- Email: [email protected]
Prevalence and diversity of Shiga toxin genes in Canada geese and water in western Lake Erie Region
Journal of Great Lakes Research 42 (2016) 476–481
Contents lists available at ScienceDirect
Journal of Great Lakes Research journal homepage: www.elsevier.com/locate/jglr
Prevalence and diversity of Shiga toxin genes in Canada geese and water in western Lake Erie Region Tsung-Ta David Hsu a, Chris L. Rea b, Zhongtang Yu a,c, Jiyoung Lee a,b,d,⁎ a
Environmental Science Graduate Program, The Ohio State University, Columbus, OH, USA College of Public Health, Division of Environmental Health Sciences, The Ohio State University, Columbus, OH, USA Department of Animal Sciences, The Ohio State University, Columbus, OH, USA d Department of Food Science & Technology, The Ohio State University, Columbus, OH, USA b c
a r t i c l e
i n f o
Article history: Received 19 June 2015 Accepted 11 November 2015 Available online 12 January 2016 Communicated by R. Michael McKay Index words: Shiga toxin-producing Escherichia coli (STEC) Canada geese Lake Erie Wetlands Beach
a b s t r a c t Shiga toxin-producing Escherichia coli (STEC) poses a major health risk by causing gastrointestinal illness and has been isolated from wild birds, including Canada geese (Branta canadensis). The major virulence factor for STEC infection is Shiga toxin. This study was designed to evaluate the occurrence and diversity of the Shiga toxin gene (stx) in Canada geese in the western Lake Erie region. Samples were collected from the Ottawa National Wildlife Refuge (ONWR) at Oak Harbor, Ohio from June to December, 2012, and occurrence of the stx gene was determined using polymerase chain reaction (PCR). Genetic diversity of stx variants among the fecal samples was examined using denaturing-gradient gel electrophoresis (DGGE). The Shiga toxin gene 2 (stx2) variant were detected in 20.8% (n = 77) of the geese fecal samples and 7% (n = 71) of the water samples. DGGE and clustering analysis showed a low stx2 diversity and single genetic lineage of all the stx2 fragments. All the stx2 sequences from excised DGGE bands were similar to those from a toxin form of high potency (stx2a) and those from reported outbreak-causing serotypes (E. coli O157:H7, O165:H25, and O111:H–). Detection of stx from Canada geese suggested that viable Shiga toxin-producing Escherichia coli may be present. Further investigations, such as bacterial isolation, are suggested to better understand potential public health hazards in Lake Erie recreational areas, the role of Canada geese as a reservoir of Shiga toxin-producing Escherichia coli, and dissemination of these pathogenic bacteria. © 2016 International Association for Great Lakes Research. Published by Elsevier B.V. All rights reserved.
Introduction In the United States, it is estimated that more than 110,000 cases of gastrointestinal illness are caused each year by Shiga toxin-producing Escherichia coli (STEC), with the majority of these cases attributed to E. coli O157:H7 (Mead et al., 1999). The major transmission route of E. coli O157:H7 is food (beef and produce); however, it can also be disseminated via other pathways, including animal contact and exposure via recreational and drinking water (Rangel et al., 2005). Shiga toxins are the main virulence factors of STEC, which are composed of two toxin types: Shiga toxin 1 (Stx1) and Shiga toxin 2 (Stx2). It has been shown that Stx2 has higher toxicity and genetic variance than Stx1, with the Stx2a and Stx2d having a higher potency than Stx2b and Stx2c (Fuller et al., 2011). Based on the diversity of the coding sequences, a subtyping method for stx2 has been developed that targets partial sequences of the stxAB2 operon. It has been shown that Stx2 subtypes (Stx2a and Stx2c) are the primary cause of hemolytic uremic
⁎ Corresponding author at: College of Public Health, Division of Environmental Health Sciences, 1841 Neil Ave., 406 Cunz Hall, Columbus, OH 43210, USA. Tel.: +1 614 292 5546. E-mail address: [email protected] (J. Lee).
syndrome (HUS) and bloody diarrhea among patients (Persson et al., 2007). Shiga toxin genes have been detected in various environments, including lake water (Smith et al., 2009), urban surface waters and sediments (Shelton et al., 2006; Tani et al., 2007). Waterfowl may harbor human pathogens and facilitate their dissemination over long distance (Abulreesh et al., 2007). In fact, Shiga toxin genes have been found in seagulls (Makino et al., 2000), ducks (Wang et al., 2010) and mallards (Chandran and Mazumder, 2014). Among waterfowl species, Canada geese feces have been found to contain several human enteric pathogens, including various STEC serotypes (Kullas et al., 2002). Because Canada geese reside in urban, agricultural, and recreational areas, it is highly probable that Canada geese can spread geese-harbored pathogens. It has been reported that stx2 has about a 10% prevalence in water samples collected from the eastern portion of Lake Erie (Smith et al., 2009); however, no previous study has been conducted on the western end of Lake Erie. The objectives of this study were (1) to evaluate the prevalence of stx2 in water and fecal samples collected from Canada geese in the western Lake Erie area; and (2) to examine the genetic variance of stx2 among different fecal samples from Canada geese. The findings of this study may help public health professionals and officials to better address potential zoonotic disease transmission risks from wildlife in recreational areas.
http://dx.doi.org/10.1016/j.jglr.2015.12.003 0380-1330/© 2016 International Association for Great Lakes Research. Published by Elsevier B.V. All rights reserved.
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
Materials and methods Site description and sample collection The Ottawa National Wildlife Refuge (ONWR) provides a protected habitat for avian species, including Canada geese. Study sites were located in two areas, the ONWR and the swimming beach of the adjacent Magee Marsh Wildlife Area (MMWA), along the southwestern shore of Lake Erie at Oak Harbor, Ohio, USA (Fig. 1). The west and south
477
sides of the ONWR are surrounded by an agricultural area in northwestern Ohio. Water samples were collected at four locations along Crane Creek in the ONWR and at the MMWA swimming beach from May to December, 2012 (Fig. 1). A total of 71 water samples were collected, with 18 samples from Sites 1, 2, 3 and 17 samples from Site 4. Water samples were collected according to the USEPA's direct method of surface water sampling using four sterile 800 mL Whirl-Pak bags (Nasco, Fort Atkinson, WI) at each site. Using global positioning system (GPS) and onsite landmarks (e.g. sign posts, trees, etc.), we ensured that
Fig. 1. Sampling sites of water and Canada geese feces at Ottawa National Wildlife Refuge. Diamonds show water sampling sites 1–4; circles denote the area where Canada geese feces were collected (modified from Rea et al., 2015).
