemokines (ENA-78, GROalpha, and IL-8), PloS one, 8 (2013) e81494. [52] C. Tefe-Silva, C.T. Beneli, M.R. Celes, E.R. Machado, M.T. Ueta, C.A. Sorgi, E.M. Floriano, L.H. Faccioli, S.G. Ramos, Dexamethasone reduces bronchial wall remodeling during pulmonary migration of Strongyloides venezuelensis larvae in rats, Parasitol Int, 61 (2012) 425-430. 17
[53] M.R. Passmore, Y.L. Fung, G. Simonova, S.R. Foley, K.R. Dunster, S.D. Diab, J.P. Tung, R.M. Minchinton, C.I. McDonald, C.M. Anstey, K. Shekar, J.F. Fraser, Inflammation and lung injury in an ovine model of extracorporeal membrane oxygenation support, American journal of physiology. Lung cellular and molecular physiology, 311 (2016) L1202-L1212. [54] C.A. Maissen-Villiger, A. Schweighauser, H.A. van Dorland, C. Morel, R.M. Bruckmaier, A. Zurbriggen, T. Francey, Expression Profile of Cytokines and Enzymes mRNA in Blood Leukocytes of Dogs with Leptospirosis and Its Associated Pulmonary Hemorrhage Syndrome, PloS one, 11 (2016) e0148029. [55] C. Karagiannidis, V. Velehorschi, B. Obertrifter, H.N. Macha, A. Linder, L. Freitag, High-level expression of matrix-associated transforming growth factor-beta1 in benign airway stenosis, Chest, 129 (2006) 1298-1304. [56] A.N. Stouch, A.M. McCoy, R.M. Greer, O. Lakhdari, F.E. Yull, T.S. Blackwell, H.M. Hoffman, L.S. Prince, IL-1beta and Inflammasome Activity Link Inflammation to Abnormal Fetal Airway Development, J Immunol, 196 (2016) 3411-3420. [57] I.K. Oglesby, S.F. Vencken, R. Agrawal, K. Gaughan, K. Molloy, G. Higgins, P. McNally, N.G. McElvaney, M.A. Mall, C.M. Greene, miR-17 overexpression in cystic fibrosis airway epithelial cells decreases interleukin-8 production, Eur Respir J, 46 (2015) 1350-1360. [58] X.H. Miao, C.G. Wang, B.Q. Hu, A. Li, C.B. Chen, W.Q. Song, TGF-beta1 immunohistochemistry and promoter methylation in chronic renal failure rats treated with Uremic Clearance Granules, Folia Histochem Cytobiol, 48 (2010) 284-291. [59] Y. Zhu, H. Yu, Y. Qiu, Z. Ye, W. Su, J. Deng, Q. Cao, G. Yuan, A. Kijlstra, P. Yang, Promoter Hypermethylation of GATA3, IL-4, and TGF-beta Confers Susceptibility to Vogt-Koyanagi-Harada Disease in Han Chinese, Invest Ophthalmol Vis Sci, 58 (2017) 1529-1536. [60] B. Hu, M. Gharaee-Kermani, Z. Wu, S.H. Phan, Epigenetic regulation of myofibroblast differentiation by DNA methylation, The American journal of pathology, 177 (2010) 21-28. [61] R.P. Steck, S.L. Hill, E.G. Weagel, K.S. Weber, R.A. Robison, K.L. O'Neill, Pharmacologic immunosuppression of mononuclear phagocyte phagocytosis by caffeine, Pharmacol Res Perspect, 3 (2015) e00180.
18
Figure 1. Effects of prenatal caffeine ingestion (PCI) from gestational day (GD) 9 to GD 20 on IUGR rate on postnatal day (PND) 0, body weight and growth rate of female offspring from PND 0 to PND 77.
A: IUGR rate on PND 0, n=20; B: Changes of body weight of offspring, n=20; C: Weight
growth rate of offspring, n=20; D: Changes of body weight of PCI offspring with IUGR, n=9; E: Weight growth rate of PCI offspring with IUGR, n=9; F: Changes of body weight of PCI offspring without IUGR, n=14; G: Weight growth rate of PCI offspring without IUGR, n=14. Mean ± SEM. *p < 0.05 vs. control.
Figure 2. Effects of PCI from GD 9 to GD 20 on histological changes in female offspring lungs on PND 77. A: Control offspring before LPS stimulation (200×); B: PCI offspring before LPS stimulation (200×); C: Control offspring after LPS stimulation (200×); D: PCI offspring after LPS stimulation (200×); E: Pulmonary pathological- injury score. Mean ± SEM, n= 3. *p < 0.05 vs. control.
19
Figure 3. Effects of PCI from GD 9 to GD 20 on the pulmonary mRNA expression of structural and inflammatory cytokines in female offspring on PND 77. A: Pulmonary mRNA expression before LPS stimulation; B: Pulmonary mRNA expression after LPS stimulation. Mean ± SEM, n= 8. *p < 0.05 vs. control.
Figure 4. Effects of PCI from GD 9 to GD18 on the pulmonary inflammatory cytokine production in female offspring on PND 77. A: Pulmonary IL-6 production before and after LPS stimulation; B: Pulmonary TNF-α production before and after LPS stimulation. Mean ± SEM, n= 6. *p < 0.05 vs. control.
