- Email: [email protected]
Prevalence of Active Hepatitis C Virus Infection in Patients with Systemic Lupus Erythematosus
Prevalence of Active Hepatitis C Virus Infection in Patients with Systemic Lupus Erythematosus M. MUBASHIR AHMED, MD; SETH MARK BERNEY, MD; ROBERT E. WOLF, MD; MICHELENE HEARTH-HOLMES, MD; SAMINA HAYAT, MD; EISHA MUBASHIR, MD; HENRI VANDERHEYDE, PHD; WUN-LING CHANG, MD; JOHN W. KING, MD
ABSTRACT: Objective: Hepatitis C virus (HCV) infection is associated with various autoimmune disorders and can mimic systemic lupus erythematosus (SLE) clinically and serologically. There are few reports of prevalence of HCV infection in patients with SLE. The aim of this study was to determine the prevalence of HCV viremia by polymerase chain reaction (PCR) in patients with SLE. Methods: We tested sera from 40 consecutive patients with SLE collected from1993 to 2000. All of the patients had HCV viral load measured by PCR. The results were compared with the prevalence of HCV viremia in a control group of blood donors in our geographic area as well as in United States general population. Results: HCV was detected in 4 of 40 patients (10%). The prevalence of HCV in our area blood donors is 130 cases per 100,000 persons (0.13%; P ⬍
0.0001). The prevalence of HCV infection in the United States general population, screened by PCR, is 1330 cases per 100,000 people (1.33%; P ⫽ 0.002). The prevalence of HCV infection was significantly higher in our SLE patients than in our area blood donors. The frequency of HCV infection was also higher than that of the United States general population. Conclusion: Our observations support those of other investigators who have reported an increased prevalence of HCV infection in SLE patients. Further detailed investigation of this association may help in understanding the pathogenesis of SLE. HCV infection should be tested when the diagnosis of SLE is considered. KEY INDEXING TERMS: Hepatitis C virus; Systemic lupus erythematosus; Extrahepatic manifestation. [Am J Med Sci 2006;331(5):252–256.]
S
disorders such as Sjo¨gren syndrome, mixed cryoglobulinemia, porphyria cutanea tarda, membranoproliferative glomerulonephritis, vasculitis, arthritis, and thyroiditis.5 Patients with chronic HCV infections may have laboratory features associated with SLE, including a variety of autoantibodies and hypocomplementemia.5,6 In addition, treatment of HCV infection with interferon (IFN) alpha is associated with the emergence of autoimmune disorders.7 Although an association between these two conditions seems possible, few studies have evaluated the prevalence of HCV infection in patients with an established diagnosis of SLE.1,4,8,9 Because SLE patients make multiple antibodies that may cross-react with serologic tests, including HCV antibody, the prevalence of HCV seropositivity may be falsely elevated in patients with SLE. The purpose of this study was to evaluate the prevalence of HCV viremia as determined by polymerase chain-reaction (PCR) of HCV-RNA in the serum of patients with SLE.
ystemic lupus erythematosus (SLE) is a common connective tissue disease with an estimated prevalence of 15 to 200 cases per 100,000 people.1 It is the most clinically and serologically diverse of the autoimmune diseases and displays a wide spectrum of clinical and immunologic manifestations involving all organs of the body.2 The etiology of SLE as well as most of other autoimmune diseases is the subject of significant investigation, and viruses have been suggested as potential etiologic and triggering agents.3,4 Hepatitis C virus (HCV) appears to be associated with autoimmune From the Center of Excellence for Arthritis and Rheumatology and from the Section of Rheumatology, Department of Medicine (MMA, SMB, REW, MH-H, SH, EM), the Section of Infectious Diseases, Department of Medicine (CW-L), and the Department of Microbiology (JWK), Louisiana State University Health Sciences Center, Shreveport, Louisiana. Submitted for publication May 11, 2005; accepted for publication November 4, 2005. Paper presented at the Southern Regional Meeting held in New Orleans, LA from February 12-14th, 2004. Abstract published in Journal of Investigative Medicine, Vol. 52, #1, January 2004. Correspondence: Mohammed Mubashir Ahmed, MD, Assistant Professor of Medicine, Center of Excellence for Arthritis and Rheumatology, LSUHSC-S, 1501 Kings Highway, Shreveport, LA 71130-3932 (E-mail: [email protected]).