478
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
water sample collection occurred at the same locations each time. Samples at Sites 1 and 3 were collected by wading into the water approximately 2 to 3 m from the shore (water depth ~ 1 m) and then opening each of the Whirl-Pak bags approximately 10 to 30 cm below the water's surface. Due to their physical characteristics, Site 2 (shallow) and 4 (gently sloping lake beach), and in order to collect water samples from a similar depth, the remaining two sites required wading farther from shore. Fecal samples (n = 77) were collected from multiple sites across ONWR (Fig. 1). Collection sites were determined by visually locating gaggles of Canada Geese. Fecal sample was identified (morphologically) at the sites where geese were present or were recently observed. Samples were randomly collected from the area in sterile 15 mL screw cap conical centrifuge tubes (Corning, Tewksbury, MA). Attempts were made to avoid any extraneous material (e.g. grass, rock, etc.) when scooping the fecal samples into the tubes. When necessary, a sterile tongue depressor was used to assist in maneuvering the fecal sample into the collection tube. Both water and fecal samples were placed on ice and transported to The Ohio State University laboratories where they were stored at 4 °C for further analysis. DNA extraction Water samples (100 mL) were filtered through a mixed cellulose ester membrane for DNA extraction (pore size 0.45 μm, Millipore, Billerica, MA). Total DNA of the water samples was extracted using MO BIO PowerWater DNA Isolation kits (MO BIO Laboratories, Inc., Carlsbad, CA). One hundred milligrams of geese feces were used for total fecal DNA extraction using MO BIO PowerSoil DNA Isolation kits (MO BIO Laboratories, Inc.). The final eluate for each of the samples was 100 μL. The DNA concentrations were measured using a Qubit Fluorometer (Life Technologies, Grand Island, NY). The concentrations of DNA ranged from 0.46 to 77.21 ng/μL. All DNA extracts were stored at −20 °C for further analysis. Detection of stx2 All of the primers for stx2 detection and DGGE are shown in Table 1. Among the primers used, stx2R2, stx2FD and stx2RDG were designed in this study. An online OligoAnalyzer® Tool (https://www.idtdna.com/ calc/analyzer) was used for developing these primers. Presence of the stx2 gene in each of the fecal samples was determined by PCR. A total volume of 20 μL of PCR mixture contained 2 μL of template DNA, 500 nM of stx2F (forward) and stx2R (reverse) primers (Sigma-Aldrich, St. Louis, MO, Table 1), 250 nM of dNTP (ThermoScientific Inc., Waltham, MA)., 250 nM of MgCl2 (ThermoScientific), 2 μL 10X Taq buffer (ThermoScientific), and 0.5 U Taq polymerase (ThermoScientific). Thermal cycling included an initialization at 94°C for 10 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s. The final extension was 10 min at 72°C. The PCR products were examined by electrophoresis on 1% agarose gels. The agarose gels were supplemented with 0.2 μg/mL of ethidium
Table 1 Primers and probes used in this study. Gene
Primers/Probes
Sequences
Reference
stx2
stx2F stx2R stx2R2
ATTAACCACACCCCACCG GTCATGGAAACCGTTGTCAC GGTCAAAACGCGCCTGATTAG CAGTTATTTTGCTGTGGATATA CGAGGGCTTG GGCACTGTCTGAAACTGCTCCTGT ACCAGAATGTCAGATAACTGGCGA ATTAAACTGCACTTCAGCAAATCC CGCCCGCCGCGCCCCGCGCCCGTC CCGCCGCCCCCGCCCG ATTAAACTGCACTTCAGCAAATCC
Ibekwe et al. (2002) Ibekwe et al. (2002) This study
stx2P stx2FD1 stx2FD stx2RD stx2RDG
Ibekwe et al. (2002) Persson et al. (2007) This study Persson et al. (2007) This study
bromide for gel imaging. The presence of stx2 in each of the water samples was determined by a StepOne Real-Time PCR system (Life Technologies). A total volume of 20 μL of PCR mixture contained 2 μL of one-toten diluted DNA extract, 333 nM of stx2F and stx2R2 (reverse) primers (Sigma-Aldrich), 250 nM stx2P probe (Eurofins MWG Operon LLC, Huntsville, AL, Table 1), and 10 μL of TaqMan Universal PCR Mastermix (Applied Biosystems, Foster City, CA). Thermal cycling included an initialization at 95°C for 5 min, followed by 45 cycles of denaturation at 95°C for 15 s and annealing/extension at 60°C for 1 min. Positive signal of amplification was considered presence of stx2 (Ibekwe et al., 2002). To establish markers with known copy numbers, stx2 was amplified from DNA extracts from E. coli O157:H7 EDL933 using stx2F and stx2R2 (Table 1) in a MultiGene Gradient Thermal Cycler (Labnet, Edison, NJ). Amplified DNA was examined on agarose gel supplemented with 0.2 μg/mL of ethidium bromide and purified using QIAquick PCR purification kits (Qiagen, Valencia, CA). The purified DNA was ligated into pGEM-T vector (Promega, Madison, WI) and transformed into E. coli DH5α competent cells by heat shock transformation. The transformed plasmids were extracted using QIAprep Spin miniprep kits (Qiagen). DNA concentrations were determined by a Qubit Fluorometer (Life Technologies). Ten-fold serial dilutions of the transformed plasmids were prepared and applied to real-time PCR analysis. A standard curve of threshold cycle (Ct) values against known gene copy numbers of stx2 was established. Samples with detected markers, but below the limit of quantification (detectable-but-not-quantifiable), were marked as “presence of stx2.”
Denaturing-gradient gel electrophoresis (DGGE) Amplification of stx2 was conducted by semi-nested PCR. A total volume of 20 μL of PCR mixture contained 1 μL of template DNA, 500 nM of stx2FD1 (forward) and stx2RD (reverse) primers (SigmaAldrich, Table 1), 250 nM of dNTP (ThermoScientific Inc., Waltham, MA)., 250 nM of MgCl2 (ThermoScientific), 2 μL 10X Taq buffer (ThermoScientific), and 0.5 U Taq polymerase (ThermoScientific). Thermal cycling included an initialization at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s. The final extension was 10 min at 72°C. For the secondary PCR, A total volume of 30 μL of PCR mixture contained 0.5 μL of the primary PCR products, 500 nM of stx2FD (forward) and stx2RDG (reverse, with GC-Clamp) primers (SigmaAldrich, Table 1), 250 nM dNTP (ThermoScientific Inc., Waltham, MA)., MgCl2 (ThermoScientific), 3 μL 10X Taq buffer (ThermoScientific), and 0.5 U Taq polymerase (ThermoScientific). Thermal cycling conditions
Table 2 Reference sequences of stx2 variants and STEC serotypes used in this study (Scheutz et al., 2012). stx2 variants
Source serotypes
Accession no.
stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2b stx2c stx2d stx2e stx2f stx2g
O48:H21 O157:H7 O165:H25 O111:HO26:H11 O178:H19 O22:H8 O113:H21 O101:H10 O104:H21 O8:H19 O118:H12 O174:H21 O73:H18 O139:K12:H1 O128:H2 O2:H25
Z37725 X07865 AY633471 EF441609 AJ272135 FM998856 AY443054 EF441618 AY443052 EF441619 AY633459 AF043627 L11079 DQ059012 M21534 AJ010730 AY286000
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
479
Table 3 Monthly prevalence of stx2 in fecal and water samples collected from the Ottawa National Wildlife Refugee. Samples Fecal (n/N) Water (n/N)
June
July
August
September
October
November
December
Total
0.0 (0/15) 18.8 (3/16)
24.0 (6/25) 10.0 (2/20)
5.9 (1/17) 0.0 (0/16)
0.0 (0/5) 0.0 (0/7)
0.0 (0/5) 0.0 (0/4)
100.0 (5/5) 0.0 (0/4)
80.0 (4/5) 0.0 (0/4)
20.8 (16/77) 7.0 (5/71)
n: stx2-positive samples; N: total samples.
for the secondary PCR were identical to those for the primary PCR except that an annealing temperature was set at 63°C. The PCR products were resolved at 60°C using an INGENYphorU system (Ingeny, Leiden, The Netherlands) with an 8% polyacrylamide gel (37.5:1) with a 10%– 35% denaturant gradient at 80 V for 1 h and then at 160 V for 15 h. Analysis of gel images were conducted using an AlphaImager HP System (ProteinSimple, Santa Clara, CA) as described previously (Yu and Morrison, 2004). Sequence analysis of DGGE bands Selected DGGE bands were excised under UV transillumination. The DNA was extracted from the gel by placing each gel slice into 30 μL of nuclease-free water and holding at 4°C for 24 h. Two micro liter of each DNA extract was used in PCR to re-amplify the stx2 gene for cloning. The PCR was performed as described in the previous DGGE section, except for an annealing temperature at 58°C and extension for 40 s during the 35 cycles. The PCR products were purified using a QIAquick PCR Purification Kit (Qiagen) and ligated into the pGEM-T vector (Promega). The ligation products were transformed into E. coli DH5α competent cells at 42°C for 45 s. Seventeen stx2-positive colonies were identified using blue-white selection and confirmed using PCR as previously described. The plasmids containing stx2 fragments were extracted from overnight LB broth cultures supplemented with ampicillin using a QIAprep Spin Miniprep Kit (Qiagen) and used as the templates for Sanger sequencing. Fifteen samples were sequenced successfully. Sequence alignment and genetic cluster analysis were performed with MEGA5 (Tamura et al., 2011). Reference sequences (Scheutz et al., 2012) of stx2 variants and of stx2a of different STEC serotypes (Table 2) were included in the analysis. Results and discussion The stx2 gene was detected in 20.8% (16/77) of geese fecal samples and 7.0% (5/71) of water samples. Monthly prevalence of stx2 was
shown in Table 3. Among the fecal samples, the months of November and December showed the highest detection rate of stx2 (100% and 80%, respectively). However, no such trend was found among the water samples. In eastern Lake Erie, Smith et al. (2009) found a prevalence of 10.3% (34/329) in beach water, which was slightly higher than found in this study in western Lake Erie. It has been estimated that low infectious doses ranging from 1 to 100 CFU were able to cause O111:H– and O157:H7 infections (Griffin et al., 1994; Paton et al., 1996). Although the STEC toxin levels were not determined in this study, existence of stx is presumed to be associated with a certain degree of health risk by STEC infection in the Lake Erie recreational area. The stx2-positive fecal DNA extracts were subject to DGGE analysis to evaluate the diversity of stx2 variants and STEC serotypes. The DGGE data show a low diversity of stx2 variants among different geese fecal samples, indicating a similar distribution among the individual geese at different times of the year. In addition, multiple DGGE bands from single DNA extracts indicated that some of the geese carried multiple stx2 variants (Fig. 2). Seventeen DGGE bands were randomly selected, excised, and subjected to sequencing to further identify the stx2 variants. Fifteen high quality sequences were aligned and compared with the reference sequences of the stx2 variants (Table 2). The genetic cluster analysis demonstrated that all fifteen stx2 sequences from geese fecal samples belonged to one single genetic cluster and demonstrated a low genetic diversity (Fig. 3). Although not specific to stx2, a genotype analysis also showed that fecal samples of Canada geese had the lowest genetic diversity of E. coli, compared to those of other waterfowl species, such as gulls, ducks, and mallards collected in British Columbia, Canada (Chandran and Mazumder, 2014). A low stx2 genetic diversity was also found in river samples collected among four urban sites in Japan (Tani et al., 2007). The fifteen stx2 sequences were most similar to the stx2a variant (Fig. 3). Stx2a was reported to be more potent than Stx2b and Stx2c in vitro and in vivo (Fuller et al., 2011). A cohort study also found that Stx2a was associated with severe infections, including hemolytic uremic syndrome and bloody diarrhea (Persson et al., 2007).
Fig. 2. DGGE result of stx2 fragments from the geese fecal samples. Geese fecal sample ID is listed at the top, while DGGE band ID is provided adjacent to bands. These bands were randomly selected for further analysis.
480
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
the US (Mead et al., 1999). Although O165:H25 is not a major serotype of concern, isolates from it have been associated with hemolytic uremic syndrome and bloody diarrhea (Brooks et al., 2005), whereas E. coli O111:H– has been isolated from clinical stool samples and linked to several outbreaks in Ohio (1990), South Australia (1995), and Oklahoma (2008) (CDC, 1995; Banatvala et al., 1996; Piercefield et al., 2010). Shelton et al. (2006) surveyed E. coli serogroups from feces of urban Canada geese and reported that 6% of the isolates were serotyped as enterohemorrhagic strains (EHEC), which produce Shiga toxins as virulence agents, although stx genes were not reported for the isolates (Kullas et al., 2002) Collectively, this study indicated the potential existence of STEC or other Shiga toxin-producing bacteria in feces of Canada geese due to the presence of stx2. Occurrence of genetic material does not necessarily equate to the presence of viable bacteria or toxin, however, given that the stx2 were associated with a high potent toxin variant and several outbreak-causing serotypes, further investigations (e.g. bacterial isolation) are suggested to elucidate potential public health risks in Lake Erie recreational areas and the role of Canada geese as a reservoir and distributor of this pathogenic, Shiga toxin-producing Escherichia coli. Conclusion Fig. 3. A dendrogram showing the sequenced stx2 fragments and the reference stx2 variants (Scheutz et al., 2012). Length of the scare bar shows 0.01 changes per nucleotide position.