Table 1. Real-time PCR primers and product length. Genes
Forward primer
Reverse primer
20
Product (bp)
IL-6
CCTTCTTGGGACTGATGT
ACTGGTCTGTTGTGGGTG
97
TNF-α
GCCACCACGCTCTTCTGTC
GCTACGGGCTTGTCACTCG
149
IL-1β
AGCATCCAGCTTCAAATC
CTTCTCCACAGCCACAAT
81
IL-8
GAGTTCTTAGCCAAGGAGG
AAACAGTCTTAGAGGGTAGTG
80
TGF-β
CCCCACTGATACGCCTGAG
GCCCTGTATTCCGTCTCCTT
85
-SMA
CAGGGAGTGATGGTTGGA
GTGATGATGCCGTGTTCT
110
GAPDH
TGCCACTCAGAAGACTGTGG
TTCAGCTCTGGGATGACCTT
129
21
S0890-6238(17)30284-8 https://doi.org/10.1016/j.reprotox.2017.10.006 RTX 7597
To appear in:
Reproductive Toxicology
Received date: Revised date: Accepted date:
30-5-2017 19-9-2017 17-10-2017
Please cite this article as: Liu Han-xiao, Hou Li-fang, Chen Ting, Qu Wen, Liu Sha, Yan Hui-yi, Wen Xiao, Ping Jie.Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring.Reproductive Toxicology https://doi.org/10.1016/j.reprotox.2017.10.006 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title page
Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring
Han-xiao Liu 1, Li-fang Hou 1, Ting Chen, Wen Qu, Sha Liu, Hui-yi Yan, Xiao Wen, Jie Ping*
Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071, China; [email protected]
*Corresponding author: Jie Ping Address: 185, East Lake Road, Wuhan 430071, China. Tel.: +86 27 6875 9310. Fax: +86 27 8733 1670. E-mail: [email protected] 1
These authors contributed equally to this work.
Highlights:
PCI increased expression of lung structure-associated genes in offspring
Upregulation of structural genes contributes to pulmonary interstitial thickness
Destroyed lung structure results in susceptibility of offspring to inflammation
Abstract: This study aimed to investigate the association between prenatal caffeine
1
ingestion (PCI) and risk of postnatal pulmonary inflammation. Pregnant Wistar rats were administered 60 mg/kg/d caffeine intragastrically from gestational day (GD) 7 to GD 20. The results showed that PCI obviously increased intrauterine growth retardation rate to 39.2% and suppressed weight growth of the offspring. PCI also enhanced the expression of transforming growth factor β, α-smooth muscle actin, interleukin (IL)-1β, and IL-8 in lungs and caused pulmonary interstitial thickening in the offspring. Further, with lipopolysaccharide stimulation on postnatal day 77, PCI offspring showed more serious inflammatory infiltration, higher injury scores, and higher levels of IL-6 and tumor necrosis factor-α in lungs than those of the control. Our findings showed, for the first time, that PCI is a certainly threat to postnatal pulmonary inflammation. The potential mechanism is that PCI alter the expression of pulmonary interstitial thickening-associated genes in the offspring. Keywords: prenatal caffeine ingestion; IUGR; pulmonary inflammation; pulmonary interstitial thickness; IL-6; TNF-α
1 Introduction1 Pulmonary inflammation has been regarded as the “captain of the men of death” by William Osler. Although survival improved with the introduction of antibiotics and vaccines in the 20th century, pulmonary inflammation remains affect approximately
Abbreviations: PCI, prenatal caffeine ingestion; IUGR, intrauterine growth retardation; LPS, lipopolysaccharide; GD, gestational day; PND, postnatal day; HE, hematoxylin and eosin; GAPDH, glyceraldehyde phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; TGF, transforming growth factor. 2
450 million people globally (7% of the population) and results in about 4 million deaths per year [1-3]. The susceptibility to pulmonary inflammation depends partly on abnormal structural programming during lung development. Embryo period is critical for lung organogenesis and development, in which the intrauterine environment plays an essential role in regulating the structural programming of the lungs [4]. Fetal exposure to adverse intrauterine factors could attenuate lung development, and the associated structural alterations could persist into adulthood, which may predispose the offspring to later pulmonary inflammation [1, 5]. Caffeine, widely found in coffee, tea, soft beverages, food and some analgesic drugs, is consumed commonly by all age groups, including pregnant women [6, 7]. Caffeine can cross placenta freely, distribute in the fetal circulation, and lead to abnormal intrauterine environment in several ways [8, 9]. Data from our previous studies and other groups showed that prenatal caffeine ingestion (PCI) could cause intrauterine growth retardation (IUGR) in rats, and the IUGR offspring exhibited inhibited weight growth and abnormal development of multiple organs [6, 10, 11]. In addition, clinical and experimental studies reported that IUGR offspring are prone to develop pulmonary inflammation in later life [12, 13]. Therefore, we speculated that PCI could potentiate the susceptibility to pulmonary inflammation in adult offspring. The PCI rat model was established in this study to investigate the association between PCI and adult pulmonary inflammation in the offspring. IUGR rate, postnatal weight growth, pulmonary interstitial thickening, and the interstitial thickening-related gene expression in the offspring were analyzed. Further, after lipopolysaccharide (LPS) 3