252
Methods We investigated 40 consecutive SLE patients, 38 women and 2 men (34 African-American and 6 white) seen in the lupus clinic at May 2006 Volume 331 Number 5
Ahmed et al
Louisiana State University Health Sciences Center in Shreveport from 1993 to 2000. This study was approved by the Institutional Review Board. All patients fulfilled the 1982 American College of Rheumatology revised criteria for SLE.10 All patients had documented history, physical examination findings, and Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) scores. The clinical and serologic characteristics of all patients were collected from their SLEDAI data and sera from the same date were selected for HCV testing. All of the patients had their HCV viral load measured by PCR from sera that were collected, stored at -80°C, and thawed only once prior to use. When multiple sera were available from the same patient, the earliest available sera at the time of the patient’s initial presentation and diagnosis with SLE was used for HCV viral load testing. These patients had not received any immunosuppressants at the time of collection of the sera used for HCV testing. The results were compared with the prevalence of HCV infection in a control group of blood donors in our geographic area obtained from LifeShare Blood Centers of Northern Louisiana. All donors were initially screened for anti-HCV antibodies with enzyme immunoassay (EIA), and all positive for anti-HCV antibody were subsequently confirmed with nucleic acid amplification testing (NAT). In Northern Louisiana, 88,918 donors donated 149,874 units of whole blood during the period of July 1, 2002 through June 30, 2003. There were 20,816 first-time donors. The results were also compared with prevalence of HCV infection in United States general population.11 Viral RNA was isolated from lupus patients’ sera using the QIAamp (Qiagen, Valencia, CA). The levels of HCV-RNA were determined using quantitative real time PCR with the following primers and probe: forward primer (5=AACTACTGTCTTCACGCAGAAAGC3=), reverse primer (5=CCCAACACTACTCGGCTAG3=), and TaqMan probe (5=FAMTGGCGTTAGTATGAGTGTCGTGCAG3=TAMRA). The quantitative real time PCR technique was validated against the branched DNA assay (Bayer, Emeryville, CA), and shown to exhibit a 10-fold greater sensitivity with an R2 of 0.98. For each assay, a series of Hepatitis C virus RNA standards (Accurun 405, Boston Biomedica, West Bridgewater, MA) were analyzed (R2⫽0.99) to allow determination of copy number and as a quality control for reagents.12 Because real-time PCR uses specific primers as well as a probe that is specific for the PCR product, the rate of false positives for real time PCR is virtually zero. If the primers were to amplify nonspecific DNA, then the probe that is specific for the correct PCR product will not bind the amplified DNA between the forward and reverse primers. Consequently, the probe will not be cleaved by the Taq polymerase and generate a fluorescent signal. In addition, the following measurements and tests were performed on patients with SLE: blood urea nitrogen, serum creatinine, aspartate transaminase, alanine transaminase, albumin, complete blood cell count, urinalysis, 24-hour urine protein and creatinine or calculation of protein-to-creatinine ratio in random spot urine samples, antinuclear antibodies against doublestranded DNA, precipitating antibodies to the extractable nuclear antigens (U1 RNP, Sm, Ro/SSA and La/SSB), complement C3 and C4, rapid protein reagin and anticardiolipin antibodies, lupus anticoagulant, and human immunodeficiency virus type-1 and 2 (HIV-1/HIV-2) (when appropriate).