The fifteen sequences were also compared to the reference stx2a sequences of different STEC serotypes (Table 2). The results indicated that all fifteen sequences had a close relationship with those of E. coli serotype O157:H7, O165:H25 and O111:H– (Fig. 4). The O157:H7 serotype is the main etiological agent causing foodborne STEC infection in
Shiga toxin gene was detected in feces of Canada geese (20.8%) and water (7.0%) collected from a western Lake Erie beach and adjacent wetlands. Toxin genes were most similar to a high potency toxin form (Stx2a) and to outbreak-causing strains (E. coli O157:H7, O165:H25 and O111:H–). Detection of the toxin gene may indicate the presence of Shiga toxin-producing E. coli and thus existence of a potential public health hazard. Further investigations such as bacterial isolation and characterization are recommended to fully elucidate the roles of Canada geese in pathogen dissemination in Lake Erie recreational areas. Acknowledgments The authors greatly acknowledge the Ohio Sea Grant for partial support in collecting geese fecal and water samples. We thank Ottawa National Wildlife Refuge and their Wildlife Biologist, Ron Huffman, for letting us collect samples. We also thank Dr. Lingling Wang, Dr. YuehFen Li and Jill Stephens for their assistance with DGGE and data analysis, Dr. Jeffrey LeJeune for providing DNA extracts for positive control, and Dr. Bruce Casto for editing the manuscript. References
Fig. 4. A dendrogram showing the sequenced stx2 fragments and the reference stx2a of STEC serotypes (Scheutz et al., 2012). Length of the scare bar shows 0.01 changes per nucleotide position.
Abulreesh, H.H., Goulder, R., Scott, G.W., 2007. Wild birds and human pathogens in the context of ringing and migration. Ringing Migr. 23, 193–200. Banatvala, N., Debeukelaer, M.M., Griffin, P.M., Barrett, T.J., Greene, K.D., Green, J.H., Wells, J.G., 1996. Shiga-like toxin-producing Escherichia coli O111 and associated hemolyticuremic syndrome: a family outbreak. Pediatr. Infect. Dis. J. 15, 1008–1011. Brooks, J.T., Sowers, E.G., Wells, J.G., Greene, K.D., Griffin, P.M., Hoekstra, R.M., Strockbine, N.A., 2005. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. J. Infect. Dis. 192, 1422–1429. Centers for Disease Control and Prevention, 1995. Community outbreak of hemolytic uremic syndrome attributable to Escherichia coli O111:NM — South Australia, 1995. Morb. Mortal. Wkly Rep. 44 (550–551), 557–558. Chandran, A., Mazumder, A., 2014. Occurrence of diarrheagenic virulence genes and genetic diversity in Escherichia coli isolates from fecal material of various avian hosts in British Columbia, Canada. Appl. Environ. Microbiol. 80, 1933–1940. Fuller, C.A., Pellino, C.A., Flagler, M.J., Strasser, J.E., Weiss, A.A., 2011. Shiga toxin subtypes display dramatic differences in potency. Infect. Immun. 79, 1329–1337. Griffin, P.M., Bell, B.P., Cieslak, P.R., Tuttle, J., Barrett, T.J., Doyle, M.P., McNamara, A.M., Shefer, A.M., Wells, J.G., 1994. Large outbreak of Escherichia coli O157:H7 infections in the Western United States: the big picture. In: Karmali, M.A., Goglio, A.G. (Eds.), Recent Advances in Verocytotoxin-Producing Escherichia coli Infections. Elsevier Science B.V., Amsterdam, The Netherlands, pp. 7–12. Ibekwe, A.M., Watt, P.M., Grieve, C.M., Sharma, V.K., Lyons, S.R., 2002. Multiplex fluorogenic real-time PCR for detection and quantification of Escherichia coli O157: H7 in dairy wastewater wetlands. Appl. Environ. Microbiol. 68, 4853–4862. Kullas, H., Coles, M., Rhyan, J., Clark, L., 2002. Prevalence of Escherichia coli serogroups and human virulence factors in faeces of urban Canada geese (Branta canadensis). Int. J. Environ. Health Res. 12, 153–162.
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481 Makino, S., Kobori, H., Asakura, H., Watarai, M., Shirahata, T., Ikeda, T., Takeshi, K., Tsukamoto, T., 2000. Detection and characterization of Shiga toxin-producing Escherichia coli from seagulls. Epidemiol. Infect. 125, 55–61. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., Tauxe, R.V., 1999. Food-related illness and death in the United States. Emerg. Infect. Dis. 5, 607–625. Paton, A.W., Ratcliff, R., Doyle, R.M., Seymour-Murray, J., Davos, D., Lanser, J.A., Paton, J.C., 1996. Molecular microbiological investigation of an outbreak of hemolytic uremic syndrome caused by dry fermented sausage contaminated with Shiga-like toxinproducing Escherichia coli. J. Clin. Microbiol. 34, 1622–1627. Persson, S., Olsen, K.E.P., Ethelberg, S., Scheutz, F., 2007. Subtyping method for Escherichia coli Shiga toxin (verocytotoxin) 2 variants and correlations to clinical manifestations. J. Clin. Microbiol. 45, 2020–2024. Piercefield, E.W., Bradley, K.K., Coffman, R.L., Mallonee, S.M., 2010. Hemolytic uremic syndrome after an Escherichia coli O111 outbreak. Arch. Intern. Med. 170, 1656–1663. Rangel, J.M., Sparling, P.H., Crowe, C., Griffin, P.M., Swerdlow, D.L., 2005. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982–2002. Emerg. Infect. Dis. 11, 603–609. Rea, C.L., Bisesi, M.S., Mitsch, W., Andridge, R., Lee, J., 2015. Human health-related ecosystem services of avian-dense coastal wetlands adjacent to a western Lake Erie swimming beach. EcoHealth 12, 77–87.
481
Scheutz, F., Teel, L.D., Beutin, L.B., Piérard, D., Buvens, G., Karch, H., Mellmann, Caprioli, A., Tozzoli, R., Morabito, S., Strockbine, N.A., Melton-Celsa, A.R., Sanchez, M., Persson, S., O ′Brien, A.D., 2012. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J. Clin. Microbiol. 50, 2951–2963. Shelton, D.R., Karns, J.S., Higgins, J.A., Van Kessel, J.A.S., Perdue, M.L., Belt, K.T., Russell-Anelli, J., DebRoy, C., 2006. Impact of microbial diversity on rapid detection of enterohemorrhagic Escherichia coli in surface waters. FEMS Microbiol. Lett. 261, 95–101. Smith, C.J., Olszewski, A.M., Mauro, S.A., 2009. Correlation of Shiga toxin gene frequency with commonly used microbial indicators of recreational water quality. Appl. Environ. Microbiol. 75, 316–321. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis program for automated and iterative data analysis. Bioinformatics 28, 2685–2686. Tani, K., Kaneshige, M., Nasu, M., 2007. Distribution and diversity of Shiga toxin 2 gene in urban rivers. J. Health Sci. 53, 486–490. Wang, Y., Tang, C., Yu, X., Xia, M., Yue, H., 2010. Distribution of serotypes and virulenceassociated genes in pathogenic Escherichia coli isolated from ducks. Avian Pathol. 39, 297–302. Yu, Z., Morrison, M., 2004. Comparisons of different hypervariable regions of rrs genes for use in fingerprinting of microbial communities by PCR-denaturing gradient gel electrophoresis. Appl. Environ. Microbiol. 70, 4800–4806.