stimulation, the production of critical pro-inflammatory cytokines in the offspring was determined. This work will be beneficial in elucidating the developmental toxicity of caffeine and in explaining the susceptibility to adult pulmonary inflammation in PCIinduced IUGR offspring. 2 Materials and methods 2.1 Chemicals and reagents. Caffeine was obtained from Sigma-Aldrich Co., Ltd. (St Louis, MO, USA). Trizol was purchased from Life Technologies (Gaithersburg, MD, USA). Reverse transcription and RT-qPCR kits were supplied by TaKaRa Biotechnology (Dalian, Liaoning, China). All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). IL-6 and TNF-α ELISA kits was purchased from eBioscience (San Diego, USA). All chemicals and reagents were analytical grade. 2.2 Animals and treatments. Wistar female rats weighing 180-220g and male rats weighing 260-300g were purchased from the Experimental Center of the Hubei Medical Scientific Academy (No. 2008-0005, Hubei, China). Rats were maintained under specific pathogen-free conditions in the Center for Animal Experimentation of Wuhan University (Wuhan, Hubei, China), which has been accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC). All animal protocols were prepared according to the Guidelines for Animal Research and approved by the Ethical and Research Committee of Medical College of Wuhan University. After a one-week acclimation period, 2 females were placed with one male in a 4
cage overnight for mating. The day was declared as gestational day (GD) 0 if a vaginal smear with sperm cells was observed. The pregnant rats were randomized into two groups. From GD 7 to GD 20, the rats in caffeine group were intragastrically administered caffeine 60 mg/kg/d. Control rats were administered with the same volume of saline. After the pregnant rats delivered naturally (Postnatal day (PND) 0), pups were weighed and normalized to 8 pups per litter to assure adequate and standardized nutrition. The IUGR rate was diagnosed when the animal had a body weight of less than the mean body weight minus 2 standard deviations of the control group. Then the pups were weaned on PND 21. The female offspring were then normally fed until PND 77. Body weight was recorded weekly, and the corresponding body weight growth rate was calculated as follows: Body weight growth rate (%) = [(body weight of postnatal week x − body weight of postnatal week 1)]/body weight of postnatal week 1× 100%. On PND 77, half of the female offspring (8-10 rats per group) were stimulated by LPS for 2 hours, and then sacrificed to collect lung samples. Lungs of 3 offspring per group were randomly selected and fixed in phosphate-buffered 10% neutral formalin solution for histological examination. The lungs of others were immediately frozen in liquid nitrogen, and then stored at -80 °C for further analysis. 2.3 Histological examination. The fixed pulmonary tissues were dehydrated and then processed via the paraffin slice technique. Sections approximately 4 μm thick were stained with hematoxylin and eosin (HE) and observed under light microscope (100×, Olympus BX-53 Tokyo, Japan). Based on inflammatory infiltration and hemorrhage, pathological-injury scoring was 5
performed according to a previously reported criteria [14]: 0 for no inflammation infiltration and hemorrhage, 1 for it in 25% of the field, 2 for it in 50% of the field, 3 for it in 75% of the field, and 4 for it throughout the field. 3 visions of each section were randomly chosen, and the scores were summed for calculating the total score. 2.4 Real-time PCR analysis. Total RNA was isolated from pulmonary tissues using TRIzol reagent according to the manufacturer's protocol. The concentration and purity of the RNA samples were assessed by spectrophotometric analysis, and the RNA concentration was adjusted to 1μg/μl. Single-strand cDNA was synthesized using the reverse transcription kit. PCR assays were conducted in 96-well optical reaction plates using the QuantStudio 6 Flex from Applied Biosystems (Foster City, CA, USA) in a total volume of 20 μl reaction mixture containing: 1 μl of cDNA template, 0.4 μl of 10μM each primer, 10 μl of 2 × SYBRGreen, 0.4 μl of ROX and 7.8μl of DEPC-H2O. The cycling conditions were as follows: pre-denaturation, 95 °C for 30 s; denaturation, 95 °C for 10 s; annealing, 60 °C for 30 s; 40 cycles. Relative mRNA expression was calculated by ΔΔCt method using glyceraldehyde phosphate dehydrogenase (GAPDH) as the reference gene. The primer sequences were listed in Table 1. 2.5 ELISA assay for pulmonary interleukin (IL)-6 and tumor necrosis factor (TNF)α) detection. Pulmonary tissues were homogenized using a tissue rotator in phosphate buffer solution. The homogenates were centrifuged at 3000 × rpm at 4 °C for 15 min. The supernatants were collected for IL-6 and TNF-α analysis by ELISA assay kits following 6
the manufacturer's protocol. 2.6 Statistical analysis. SPSS 17 (SPSS Science Inc., Chicago, Illinois) was used for data analyses. All measurement data were expressed as the mean ± SEM and evaluated with Student's t test or with two-factor analysis of variance as appropriate. Values of p < 0.05 were considered statistically significant. 3 Results 3.1 PCI induced IUGR. PCI significantly increased the IUGR rate to 39.2% (p < 0.01, Figure 1 A) on PND 0. Body weight is an important index for offspring development. The results showed that the body weight of female offspring in PCI group was clearly lower than that of the control from PND 0 to PND 77 (p < 0.05, Figure 1B), but the growth rates of PCI offspring were higher compared with the control (p < 0.05, Figure 1C). In addition, the body weight of PCI offspring with or without IUGR was analyzed and compared separately with the control offspring. The results showed that the PCI offspring with IUGR showed a significantly lower body weight and higher weight growth rate, as compared to the control offspring (p < 0.05, Figures 1D and E). The PCI offspring without IUGR also exhibited reduced body weight and increased weight growth rate, but the difference was not significant (Figures 1F and G). Although the growth rate was higher in rats with IUGR, the weight of PCI offspring with IUGR was still clearly lower than both the weight of control offspring and the weight of PCI offspring without IUGR at PND 77. 7