confirmed with NAT for the presence of HCV-RNA. The prevalence of HCV in our area blood donors was 130 per 100,000 donors (0.13%; P ⬍ 0.0001) relative to SLE patients. Among the 20,816 first-time donors, 114 were positive for anti-HCV antibody by EIA and 92 first-time donors were found positive for HCV-RNA by NAT for a prevalence of 440 per 100,000 donors (0.44%; P ⬍ 0.0001) compared to SLE patients. The prevalence of chronic HCV infection in the United States general population, screened by PCR, is 1330 per 100,000 persons (1.33%; P ⫽ 0.002) relative to our SLE patients (Table 1). Clinical, immunologic, and serologic characteristics of the four SLE patients positive for active HCV infection by PCR are summarized in Table 2. All four patients were female. Their risk factors for HCV infection were unknown. Their transaminase levels were normal and remained normal for a long period after the diagnosis of SLE. There were no clinical signs of hepatopathy. Clinical, immunologic features, and Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) in patients with and without chronic HCV infection are summarized in Table 3. There was no difference in the SLEDAI between HCV-positive and HCV-negative SLE patients. All of the patients received standard treatment as indicated by their predominant disease manifestations and the extent of the organ involvement including steroids, azathioprine, cyclophosphamide, hydroxychlorquine, methotrexate, and nonsteroidal anti-inflammatory drugs. Discussion Viruses have been suggested as potential etiologic and triggering agents in the pathogenesis of systemic autoimmune diseases.3,4 HCV infection appears to be associated with several autoimmune disorders and can mimic SLE clinically and serologically.5,6 Although the major risks of HCV infection are the development of cirrhosis in up to 20% of chronically infected patients and the risk for hepatocellular carcinoma and liver failure, numerous extrahepatic manifestations have been reported with HCV infection including Sjo¨gren syndrome,13,14 cryoglobulinemia, vasculitis, arthritis, thyroiditis, sialadenitis, lichen planus, porphyria cutanea tarda,
Statistical Analysis We used the Fisher exact test to analyze differences in frequency. A P-value of less than 0.05 was taken to indicate statistical significance.
Table 1. Prevalence of HCV Viremia in SLE Patients, Area Blood Donors, and US Population Group
Results Hepatitis C virus was detected in 4 of our 40 lupus patients (10%). One hundred forty LifeShare Blood donors were initially found to be positive for antiHCV antibodies by EIA, and 113 were subsequently THE AMERICAN JOURNAL OF THE MEDICAL SCIENCES
LSUHSC-S SLE Patients Area Blood Donors First-Time Area Blood Donors US Population a
HCV Positive, %
P-valuea
10.00 0.13 0.44 1.33
— ⬍ 0.0001 ⬍ 0.0001 ⬍ 0.002
Versus LSUHSC-S SLE patients using Fisher exact test.
253
Prevalence of HCV in SLE
Table 2. Clinical and Immunologic Features of Patients with Systemic Lupus Erythematosus and Chronic Hepatitis C Virus Infection Age, y 44 43 28 44
Arthritis, Arthritis, Arthritis, Arthritis,
SLE criteria
ANA
dsDNA
Anti Sm
ACL
Hypocomp
ALT
SSAßSB
HIV
Nephritis, Nephritis, Nephritis, Nephritis,
640 320 1280 640
⫺ ⫺ ⫹ ⫺
⫺ ⫺ ⫺ ⫺
⫹ ⫹ ⫺ ND
⫹ ⫹ ⫹ ⫺
N N N N
⫹/⫹ ⫹/⫹ ⫺/⫺ ⫺/⫹
⫺ ND ND ⫺
Hemo, Discoid Serositis Oral ulcers
ACL, anticardiolipin antibodies; ANA, antinuclear antibodies; dsDNA, anti-double stranded DNA; Hemo, hemocytopenias; HIV, human immunodeficiency virus; Hypocomp, hypocomplimentia; N, normal; ND, not done; - , absent; ⫹, present.