Contents lists available at ScienceDirect
Journal of Great Lakes Research journal homepage: www.elsevier.com/locate/jglr
Prevalence and diversity of Shiga toxin genes in Canada geese and water in western Lake Erie Region Tsung-Ta David Hsu a, Chris L. Rea b, Zhongtang Yu a,c, Jiyoung Lee a,b,d,⁎ a
Environmental Science Graduate Program, The Ohio State University, Columbus, OH, USA College of Public Health, Division of Environmental Health Sciences, The Ohio State University, Columbus, OH, USA Department of Animal Sciences, The Ohio State University, Columbus, OH, USA d Department of Food Science & Technology, The Ohio State University, Columbus, OH, USA b c
a r t i c l e
i n f o
Article history: Received 19 June 2015 Accepted 11 November 2015 Available online 12 January 2016 Communicated by R. Michael McKay Index words: Shiga toxin-producing Escherichia coli (STEC) Canada geese Lake Erie Wetlands Beach
a b s t r a c t Shiga toxin-producing Escherichia coli (STEC) poses a major health risk by causing gastrointestinal illness and has been isolated from wild birds, including Canada geese (Branta canadensis). The major virulence factor for STEC infection is Shiga toxin. This study was designed to evaluate the occurrence and diversity of the Shiga toxin gene (stx) in Canada geese in the western Lake Erie region. Samples were collected from the Ottawa National Wildlife Refuge (ONWR) at Oak Harbor, Ohio from June to December, 2012, and occurrence of the stx gene was determined using polymerase chain reaction (PCR). Genetic diversity of stx variants among the fecal samples was examined using denaturing-gradient gel electrophoresis (DGGE). The Shiga toxin gene 2 (stx2) variant were detected in 20.8% (n = 77) of the geese fecal samples and 7% (n = 71) of the water samples. DGGE and clustering analysis showed a low stx2 diversity and single genetic lineage of all the stx2 fragments. All the stx2 sequences from excised DGGE bands were similar to those from a toxin form of high potency (stx2a) and those from reported outbreak-causing serotypes (E. coli O157:H7, O165:H25, and O111:H–). Detection of stx from Canada geese suggested that viable Shiga toxin-producing Escherichia coli may be present. Further investigations, such as bacterial isolation, are suggested to better understand potential public health hazards in Lake Erie recreational areas, the role of Canada geese as a reservoir of Shiga toxin-producing Escherichia coli, and dissemination of these pathogenic bacteria. © 2016 International Association for Great Lakes Research. Published by Elsevier B.V. All rights reserved.
Introduction In the United States, it is estimated that more than 110,000 cases of gastrointestinal illness are caused each year by Shiga toxin-producing Escherichia coli (STEC), with the majority of these cases attributed to E. coli O157:H7 (Mead et al., 1999). The major transmission route of E. coli O157:H7 is food (beef and produce); however, it can also be disseminated via other pathways, including animal contact and exposure via recreational and drinking water (Rangel et al., 2005). Shiga toxins are the main virulence factors of STEC, which are composed of two toxin types: Shiga toxin 1 (Stx1) and Shiga toxin 2 (Stx2). It has been shown that Stx2 has higher toxicity and genetic variance than Stx1, with the Stx2a and Stx2d having a higher potency than Stx2b and Stx2c (Fuller et al., 2011). Based on the diversity of the coding sequences, a subtyping method for stx2 has been developed that targets partial sequences of the stxAB2 operon. It has been shown that Stx2 subtypes (Stx2a and Stx2c) are the primary cause of hemolytic uremic
⁎ Corresponding author at: College of Public Health, Division of Environmental Health Sciences, 1841 Neil Ave., 406 Cunz Hall, Columbus, OH 43210, USA. Tel.: +1 614 292 5546. E-mail address: [email protected] (J. Lee).
syndrome (HUS) and bloody diarrhea among patients (Persson et al., 2007). Shiga toxin genes have been detected in various environments, including lake water (Smith et al., 2009), urban surface waters and sediments (Shelton et al., 2006; Tani et al., 2007). Waterfowl may harbor human pathogens and facilitate their dissemination over long distance (Abulreesh et al., 2007). In fact, Shiga toxin genes have been found in seagulls (Makino et al., 2000), ducks (Wang et al., 2010) and mallards (Chandran and Mazumder, 2014). Among waterfowl species, Canada geese feces have been found to contain several human enteric pathogens, including various STEC serotypes (Kullas et al., 2002). Because Canada geese reside in urban, agricultural, and recreational areas, it is highly probable that Canada geese can spread geese-harbored pathogens. It has been reported that stx2 has about a 10% prevalence in water samples collected from the eastern portion of Lake Erie (Smith et al., 2009); however, no previous study has been conducted on the western end of Lake Erie. The objectives of this study were (1) to evaluate the prevalence of stx2 in water and fecal samples collected from Canada geese in the western Lake Erie area; and (2) to examine the genetic variance of stx2 among different fecal samples from Canada geese. The findings of this study may help public health professionals and officials to better address potential zoonotic disease transmission risks from wildlife in recreational areas.
http://dx.doi.org/10.1016/j.jglr.2015.12.003 0380-1330/© 2016 International Association for Great Lakes Research. Published by Elsevier B.V. All rights reserved.
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
Materials and methods Site description and sample collection The Ottawa National Wildlife Refuge (ONWR) provides a protected habitat for avian species, including Canada geese. Study sites were located in two areas, the ONWR and the swimming beach of the adjacent Magee Marsh Wildlife Area (MMWA), along the southwestern shore of Lake Erie at Oak Harbor, Ohio, USA (Fig. 1). The west and south
477
sides of the ONWR are surrounded by an agricultural area in northwestern Ohio. Water samples were collected at four locations along Crane Creek in the ONWR and at the MMWA swimming beach from May to December, 2012 (Fig. 1). A total of 71 water samples were collected, with 18 samples from Sites 1, 2, 3 and 17 samples from Site 4. Water samples were collected according to the USEPA's direct method of surface water sampling using four sterile 800 mL Whirl-Pak bags (Nasco, Fort Atkinson, WI) at each site. Using global positioning system (GPS) and onsite landmarks (e.g. sign posts, trees, etc.), we ensured that
Fig. 1. Sampling sites of water and Canada geese feces at Ottawa National Wildlife Refuge. Diamonds show water sampling sites 1–4; circles denote the area where Canada geese feces were collected (modified from Rea et al., 2015).