3.2 PCI induced histological changes in offspring lungs. HE staining revealed that PCI caused histological changes in the lungs of the offspring on PND 77 before LPS stimulation. As compared with the control (Figure 2A), thickened alveoli septum with increased pulmonary interstitium were observed in lungs of PCI offspring (Figure 2B). The histological changes were then semiquantitatively analyzed by pathological-injury scoring, which also showed higher injury scores in PCI group (p < 0.05, Figure 2E). To investigate the effects of PCI on pulmonary inflammation development, we further established acute inflammatory model with LPS and demonstrated evident inflammatory injuries characterized by the presence of interstitial edema, hemorrhage, thickening of the alveolar wall, decreased alveoli number, and inflammatory cell infiltration in the lungs of both control (Figure 2C) and PCI offspring (Figure 2D). Following LPS stimulation, offspring in both groups also exhibited increased pathological-injury scoring in lungs. In addition, as compared to the control, PCI offspring exhibited more severe inflammatory changes (more hemorrhage and inflammatory cell infiltration, much greater thickening of the alveolar wall, and more obvious decrease of the alveoli number) in lungs. The results from pathological-injury scoring also showed more serious inflammation in PCI offspring than control (p < 0.05, Figure 2E). 3.3 PCI altered gene expression of structural cytokines in offspring lungs. According to the HE staining results, the mRNA expression levels of transforming growth factor (TGF-β), α-smooth muscle actin (α-SMA), IL-8, and IL-1β, which were related to pulmonary interstitial thickness, were detected. Consistent with the HE 8
staining results, before LPS stimulation, the expression levels of IL-1β, IL-8, TGF-β, and α-SMA were obviously increased in PCI offspring as compared with the control (p < 0.05, Figure 3A). Following LPS stimulation, comparatively more increases of the expression of those genes were observed in control offspring than those of the PCI offspring. Additionally, there were higher expression of IL-1β (p < 0.05, Figure 3 B), lower expression of IL-8 and TGF-β (p < 0.05, Figure 3B), and similar expression of α-SMA in PCI offspring as compared with the control. IL-6 and TNF-α were thought as the two major cytokines mediating pulmonary inflammation development. The expression levels of IL-6 and TNF-α in lungs were also detected. The results showed that PCI offspring exhibited higher expression levels of TNF-α and IL-6 in lungs both before and after LPS stimulation, as compared to the control offspring, but the difference was not significant (Figures 3A and B). 3.4 PCI increased inflammatory cytokine production in offspring lungs. The production of IL-6 and TNF-α were widely used for diagnosis of the LPSinduced inflammation. To explore the effect of PCI on the production of inflammatory cytokines, we further determined the levels of IL-6 and TNF-α in lungs of the offspring on PND 77. Before LPS stimulation, there were no statistical difference in pulmonary contents of IL-6 and TNF-α between PCI offspring and control (Figures 4 A and B). Following LPS stimulation, offspring in both groups exhibited increased production of IL-6 and TNF-α in lungs. The IL-6 and TNF-α concentrations of PCI offspring were obviously higher than that of the control (p < 0.05 Figures 4 A and B). 4 Discussion 9
In our previous studies, different doses of caffeine (20, 60 and 180 mg/kg/d) were used to establish IUGR rat model and revealed a clear dose-dependent effects of PCI on adverse fetal development-related parameters [15, 16]. To achieve the typical IUGR model and to avoid excessive numbers of absorbed or stillborn fetuses, the middle dose of 60 mg/kg/d caffeine was chosen in this study. According to the World Health Organization, caffeine intake of 300 mg/d (5 mg/kg/d) in pregnant women was associated with increased risk for IUGR [17]. Using the dose conversion between human and rat (1:6.17) [18], the dose of 5 mg/kg/d in human is equivalent to 31 mg/kg/d caffeine in rats. The 60 mg/kg/d caffeine used in this study is higher than 31 mg/kg/d but less than the lowest dose usually needed to induce malformations in rats (80 mg/kg/d) [19]. Therefore, the dose of caffeine used in this study should be reasonable. In fact, no resorbed fetuses and miscarriage have been observed in the present study. LPS, which is widely used to achieve the acute pulmonary inflammation model, could induce pulmonary injury rapidly [20-23]. Hence, rats were scarified 2 h after LPS stimulation on PND 77 (adulthood in rats) in this study. It was reported that respiratory inflammation was associated with more deleterious pathological damage, higher expression of inflammatory markers, and higher recruitment of cells in females than in males [24, 25]. Because Female X-chromosome mosaicism for inflammatory gene expression could contribute to the responses to LPS, the females are more sensitive to LPS stimulation [26]. Therefore, female offspring were used in this study. In a number of studies, pulmonary inflammation induced by LPS was mainly featured with destroyed alveolar structure, thickened pulmonary interstitium, and the infiltration of 10