mesangiocapillary glomerulonephritis , type II diabetes mellitus, celiac sprue,15 myocarditis,16 and Bcell non-Hodgkin lymphoma.17,18 Several of the most frequent extrahepatic manifestations of HCV infection such as arthralgia, myalgia, sicca syndrome, and antinuclear antibodies may mimic a true connective tissue disease, particularly SLE. Patients with chronic HCV infections are frequently positive for autoantibodies, such as antinuclear antibodies (10-30%), anti-dsDNA at low titers, anticardiolipin antibodies, antithyroidal antibodies, anti-smooth muscle antibodies, anti-liver/kidney microsome type 1 antibodies,19 cryoglobulins, rheumatoid factor (75%), and hypocomplementemia, all features seen in patients with SLE. In addition, there is a case report of a patient with chronic HCV infection who presented with nephrotic syndrome in whom kidney biopsy was diagnostic of lupus membranous nephritis and serologic studies confirmed the diagnosis of SLE.20 Some authors have analyzed the prevalence of HCV infection in SLE patients based on the presence of anti-HCV antibodies,8,9,21 and case reports of their association have also been published.22,23 Cacoub et al21 found anti-HCV antibodies (by ELISA-2) in 7 (11%) of 62 SLE patients, but only two had detectable HCV-RNA (3%). In another study, Kowdley et al9 found anti-HCV antibodies (by ELISA-2) in 5 (12%) of 42 SLE patients, but only three patients (7%) were antibody positive in the immunoblot analysis and two (5%) were positive by PCR. None of these patients had chronic liver disease symptoms, and only one had abnormal findings in the liver. In a recent study, Ramos-Casals et al5 investigated 134 SLE patients and found antibodies to HCV in 18 lupus patients (13%) and in 2 of 200 (1%) blood donors studied. Among the anti-HCV–positive group, HCV viremia was confirmed (by RIBA-3 and polymerase chain reaction) in 15 SLE patients (11%) and in the two blood donors (1%) (P ⬍ 0.001). This prevalence is significantly higher than the prevalence of HCV infection found in the control group (1%) of blood donors from the same geographic area and in the general population in Catalonia (1.2%),24 and the authors suggested a possible link between HCV infection and SLE. In the present study, we looked at the prevalence 254
of HCV viremia as evidenced by PCR detection of HCV-RNA in the serum of patients with SLE. We found active HCV infection in 10% of our unselected SLE patients, similar to the prevalence noted in the study by Ramos-Casals et al.5 This prevalence is significantly higher than the prevalence of active HCV infection in the blood donors, including the first-time donors in our geographic area as well as compared with prevalence of HCV infection in United States general population. There was no difference in the SLEDAI between HCV-positive and HCV-negative SLE patients in our study. The treatment of HCV infection with interferonalpha is associated with the development of autoimmune disorders in 4% to 19% of patients receiving interferon-alpha, though SLE-like syndromes are only seen in 0.15% to 0.7%.7 Clinical and laboratory features of SLE in this setting, including arthralgia/ arthritis, serositis, headaches, alopecia, positive antinuclear antibodies, and dsDNA, resemble idiopathic disease, typically with a good outcome after discontinuation of the drug. Recently, Fuyukawa et al.25 reported a patient who developed SLE after receiving alpha2-interferon therapy for HCV infection, and reviewed 11 additional cases that had been previously reported. Other autoimmune disorders have been reported to develop after treatment with type 1 interferon.26 –33 The role of other viruses (including retroviruses) as potential