478
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
water sample collection occurred at the same locations each time. Samples at Sites 1 and 3 were collected by wading into the water approximately 2 to 3 m from the shore (water depth ~ 1 m) and then opening each of the Whirl-Pak bags approximately 10 to 30 cm below the water's surface. Due to their physical characteristics, Site 2 (shallow) and 4 (gently sloping lake beach), and in order to collect water samples from a similar depth, the remaining two sites required wading farther from shore. Fecal samples (n = 77) were collected from multiple sites across ONWR (Fig. 1). Collection sites were determined by visually locating gaggles of Canada Geese. Fecal sample was identified (morphologically) at the sites where geese were present or were recently observed. Samples were randomly collected from the area in sterile 15 mL screw cap conical centrifuge tubes (Corning, Tewksbury, MA). Attempts were made to avoid any extraneous material (e.g. grass, rock, etc.) when scooping the fecal samples into the tubes. When necessary, a sterile tongue depressor was used to assist in maneuvering the fecal sample into the collection tube. Both water and fecal samples were placed on ice and transported to The Ohio State University laboratories where they were stored at 4 °C for further analysis. DNA extraction Water samples (100 mL) were filtered through a mixed cellulose ester membrane for DNA extraction (pore size 0.45 μm, Millipore, Billerica, MA). Total DNA of the water samples was extracted using MO BIO PowerWater DNA Isolation kits (MO BIO Laboratories, Inc., Carlsbad, CA). One hundred milligrams of geese feces were used for total fecal DNA extraction using MO BIO PowerSoil DNA Isolation kits (MO BIO Laboratories, Inc.). The final eluate for each of the samples was 100 μL. The DNA concentrations were measured using a Qubit Fluorometer (Life Technologies, Grand Island, NY). The concentrations of DNA ranged from 0.46 to 77.21 ng/μL. All DNA extracts were stored at −20 °C for further analysis. Detection of stx2 All of the primers for stx2 detection and DGGE are shown in Table 1. Among the primers used, stx2R2, stx2FD and stx2RDG were designed in this study. An online OligoAnalyzer® Tool (https://www.idtdna.com/ calc/analyzer) was used for developing these primers. Presence of the stx2 gene in each of the fecal samples was determined by PCR. A total volume of 20 μL of PCR mixture contained 2 μL of template DNA, 500 nM of stx2F (forward) and stx2R (reverse) primers (Sigma-Aldrich, St. Louis, MO, Table 1), 250 nM of dNTP (ThermoScientific Inc., Waltham, MA)., 250 nM of MgCl2 (ThermoScientific), 2 μL 10X Taq buffer (ThermoScientific), and 0.5 U Taq polymerase (ThermoScientific). Thermal cycling included an initialization at 94°C for 10 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s. The final extension was 10 min at 72°C. The PCR products were examined by electrophoresis on 1% agarose gels. The agarose gels were supplemented with 0.2 μg/mL of ethidium
Table 1 Primers and probes used in this study. Gene
Primers/Probes
Sequences
Reference
stx2
stx2F stx2R stx2R2
ATTAACCACACCCCACCG GTCATGGAAACCGTTGTCAC GGTCAAAACGCGCCTGATTAG CAGTTATTTTGCTGTGGATATA CGAGGGCTTG GGCACTGTCTGAAACTGCTCCTGT ACCAGAATGTCAGATAACTGGCGA ATTAAACTGCACTTCAGCAAATCC CGCCCGCCGCGCCCCGCGCCCGTC CCGCCGCCCCCGCCCG ATTAAACTGCACTTCAGCAAATCC
Ibekwe et al. (2002) Ibekwe et al. (2002) This study
stx2P stx2FD1 stx2FD stx2RD stx2RDG
Ibekwe et al. (2002) Persson et al. (2007) This study Persson et al. (2007) This study
bromide for gel imaging. The presence of stx2 in each of the water samples was determined by a StepOne Real-Time PCR system (Life Technologies). A total volume of 20 μL of PCR mixture contained 2 μL of one-toten diluted DNA extract, 333 nM of stx2F and stx2R2 (reverse) primers (Sigma-Aldrich), 250 nM stx2P probe (Eurofins MWG Operon LLC, Huntsville, AL, Table 1), and 10 μL of TaqMan Universal PCR Mastermix (Applied Biosystems, Foster City, CA). Thermal cycling included an initialization at 95°C for 5 min, followed by 45 cycles of denaturation at 95°C for 15 s and annealing/extension at 60°C for 1 min. Positive signal of amplification was considered presence of stx2 (Ibekwe et al., 2002). To establish markers with known copy numbers, stx2 was amplified from DNA extracts from E. coli O157:H7 EDL933 using stx2F and stx2R2 (Table 1) in a MultiGene Gradient Thermal Cycler (Labnet, Edison, NJ). Amplified DNA was examined on agarose gel supplemented with 0.2 μg/mL of ethidium bromide and purified using QIAquick PCR purification kits (Qiagen, Valencia, CA). The purified DNA was ligated into pGEM-T vector (Promega, Madison, WI) and transformed into E. coli DH5α competent cells by heat shock transformation. The transformed plasmids were extracted using QIAprep Spin miniprep kits (Qiagen). DNA concentrations were determined by a Qubit Fluorometer (Life Technologies). Ten-fold serial dilutions of the transformed plasmids were prepared and applied to real-time PCR analysis. A standard curve of threshold cycle (Ct) values against known gene copy numbers of stx2 was established. Samples with detected markers, but below the limit of quantification (detectable-but-not-quantifiable), were marked as “presence of stx2.”
Denaturing-gradient gel electrophoresis (DGGE) Amplification of stx2 was conducted by semi-nested PCR. A total volume of 20 μL of PCR mixture contained 1 μL of template DNA, 500 nM of stx2FD1 (forward) and stx2RD (reverse) primers (SigmaAldrich, Table 1), 250 nM of dNTP (ThermoScientific Inc., Waltham, MA)., 250 nM of MgCl2 (ThermoScientific), 2 μL 10X Taq buffer (ThermoScientific), and 0.5 U Taq polymerase (ThermoScientific). Thermal cycling included an initialization at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s. The final extension was 10 min at 72°C. For the secondary PCR, A total volume of 30 μL of PCR mixture contained 0.5 μL of the primary PCR products, 500 nM of stx2FD (forward) and stx2RDG (reverse, with GC-Clamp) primers (SigmaAldrich, Table 1), 250 nM dNTP (ThermoScientific Inc., Waltham, MA)., MgCl2 (ThermoScientific), 3 μL 10X Taq buffer (ThermoScientific), and 0.5 U Taq polymerase (ThermoScientific). Thermal cycling conditions
Table 2 Reference sequences of stx2 variants and STEC serotypes used in this study (Scheutz et al., 2012). stx2 variants
Source serotypes
Accession no.
stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2a stx2b stx2c stx2d stx2e stx2f stx2g
O48:H21 O157:H7 O165:H25 O111:HO26:H11 O178:H19 O22:H8 O113:H21 O101:H10 O104:H21 O8:H19 O118:H12 O174:H21 O73:H18 O139:K12:H1 O128:H2 O2:H25
Z37725 X07865 AY633471 EF441609 AJ272135 FM998856 AY443054 EF441618 AY443052 EF441619 AY633459 AF043627 L11079 DQ059012 M21534 AJ010730 AY286000
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
479
Table 3 Monthly prevalence of stx2 in fecal and water samples collected from the Ottawa National Wildlife Refugee. Samples Fecal (n/N) Water (n/N)
June
July
August
September
October
November
December
Total
0.0 (0/15) 18.8 (3/16)
24.0 (6/25) 10.0 (2/20)
5.9 (1/17) 0.0 (0/16)
0.0 (0/5) 0.0 (0/7)
0.0 (0/5) 0.0 (0/4)
100.0 (5/5) 0.0 (0/4)
80.0 (4/5) 0.0 (0/4)
20.8 (16/77) 7.0 (5/71)
n: stx2-positive samples; N: total samples.
for the secondary PCR were identical to those for the primary PCR except that an annealing temperature was set at 63°C. The PCR products were resolved at 60°C using an INGENYphorU system (Ingeny, Leiden, The Netherlands) with an 8% polyacrylamide gel (37.5:1) with a 10%– 35% denaturant gradient at 80 V for 1 h and then at 160 V for 15 h. Analysis of gel images were conducted using an AlphaImager HP System (ProteinSimple, Santa Clara, CA) as described previously (Yu and Morrison, 2004). Sequence analysis of DGGE bands Selected DGGE bands were excised under UV transillumination. The DNA was extracted from the gel by placing each gel slice into 30 μL of nuclease-free water and holding at 4°C for 24 h. Two micro liter of each DNA extract was used in PCR to re-amplify the stx2 gene for cloning. The PCR was performed as described in the previous DGGE section, except for an annealing temperature at 58°C and extension for 40 s during the 35 cycles. The PCR products were purified using a QIAquick PCR Purification Kit (Qiagen) and ligated into the pGEM-T vector (Promega). The ligation products were transformed into E. coli DH5α competent cells at 42°C for 45 s. Seventeen stx2-positive colonies were identified using blue-white selection and confirmed using PCR as previously described. The plasmids containing stx2 fragments were extracted from overnight LB broth cultures supplemented with ampicillin using a QIAprep Spin Miniprep Kit (Qiagen) and used as the templates for Sanger sequencing. Fifteen samples were sequenced successfully. Sequence alignment and genetic cluster analysis were performed with MEGA5 (Tamura et al., 2011). Reference sequences (Scheutz et al., 2012) of stx2 variants and of stx2a of different STEC serotypes (Table 2) were included in the analysis. Results and discussion The stx2 gene was detected in 20.8% (16/77) of geese fecal samples and 7.0% (5/71) of water samples. Monthly prevalence of stx2 was
shown in Table 3. Among the fecal samples, the months of November and December showed the highest detection rate of stx2 (100% and 80%, respectively). However, no such trend was found among the water samples. In eastern Lake Erie, Smith et al. (2009) found a prevalence of 10.3% (34/329) in beach water, which was slightly higher than found in this study in western Lake Erie. It has been estimated that low infectious doses ranging from 1 to 100 CFU were able to cause O111:H– and O157:H7 infections (Griffin et al., 1994; Paton et al., 1996). Although the STEC toxin levels were not determined in this study, existence of stx is presumed to be associated with a certain degree of health risk by STEC infection in the Lake Erie recreational area. The stx2-positive fecal DNA extracts were subject to DGGE analysis to evaluate the diversity of stx2 variants and STEC serotypes. The DGGE data show a low diversity of stx2 variants among different geese fecal samples, indicating a similar distribution among the individual geese at different times of the year. In addition, multiple DGGE bands from single DNA extracts indicated that some of the geese carried multiple stx2 variants (Fig. 2). Seventeen DGGE bands were randomly selected, excised, and subjected to sequencing to further identify the stx2 variants. Fifteen high quality sequences were aligned and compared with the reference sequences of the stx2 variants (Table 2). The genetic cluster analysis demonstrated that all fifteen stx2 sequences from geese fecal samples belonged to one single genetic cluster and demonstrated a low genetic diversity (Fig. 3). Although not specific to stx2, a genotype analysis also showed that fecal samples of Canada geese had the lowest genetic diversity of E. coli, compared to those of other waterfowl species, such as gulls, ducks, and mallards collected in British Columbia, Canada (Chandran and Mazumder, 2014). A low stx2 genetic diversity was also found in river samples collected among four urban sites in Japan (Tani et al., 2007). The fifteen stx2 sequences were most similar to the stx2a variant (Fig. 3). Stx2a was reported to be more potent than Stx2b and Stx2c in vitro and in vivo (Fuller et al., 2011). A cohort study also found that Stx2a was associated with severe infections, including hemolytic uremic syndrome and bloody diarrhea (Persson et al., 2007).
Fig. 2. DGGE result of stx2 fragments from the geese fecal samples. Geese fecal sample ID is listed at the top, while DGGE band ID is provided adjacent to bands. These bands were randomly selected for further analysis.
480
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481
the US (Mead et al., 1999). Although O165:H25 is not a major serotype of concern, isolates from it have been associated with hemolytic uremic syndrome and bloody diarrhea (Brooks et al., 2005), whereas E. coli O111:H– has been isolated from clinical stool samples and linked to several outbreaks in Ohio (1990), South Australia (1995), and Oklahoma (2008) (CDC, 1995; Banatvala et al., 1996; Piercefield et al., 2010). Shelton et al. (2006) surveyed E. coli serogroups from feces of urban Canada geese and reported that 6% of the isolates were serotyped as enterohemorrhagic strains (EHEC), which produce Shiga toxins as virulence agents, although stx genes were not reported for the isolates (Kullas et al., 2002) Collectively, this study indicated the potential existence of STEC or other Shiga toxin-producing bacteria in feces of Canada geese due to the presence of stx2. Occurrence of genetic material does not necessarily equate to the presence of viable bacteria or toxin, however, given that the stx2 were associated with a high potent toxin variant and several outbreak-causing serotypes, further investigations (e.g. bacterial isolation) are suggested to elucidate potential public health risks in Lake Erie recreational areas and the role of Canada geese as a reservoir and distributor of this pathogenic, Shiga toxin-producing Escherichia coli. Conclusion Fig. 3. A dendrogram showing the sequenced stx2 fragments and the reference stx2 variants (Scheutz et al., 2012). Length of the scare bar shows 0.01 changes per nucleotide position.