inflammatory cells [27-29]. The severity of these morphologic injuries is used as a key indicator to measure the inflammation degree in lung [30]. In the present study, PCI offspring following LPS stimulation displayed more evident inflammatory injuries and higher injury scores, indicating a more serious pulmonary inflammation in PCI offspring than control. In addition to the morphologic injuries, the production of IL-6 and TNF-α, which are known as the main two pulmonary inflammatory mediators, were also widely used as a “gold standard” for diagnosis of the LPS-induced inflammation [28-30]. Peters MC et.al and van der Poll et.al reported that IL-6 plays a role in regulating poor pulmonary condition and is essential during pulmonary inflammation development [31, 32]. In addition, TNF-α is known to mediate the acute phase reaction, which is critical for LPS-caused immune responses [33]. Our pre-experiments showed that the concentrations of IL-6 and TNF-α in serum before and after stimulation were both below the detection limit of the ELISA kits (IL-6: 31.0 pg/ml; TNF-α: 39.1 pg/ml). Thus, the levels of IL-6 and TNF-α were only detected in lungs. Although no apparent statistic difference in pulmonary IL-6 and TNF-α mRNA expression between PCI and control groups was observed before and after LPS stimulation, PCI significantly augmented the contents of IL-6 and TNF-α in lungs, as compared with control. These findings further confirmed that the pulmonary inflammation was more severe in PCI offspring with LPS stimulation than control. In the present study, IUGR rate was obviously increased in PCI group. The offspring with IUGR exhibited low body weight and high growth rate until adulthood, which, based on the findings of our and other groups, is closely related to altered 11
development pattern of multiple organs functionally and structurally [34-37]. IUGR has already been linked to poor pulmonary structure, which in turn increase risk of inflammation [38]. In human, clinical studies have established a clear connection between changes of pulmonary structure and pulmonary inflammatory diseases. Pulmonary interstitial thickness is a definite trigger of usual interstitial pneumonia, nonspecific interstitial pneumonia, centrilobular emphysema, pulmonary inflammatory fibrosis, chronic obstructive pulmonary disease, and asthma [39-44]. The experimental studies further confirmed that the pulmonary interstitial thickness and the alveolar destruction could potentiate the susceptibility of pulmonary inflammation [45]. In this study, HE staining revealed that PCI could cause pulmonary interstitial thickness before LPS stimulation, indicating a pulmonary inflammation-predisposing structure in PCI offspring. TGF-β is known as a key mediator in augmenting the pulmonary interstitium through induction of fibrillogenesis [46]. Studies reported that over-expression of the TGF-β gene or enhanced protein expression of TGF-β could increase Smad2/3 and p38 MAPK signaling in pulmonary arterial smooth muscle cells, and induce fibrotic activity of muscle cells and the associated pulmonary thickening [47-49]. The expression of αSMA plays a critical role in developmental changes of airway wall structure by promoting smooth muscle proliferation [50]. During airway wall remodeling, two proinflammatory cytokines, the IL-8 and the IL1-β, are known to the potent promoter of inflammatory hyperplasia [51, 52]. The enhanced expression levels of IL-8 and IL1β could induce angiogenesis in lungs, which in turn caused pulmonary thickening and 12
inflammatory infiltration [53, 54]. Moreover, researchers reported that the increase in the expression of TGF-β, α-SMA, IL1-β, and IL-8 could result in chronic airway thickening [46, 55-57]. In the present study, before stimulation, the expression levels of TGF-β, α-SMA, IL1-β, and IL-8 in lungs of PCI offspring were clearly higher than that of control. These findings provided a potential mechanism of PCI-induced pulmonary inflammation susceptibility, which is that PCI caused structural changes in lung through upregulating the expression of remodeling-associated genes. It was reported that the expression of these genes are regulated by the DNA methylation modification at the level of transcription [58-60]. Our previous studies demonstrated that PCI can change the expression of DNA methyltransferase and the DNA methylation patterns of multiple genes during fetal development [10, 11]. Hence, DNA methylation mechanism may be involved in PCI induced changes of the remodeling-associated gene expression. In addition, both human and animal studies reported that prenatal abnormal environment exposure may cause structural (altered lung development) and functional (skewed immune development) changes, which may predispose the offspring to inflammatory stimulation [5]. It is well known that caffeine has definitely immunosuppressive effect [61]. Hence, PCI induced immune skewing might also be potentially involved in the susceptibility of PCI offspring to LPS stimulation.
5 Conclusion Our study showed, for the first time, that PCI contributed to the increased risk of pulmonary inflammation in the adult female offspring and the underlying mechanism 13