etiologic and triggering agents in some genetically susceptible individuals has been proposed.3,4 Patients with HIV infection and SLE show marked overlap with respect to the characteristics of their immune response, and the clinical manifestations of both diseases can sometimes be indistinguishable. Nevertheless, HIV infection and SLE are rarely seen in the same patient. It has also been reported that treatment of one condition may cause the other to become worse in patients with both diseases. Two of the four HCV-positive SLE patients in our study were HIV-negative. The HIV status of other two patients is not known. All of these patients had long-standing SLE with major organ involvement including nephritis and have received various immunosuppressants including steroids and cyclophosphamide over time after their sera collection dates (the sera used for HCV-RNA testing). Both May 2006 Volume 331 Number 5
Ahmed et al
Table 3. Clinical, Immunologic Features, and Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) in Patients with and without Chronic Hepatitis C Virus infectiona
Manifestation Neurologicb Arthritis Myositis Cutaneousc Mucosal ulcers Serositis Nephropathyd Hemocytopenias ANA DsDNA Anti Sm Low C3 Low C4 SLEDAI at the time Of HCV testing (mean)
SLE patients without HCV, n ⫽ 36 6 (17) 9 (25) 3 (8) 10 (28) 5 (14) 2 (6) 17 (47) 4 (11) 36 (100) 12 (33) 9 (25) 23 (64) 10 (28) 9.6
SLE patients with HCV, n⫽4 0 (0) 4 (100) 0 (0) 0 (0) 0 (0) 1 (25) 4 (100) 0 (0) 4 (100) 1 (25) 0 (0) 3 (75) 1 (25) 10.5
P-value ⬎0.99 0.008 ⬎0.99 0.56 ⬎0.99 0.28 0.11 ⬎0.99 — ⬎0.99 ⬎0.99 ⬎0.56 0.99 0.93
ANA, antinuclear antibodies; dsDNA, anti-double stranded DNA; Hemo, hemocytopenias; SLEDAI, Systemic Lupus Erythematosus Disease Activity Index. a Values represent the number (%) of patients. b Neurologic: presence of seizure, psychosis, organic brain syndrome, cranial neuropathy, lupus headache, and/or cerebrovascular accident. c Cutaneous: malar rash, discoid lesions, subacute cutaneous lesions, and/or photosensitivity. d Nephropathy: presence of heme granular casts, hematuria, proteinuria ⬎ 0.5 g/24 hrs and/or sterile pyuria.
patients whose HIV status is not known were diagnosed with SLE prior to 1993 and have been followed at our clinic since then. Their SLE is in remission and there were no clinical manifestations of HIV coinfection. Conclusion Hepatitis C virus infection is associated with various autoimmune disorders and can mimic SLE clinically and serologically. Patients presenting with arthritis, arthralgia, myalgia, sicca symptoms, or leucopenia who are suspected of SLE should be tested for chronic HCV infection. Conversely, patients with chronic HCV infection and extrahepatic manifestations mimicking SLE should be tested for highly specific antibodies for SLE such as anti-Sm, anti-dsDNA, and anti-nucleosome antibodies to be considered as having definite SLE. Although there is no established role of HCV in the pathogenesis of SLE, the possibility that viral and other microbiologic agents may act as triggering factors in some genetically susceptible individuals has been discussed.3–5 The extraordinary association between HCV infection and mixed cryoglobulinemia, often in association with vasculitis and with other autoimmune diseases, has encouraged the suspicion that THE AMERICAN JOURNAL OF THE MEDICAL SCIENCES