The fifteen sequences were also compared to the reference stx2a sequences of different STEC serotypes (Table 2). The results indicated that all fifteen sequences had a close relationship with those of E. coli serotype O157:H7, O165:H25 and O111:H– (Fig. 4). The O157:H7 serotype is the main etiological agent causing foodborne STEC infection in
Shiga toxin gene was detected in feces of Canada geese (20.8%) and water (7.0%) collected from a western Lake Erie beach and adjacent wetlands. Toxin genes were most similar to a high potency toxin form (Stx2a) and to outbreak-causing strains (E. coli O157:H7, O165:H25 and O111:H–). Detection of the toxin gene may indicate the presence of Shiga toxin-producing E. coli and thus existence of a potential public health hazard. Further investigations such as bacterial isolation and characterization are recommended to fully elucidate the roles of Canada geese in pathogen dissemination in Lake Erie recreational areas. Acknowledgments The authors greatly acknowledge the Ohio Sea Grant for partial support in collecting geese fecal and water samples. We thank Ottawa National Wildlife Refuge and their Wildlife Biologist, Ron Huffman, for letting us collect samples. We also thank Dr. Lingling Wang, Dr. YuehFen Li and Jill Stephens for their assistance with DGGE and data analysis, Dr. Jeffrey LeJeune for providing DNA extracts for positive control, and Dr. Bruce Casto for editing the manuscript. References
Fig. 4. A dendrogram showing the sequenced stx2 fragments and the reference stx2a of STEC serotypes (Scheutz et al., 2012). Length of the scare bar shows 0.01 changes per nucleotide position.
Abulreesh, H.H., Goulder, R., Scott, G.W., 2007. Wild birds and human pathogens in the context of ringing and migration. Ringing Migr. 23, 193–200. Banatvala, N., Debeukelaer, M.M., Griffin, P.M., Barrett, T.J., Greene, K.D., Green, J.H., Wells, J.G., 1996. Shiga-like toxin-producing Escherichia coli O111 and associated hemolyticuremic syndrome: a family outbreak. Pediatr. Infect. Dis. J. 15, 1008–1011. Brooks, J.T., Sowers, E.G., Wells, J.G., Greene, K.D., Griffin, P.M., Hoekstra, R.M., Strockbine, N.A., 2005. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. J. Infect. Dis. 192, 1422–1429. Centers for Disease Control and Prevention, 1995. Community outbreak of hemolytic uremic syndrome attributable to Escherichia coli O111:NM — South Australia, 1995. Morb. Mortal. Wkly Rep. 44 (550–551), 557–558. Chandran, A., Mazumder, A., 2014. Occurrence of diarrheagenic virulence genes and genetic diversity in Escherichia coli isolates from fecal material of various avian hosts in British Columbia, Canada. Appl. Environ. Microbiol. 80, 1933–1940. Fuller, C.A., Pellino, C.A., Flagler, M.J., Strasser, J.E., Weiss, A.A., 2011. Shiga toxin subtypes display dramatic differences in potency. Infect. Immun. 79, 1329–1337. Griffin, P.M., Bell, B.P., Cieslak, P.R., Tuttle, J., Barrett, T.J., Doyle, M.P., McNamara, A.M., Shefer, A.M., Wells, J.G., 1994. Large outbreak of Escherichia coli O157:H7 infections in the Western United States: the big picture. In: Karmali, M.A., Goglio, A.G. (Eds.), Recent Advances in Verocytotoxin-Producing Escherichia coli Infections. Elsevier Science B.V., Amsterdam, The Netherlands, pp. 7–12. Ibekwe, A.M., Watt, P.M., Grieve, C.M., Sharma, V.K., Lyons, S.R., 2002. Multiplex fluorogenic real-time PCR for detection and quantification of Escherichia coli O157: H7 in dairy wastewater wetlands. Appl. Environ. Microbiol. 68, 4853–4862. Kullas, H., Coles, M., Rhyan, J., Clark, L., 2002. Prevalence of Escherichia coli serogroups and human virulence factors in faeces of urban Canada geese (Branta canadensis). Int. J. Environ. Health Res. 12, 153–162.
T.-T.D. Hsu et al. / Journal of Great Lakes Research 42 (2016) 476–481 Makino, S., Kobori, H., Asakura, H., Watarai, M., Shirahata, T., Ikeda, T., Takeshi, K., Tsukamoto, T., 2000. Detection and characterization of Shiga toxin-producing Escherichia coli from seagulls. Epidemiol. Infect. 125, 55–61. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., Tauxe, R.V., 1999. Food-related illness and death in the United States. Emerg. Infect. Dis. 5, 607–625. Paton, A.W., Ratcliff, R., Doyle, R.M., Seymour-Murray, J., Davos, D., Lanser, J.A., Paton, J.C., 1996. Molecular microbiological investigation of an outbreak of hemolytic uremic syndrome caused by dry fermented sausage contaminated with Shiga-like toxinproducing Escherichia coli. J. Clin. Microbiol. 34, 1622–1627. Persson, S., Olsen, K.E.P., Ethelberg, S., Scheutz, F., 2007. Subtyping method for Escherichia coli Shiga toxin (verocytotoxin) 2 variants and correlations to clinical manifestations. J. Clin. Microbiol. 45, 2020–2024. Piercefield, E.W., Bradley, K.K., Coffman, R.L., Mallonee, S.M., 2010. Hemolytic uremic syndrome after an Escherichia coli O111 outbreak. Arch. Intern. Med. 170, 1656–1663. Rangel, J.M., Sparling, P.H., Crowe, C., Griffin, P.M., Swerdlow, D.L., 2005. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982–2002. Emerg. Infect. Dis. 11, 603–609. Rea, C.L., Bisesi, M.S., Mitsch, W., Andridge, R., Lee, J., 2015. Human health-related ecosystem services of avian-dense coastal wetlands adjacent to a western Lake Erie swimming beach. EcoHealth 12, 77–87.
481
Scheutz, F., Teel, L.D., Beutin, L.B., Piérard, D., Buvens, G., Karch, H., Mellmann, Caprioli, A., Tozzoli, R., Morabito, S., Strockbine, N.A., Melton-Celsa, A.R., Sanchez, M., Persson, S., O ′Brien, A.D., 2012. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J. Clin. Microbiol. 50, 2951–2963. Shelton, D.R., Karns, J.S., Higgins, J.A., Van Kessel, J.A.S., Perdue, M.L., Belt, K.T., Russell-Anelli, J., DebRoy, C., 2006. Impact of microbial diversity on rapid detection of enterohemorrhagic Escherichia coli in surface waters. FEMS Microbiol. Lett. 261, 95–101. Smith, C.J., Olszewski, A.M., Mauro, S.A., 2009. Correlation of Shiga toxin gene frequency with commonly used microbial indicators of recreational water quality. Appl. Environ. Microbiol. 75, 316–321. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis program for automated and iterative data analysis. Bioinformatics 28, 2685–2686. Tani, K., Kaneshige, M., Nasu, M., 2007. Distribution and diversity of Shiga toxin 2 gene in urban rivers. J. Health Sci. 53, 486–490. Wang, Y., Tang, C., Yu, X., Xia, M., Yue, H., 2010. Distribution of serotypes and virulenceassociated genes in pathogenic Escherichia coli isolated from ducks. Avian Pathol. 39, 297–302. Yu, Z., Morrison, M., 2004. Comparisons of different hypervariable regions of rrs genes for use in fingerprinting of microbial communities by PCR-denaturing gradient gel electrophoresis. Appl. Environ. Microbiol. 70, 4800–4806.