may involve the enhanced expression of the pulmonary interstitial thickeningassociated genes. This study provided evidence for exploring the fetal origin of pulmonary destruction and pulmonary inflammation susceptibility for caffeine-induced IUGR offspring. Further analysis will be needed to explore the molecular mechanisms of the effects of caffeine on TGF-β and α-SMA expression in IUGR offspring. Conflicts of Interest: The authors declare no conflict of interest. Acknowledgments: This work was supported by Grants from the National Natural Science Foundation of China (No. 81673215, 81273107), the Outstanding Youth Science Fund of Hubei Province (No. 2012FFA017), and the Applied Fundamental Research Project of Wuhan (No. 2017060201010199).
References [1] O. Ruuskanen, E. Lahti, L.C. Jennings, D.R. Murdoch, Viral pneumonia, Lancet, 377 (2011) 1264-1275. [2] R. Lodha, S.K. Kabra, R.M. Pandey, Antibiotics for community-acquired pneumonia in children, Cochrane Database Syst Rev, (2013) CD004874. [3] G.B. Nair, M.S. Niederman, Community-acquired pneumonia: an unfinished battle, Med Clin North Am, 95 (2011) 1143-1161. [4] R. Harding, M.L. Cock, S. Louey, B.J. Joyce, M.G. Davey, C.A. Albuquerque, S.B. Hooper, G.S. Maritz, The compromised intra-uterine environment: implications for future lung health, Clin Exp Pharmacol Physiol, 27 (2000) 965-974. [5] D.I. Suh, H.Y. Chang, E. Lee, S.I. Yang, S.J. Hong, Prenatal Maternal Distress and Allergic Diseases in Offspring: Review of Evidence and Possible Pathways, Allergy Asthma Immunol Res, 9 (2017) 200-211. [6] V. Sengpiel, E. Elind, J. Bacelis, S. Nilsson, J. Grove, R. Myhre, M. Haugen, H.M. Meltzer, J. Alexander, B. Jacobsson, A.L. Brantsaeter, Maternal caffeine intake during pregnancy is associated with birth weight but not with gestational length: results from a large prospective observational cohort study, BMC Med, 11 (2013) 42. [7] M.A. Heckman, J. Weil, E. Gonzalez de Mejia, Caffeine (1, 3, 7-trimethylxanthine) in foods: a comprehensive review on consumption, functionality, safety, and regulatory matters, J Food Sci, 75 (2010) R77-87. 14
[8] R. Wierzejska, M. Jarosz, M. Siuba, W. Sawicki, Comparison of maternal and fetal blood levels of caffeine and its metabolite. A pilot study, Ginekol Pol, 85 (2014) 500-503. [9] D.C. Greenwood, N.J. Thatcher, J. Ye, L. Garrard, G. Keogh, L.G. King, J.E. Cade, Caffeine intake during pregnancy and adverse birth outcomes: a systematic review and dose-response metaanalysis, Eur J Epidemiol, 29 (2014) 725-734. [10] D.M. Wu, Z. He, L.P. Ma, L.L. Wang, J. Ping, H. Wang, Increased DNA methylation of scavenger receptor class B type I contributes to inhibitory effects of prenatal caffeine ingestion on cholesterol uptake and steroidogenesis in fetal adrenals, Toxicol Appl Pharmacol, 285 (2015) 8997. [11] J. Ping, J.F. Wang, L. Liu, Y.E. Yan, F. Liu, Y.Y. Lei, H. Wang, Prenatal caffeine ingestion induces aberrant DNA methylation and histone acetylation of steroidogenic factor 1 and inhibits fetal adrenal steroidogenesis, Toxicology, 321 (2014) 53-61. [12] A. Sasi, V. Abraham, M. Davies-Tuck, G.R. Polglase, G. Jenkin, S.L. Miller, A. Malhotra, Impact of intrauterine growth restriction on preterm lung disease, Acta Paediatr, 104 (2015) e552556. [13] D. Wignarajah, M.L. Cock, K.E. Pinkerton, R. Harding, Influence of intrauterine growth restriction on airway development in fetal and postnatal sheep, Pediatr Res, 51 (2002) 681-688. [14] K.M. Smith, J.D. Mrozek, S.C. Simonton, D.R. Bing, P.A. Meyers, J.E. Connett, M.C. Mammel, Prolonged partial liquid ventilation using conventional and high-frequency ventilatory techniques: gas exchange and lung pathology in an animal model of respiratory distress syndrome, Crit Care Med, 25 (1997) 1888-1897. [15] Y. Liu, D. Xu, J. Feng, H. Kou, G. Liang, H. Yu, X. He, B. Zhang, L. Chen, J. Magdalou, H. Wang, Fetal rat metabonome alteration by prenatal caffeine ingestion probably due to the increased circulatory glucocorticoid level and altered peripheral glucose and lipid metabolic pathways, Toxicol Appl Pharmacol, 262 (2012) 205-216. [16] D. Xu, B. Zhang, G. Liang, J. Ping, H. Kou, X. Li, J. Xiong, D. Hu, L. Chen, J. Magdalou, H. Wang, Caffeine-induced activated glucocorticoid metabolism in the hippocampus causes hypothalamic-pituitary-adrenal axis inhibition in fetal rats, PloS one, 7 (2012) e44497. [17] J.J. Guilbert, The world health report 2002 - reducing risks, promoting healthy life, Educ Health, 16 (2003) 230. [18] S. Reagan-Shaw, M. Nihal, N. Ahmad, Dose translation from animal to human studies revisited, FASEB J, 22 (2008) 659-661. [19] A. Nehlig, G. Debry, Potential teratogenic and neurodevelopmental consequences of coffee and caffeine exposure: a review on human and animal data, Neurotoxicol Teratol, 16 (1994) 531-543. [20] M. Zeng, W. Sang, S. Chen, R. Chen, H. Zhang, F. Xue, Z. Li, Y. Liu, Y. Gong, H. Zhang, X. Kong, 4-PBA inhibits LPS-induced inflammation through regulating ER stress and autophagy in acute lung injury models, Toxicol Lett, 271 (2017) 26-37. [21] J.M. Lee, C.D. Yeo, H.Y. Lee, C.K. Rhee, I.K. Kim, D.G. Lee, S.H. Lee, J.W. Kim, Inhibition of neutrophil elastase contributes to attenuation of lipopolysaccharide-induced acute lung injury during neutropenia recovery in mice, J Anesth, (2017). [22] N. Li, Y. Song, W. Zhao, T. Han, S. Lin, O. Ramirez, L. Liang, Small interfering RNA targeting NF-kappaB attenuates lipopolysaccharide-induced acute lung injury in rats, BMC Physiol, 16 (2016) 7. [23] Y. Zhang, H. Liu, J. Yao, Y. Huang, S. Qin, Z. Sun, Y. Xu, S. Wan, H. Cheng, C. Li, X. Zhang, 15
Y. Ke, Manipulating the air-filled zebrafish swim bladder as a neutrophilic inflammation model for acute lung injury, Cell Death Dis, 7 (2016) e2470. [24] W.Q. Gan, S.F. Man, D.S. Postma, P. Camp, D.D. Sin, Female smokers beyond the perimenopausal period are at increased risk of chronic obstructive pulmonary disease: a systematic review and meta-analysis, Respir Res, 7 (2006) 52. [25] G.J. Casimir, N. Lefevre, F. Corazza, J. Duchateau, Sex and inflammation in respiratory diseases: a clinical viewpoint, Biol Sex Differ, 4 (2013) 16. [26] R. Chandra, S. Federici, G. Hasko, E.A. Deitch, Z. Spolarics, Female X-chromosome mosaicism for gp91phox expression diversifies leukocyte responses during endotoxemia, Crit Care Med, 38 (2010) 2003-2010. [27] X. Niu, F. Liu, W. Li, W. Zhi, H. Zhang, X. Wang, Z. He, Cavidine Ameliorates Lipopolysaccharide-Induced Acute Lung Injury via NF-kappaB Signaling Pathway in vivo and in vitro, Inflammation, (2017). [28] G. Zhu, X. Xin, Y. Liu, Y. Huang, K. Li, C. Wu, Geraniin attenuates LPS-induced acute lung injury via inhibiting NF-kappaB and activating Nrf2 signaling pathways, Oncotarget, 8 (2017) 22835-22841. [29] L. Shao, D. Meng, F. Yang, H. Song, D. Tang, Irisin-mediated protective effect on LPS-induced acute lung injury via suppressing inflammation and apoptosis of alveolar epithelial cells, Biochem Biophys Res Commun, 487 (2017) 194-200. [30] X. Chen, X. Zhang, J. Zhang, Y. Gao, Z. Yang, S. Li, H. Dai, Attenuation of acute lung injury in a rat model by Semen Cassiae, BMC Complement Altern Med, 17 (2017) 234. [31] T. van der Poll, C.V. Keogh, X. Guirao, W.A. Buurman, M. Kopf, S.F. Lowry, Interleukin-6 gene-deficient mice show impaired defense against pneumococcal pneumonia, J Infect Dis, 176 (1997) 439-444. [32] M.C. Peters, K.W. McGrath, G.A. Hawkins, A.T. Hastie, B.D. Levy, D.T. Mauger, S.A. Comhair, S.C. Erzurum, M.W. Johansson, N.N. Jarjour, A.M. Coverstone, M. Castro, F. Holguin, S.E. Wenzel, P.G. Woodruff, E.R. Bleecker, J.V. Fahy, L. National Heart, P. Blood Institute Severe Asthma Research, Plasma interleukin-6 concentrations, metabolic dysfunction, and asthma severity: a cross-sectional analysis of two cohorts, Lancet Respir Med, 4 (2016) 574-584. [33] V.V. Novochadov, D.M. Frolov, A.I. Shchyogolev, Characteristics of Lung Injury in Rats after Inhalation of Ultradisperse Bacterial LPS in Lipophilic and Hydrophilic Phases, Bull Exp Biol Med, 159 (2015) 438-442. [34] S.U. Devaskar, A. Chu, Intrauterine Growth Restriction: Hungry for an Answer, Physiology (Bethesda), 31 (2016) 131-146. [35] A.R.A. McDougall, V. Wiradjaja, A. Azhan, A. Li, N. Hale, M.E. Wlodek, S.B. Hooper, M.J. Wallace, M. Tolcos, Intrauterine Growth Restriction Alters the Postnatal Development of the Rat Cerebellum, Dev Neurosci, (2017). [36] C. Zhang, D. Xu, H. Luo, J. Lu, L. Liu, J. Ping, H. Wang, Prenatal xenobiotic exposure and intrauterine hypothalamus-pituitary-adrenal axis programming alteration, Toxicology, 325 (2014) 74-84. [37] J. Fan, W.X. Zhang, Y.S. Rao, J.L. Xue, F.F. Wang, L. Zhang, Y.E. Yan, Perinatal Nicotine Exposure Increases Obesity Susceptibility in Adult Male Rat Offspring by Altering Early Adipogenesis, Endocrinology, 157 (2016) 4276-4286. [38] M.A. Alcazar, K. Dinger, E. Rother, I. Ostreicher, C. Vohlen, C. Plank, J. Dotsch, Prevention 16
of early postnatal hyperalimentation protects against activation of transforming growth factorbeta/bone morphogenetic protein and interleukin-6 signaling in rat lungs after intrauterine growth restriction, J Nutr, 144 (2014) 1943-1951. [39] C.A. Yi, K.S. Lee, J. Han, M.P. Chung, M.J. Chung, K.M. Shin, 3-T MRI for differentiating inflammation- and fibrosis-predominant lesions of usual and nonspecific interstitial pneumonia: comparison study with pathologic correlation, AJR Am J Roentgenol, 190 (2008) 878-885. [40] T. Fujimoto, T. Matsumoto, S. Shoji, Disorganizing-fibrosing processes in alveolar walls of interstitial pneumonia, "alveolopneumonitis": a morphopathological study, Tohoku J Exp Med, 158 (1989) 237-251. [41] A. Ciledag, B. Cirit Kocer, N. Kokturk, A. Kaya, G. Celik, N. Numanoglu, A rare cause of interstitial lung disease: Hermansky-Pudlak syndrome, Tuberk Toraks, 59 (2011) 85-88. [42] S. Glaser, R. Meyer, C.F. Opitz, R. Hetzer, R. Ewert, Pulmonary interstitial and vascular abnormalities following cardiac transplantation, Transplant Proc, 40 (2008) 3585-3589. [43] M.J. Kang, C.M. Yoon, B.H. Kim, C.M. Lee, Y. Zhou, M. Sauler, R. Homer, A. Dhamija, D. Boffa, A.P. West, G.S. Shadel, J.P. Ting, J.R. Tedrow, N. Kaminski, W.J. Kim, C.G. Lee, Y.M. Oh, J.A. Elias, Suppression of NLRX1 in chronic obstructive pulmonary disease, The Journal of clinical investigation, 125 (2015) 2458-2462. [44] J.C. Hogg, The pathology of asthma, APMIS, 105 (1997) 735-745. [45] Q. Deng, J. Zhang, Y. Gao, X. She, Y. Wang, Y. Wang, X. Ge, MLN4924 protects against bleomycin-induced pulmonary fibrosis by inhibiting the early inflammatory process, Am J Transl Res, 9 (2017) 1810-1821. [46] D.M. Brass, I.V. Yang, M.P. Kennedy, G.S. Whitehead, H. Rutledge, L.H. Burch, D.A. Schwartz, Fibroproliferation in LPS-induced airway remodeling and bleomycin-induced fibrosis share common patterns of gene expression, Immunogenetics, 60 (2008) 353-369. [47] P. Dalvi, H. Sharma, T. Konstantinova, M. Sanderson, A.O. Brien-Ladner, N.K. Dhillon, Hyperactive TGF-beta Signaling in Smooth Muscle Cells Exposed to HIV-protein(s) and Cocaine: Role in Pulmonary Vasculopathy, Scientific reports, 7 (2017) 10433. [48] E. Bouros, E. Filidou, K. Arvanitidis, D. Mikroulis, P. Steiropoulos, G. Bamias, D. Bouros, G. Kolios, Lung fibrosis-associated soluble mediators and bronchoalveolar lavage from idiopathic pulmonary fibrosis patients promote the expression of fibrogenic factors in subepithelial lung myofibroblasts, Pulm Pharmacol Ther, (2017). [49] S.A. Papiris, I.P. Tomos, A. Karakatsani, A. Spathis, I. Korbila, A. Analitis, L. Kolilekas, K. Kagouridis, S. Loukides, P. Karakitsos, E.D. Manali, High levels of IL-6 and IL-8 characterize early-on idiopathic pulmonary fibrosis acute exacerbations, Cytokine, (2017). [50] T. Yamada, E. Suzuki, F. Gejyo, T. Ushiki, Developmental changes in the structure of the rat fetal lung, with special reference to the airway smooth muscle and vasculature, Arch Histol Cytol, 65 (2002) 55-69. [51] L. Keglowich, M. Roth, M. Philippova, T. Resink, G. Tjin, B. Oliver, D. Lardinois, S. DessusBabus, R. Gosens, K. Hostettler Haack, M. Tamm, P. Borger, Bronchial smooth muscle cells of asthmatics promote angiogenesis through elevated secretion of CXC-chemokines (ENA-78, GROalpha, and IL-8), PloS one, 8 (2013) e81494. [52] C. Tefe-Silva, C.T. Beneli, M.R. Celes, E.R. Machado, M.T. Ueta, C.A. Sorgi, E.M. Floriano, L.H. Faccioli, S.G. Ramos, Dexamethasone reduces bronchial wall remodeling during pulmonary migration of Strongyloides venezuelensis larvae in rats, Parasitol Int, 61 (2012) 425-430. 17
[53] M.R. Passmore, Y.L. Fung, G. Simonova, S.R. Foley, K.R. Dunster, S.D. Diab, J.P. Tung, R.M. Minchinton, C.I. McDonald, C.M. Anstey, K. Shekar, J.F. Fraser, Inflammation and lung injury in an ovine model of extracorporeal membrane oxygenation support, American journal of physiology. Lung cellular and molecular physiology, 311 (2016) L1202-L1212. [54] C.A. Maissen-Villiger, A. Schweighauser, H.A. van Dorland, C. Morel, R.M. Bruckmaier, A. Zurbriggen, T. Francey, Expression Profile of Cytokines and Enzymes mRNA in Blood Leukocytes of Dogs with Leptospirosis and Its Associated Pulmonary Hemorrhage Syndrome, PloS one, 11 (2016) e0148029. [55] C. Karagiannidis, V. Velehorschi, B. Obertrifter, H.N. Macha, A. Linder, L. Freitag, High-level expression of matrix-associated transforming growth factor-beta1 in benign airway stenosis, Chest, 129 (2006) 1298-1304. [56] A.N. Stouch, A.M. McCoy, R.M. Greer, O. Lakhdari, F.E. Yull, T.S. Blackwell, H.M. Hoffman, L.S. Prince, IL-1beta and Inflammasome Activity Link Inflammation to Abnormal Fetal Airway Development, J Immunol, 196 (2016) 3411-3420. [57] I.K. Oglesby, S.F. Vencken, R. Agrawal, K. Gaughan, K. Molloy, G. Higgins, P. McNally, N.G. McElvaney, M.A. Mall, C.M. Greene, miR-17 overexpression in cystic fibrosis airway epithelial cells decreases interleukin-8 production, Eur Respir J, 46 (2015) 1350-1360. [58] X.H. Miao, C.G. Wang, B.Q. Hu, A. Li, C.B. Chen, W.Q. Song, TGF-beta1 immunohistochemistry and promoter methylation in chronic renal failure rats treated with Uremic Clearance Granules, Folia Histochem Cytobiol, 48 (2010) 284-291. [59] Y. Zhu, H. Yu, Y. Qiu, Z. Ye, W. Su, J. Deng, Q. Cao, G. Yuan, A. Kijlstra, P. Yang, Promoter Hypermethylation of GATA3, IL-4, and TGF-beta Confers Susceptibility to Vogt-Koyanagi-Harada Disease in Han Chinese, Invest Ophthalmol Vis Sci, 58 (2017) 1529-1536. [60] B. Hu, M. Gharaee-Kermani, Z. Wu, S.H. Phan, Epigenetic regulation of myofibroblast differentiation by DNA methylation, The American journal of pathology, 177 (2010) 21-28. [61] R.P. Steck, S.L. Hill, E.G. Weagel, K.S. Weber, R.A. Robison, K.L. O'Neill, Pharmacologic immunosuppression of mononuclear phagocyte phagocytosis by caffeine, Pharmacol Res Perspect, 3 (2015) e00180.
18
Figure 1. Effects of prenatal caffeine ingestion (PCI) from gestational day (GD) 9 to GD 20 on IUGR rate on postnatal day (PND) 0, body weight and growth rate of female offspring from PND 0 to PND 77.
A: IUGR rate on PND 0, n=20; B: Changes of body weight of offspring, n=20; C: Weight
growth rate of offspring, n=20; D: Changes of body weight of PCI offspring with IUGR, n=9; E: Weight growth rate of PCI offspring with IUGR, n=9; F: Changes of body weight of PCI offspring without IUGR, n=14; G: Weight growth rate of PCI offspring without IUGR, n=14. Mean ± SEM. *p < 0.05 vs. control.
Figure 2. Effects of PCI from GD 9 to GD 20 on histological changes in female offspring lungs on PND 77. A: Control offspring before LPS stimulation (200×); B: PCI offspring before LPS stimulation (200×); C: Control offspring after LPS stimulation (200×); D: PCI offspring after LPS stimulation (200×); E: Pulmonary pathological- injury score. Mean ± SEM, n= 3. *p < 0.05 vs. control.
19
Figure 3. Effects of PCI from GD 9 to GD 20 on the pulmonary mRNA expression of structural and inflammatory cytokines in female offspring on PND 77. A: Pulmonary mRNA expression before LPS stimulation; B: Pulmonary mRNA expression after LPS stimulation. Mean ± SEM, n= 8. *p < 0.05 vs. control.
Figure 4. Effects of PCI from GD 9 to GD18 on the pulmonary inflammatory cytokine production in female offspring on PND 77. A: Pulmonary IL-6 production before and after LPS stimulation; B: Pulmonary TNF-α production before and after LPS stimulation. Mean ± SEM, n= 6. *p < 0.05 vs. control.
Table 1. Real-time PCR primers and product length. Genes
Forward primer
Reverse primer
20
Product (bp)
IL-6
CCTTCTTGGGACTGATGT
ACTGGTCTGTTGTGGGTG
97
TNF-α
GCCACCACGCTCTTCTGTC
GCTACGGGCTTGTCACTCG
149
IL-1β
AGCATCCAGCTTCAAATC
CTTCTCCACAGCCACAAT
81
IL-8
GAGTTCTTAGCCAAGGAGG
AAACAGTCTTAGAGGGTAGTG
80
TGF-β
CCCCACTGATACGCCTGAG
GCCCTGTATTCCGTCTCCTT
85
-SMA
CAGGGAGTGATGGTTGGA
GTGATGATGCCGTGTTCT
110
GAPDH
TGCCACTCAGAAGACTGTGG
TTCAGCTCTGGGATGACCTT
129
21