infection by this agent might also account for SLE at least in some patients. The prevalence of HCV infection as determined by PCR was significantly higher in our SLE patients than in the healthy blood donors in our geographic area. The frequency of HCV infection in our patients was also significantly higher compared to the U.S. general population. Larger studies are needed to determine whether the higher prevalence of HCV infection seen in our SLE patients is seen in other SLE populations, and whether treatment of the HCV with interferon and ribavirin will have an impact on the patient’s disease. Patients with SLE should be evaluated for possible HCV infection. Further detailed investigation of this association may help in understanding the pathogenesis of SLE. Acknowledgments The authors are grateful to Mrs. Jane Carroll, Manager Shreveport Center, LifeShare Blood Centers, for her assistance with the data collection. References 1. Perlemuter G, Cacoub P, Sbai A, et al. Hepatitis C virus in SLE. J Rheumatol 2003;30:1473–8. 2. Cacoub P, Renou C, Rosenthal E, et al. Extrahepatic manifestations associated with hepatitis C virus infection: a prospective multicenter study of 321 patients. Medicine (Baltimore) 2000;79:47–56. 3. Denman AM. Systemic lupus erythematosus: is a viral etiology a credible hypothesis? J Infect 2000;40:229–33. 4. Obermayer-Straub P, Manns M. Hepatitis C and D: retroviruses and autoimmune manifestations. Autoimmun 2001; 16:275–285. 5. Ramos-Casals M, Font J, Garcia-Carrasco M, et al. Hepatitis C virus infection mimicking systemic lupus erythematosus. Arthritis Rheum 2000;43:2801–6. 6. Cacoub P, Poynard T, Ghallani P, et al. Extrahepatic manifestations of chronic hepatitis C. MULTIVIRC Group. Multidepartment Virus C Arthritis Rheum 1999;42:2204–12. 7. Wilson LE, Widman D, Dickman SH, et al. Autoimmune disease complicating antiviral therapy for hepatitis C virus infection. Semin Arthritis Rheum 2002;32:163–73. 8. Marchesoni A, Battafarano N, Podico M, et al. Hepatitis C virus antibodies and systemic lupus erythematosus [letter]. Clin Exp Rheumatol 1995;13:267. 9. Kowdley KV, Subler DE, Scheffel J, et al. Hepatitis C virus antibodies in systemic lupus erythematosus. J Clin Gastroenterol 1997;25:437–9. 10. Tan EM, Cohen AS, Fries JF, et al. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1982;25:1271–7. 11. Alter M, Kruszon-Moran D, Nainan O, et al. The prevalence of hepatitis C virus in United States, 1988 through 1994. N Engl J Med. 1999 Aug 19;341:556–62. 12. Jorgensen PA, Neuwald PD. Standardized hepatitis C virus RNA panels for nucleic acid testing assays. J Clin Virol 2001;20:35–40. 13. Ramos-Casals M, Garcia-Carrasco M, Cervera R, et al. Hepatitis C virus mimicking primary Sjogren’s syndrome: a clinical and immunologic description of 35 cases. Medicine 2001;80:1–8.
255
Prevalence of HCV in SLE
14. Ramos-Casals M, Garcı´a-Carrasco M, Cervera R, et al. Sjo¨gren’s syndrome and hepatitis C virus. Clin Rheumatol 1999;18:93–100. 15. Fine KD, Ogunji F, Saloum Y, et al. Celiac sprue: another autoimmune syndrome associated with hepatitis C. Am J Gastroenterol 2001;96:138–45. 16. Frustaci , Calabrese F, Chimenti C, et al. Lone hepatitis C virus myocarditis responsive to immunosuppressive therapy. Chest 2002;122:1348–56. 17. Starkebaum G, Sasso E. Hepatitis C and B cells: induction of autoimmunity and lymphoproliferation may reflect chronic stimulation through cell-surface receptors [editorial]. J Rheumatol 2004;31:416–8. 18. Ramos-Casals M, Trejo O, Garcia-Carrasco M, et al. Triple association between HCV infection, systemic autoimmune diseases, and B cell lymphoma. J Rheumatol 2004;31:495–9. 19. Lunel F, Cacoub P. Treatment of autoimmune and extrahepatic manifestations of HCV infection. Ann Med Interne 2000;151:58–64. 20. Danesh FR, Lynch P, Kanwar YS. Lupus membranous glomerulonephritis mimicking hepatitis C-associated nephropathy. Am J Kidney Dis 2002;39:E19. 21. Cacoub P, Lunel F, Huong LT. Polyarteritis nodosa and hepatitis C virus infection [letter]. Ann Intern Med 1992;116:605–6. 22. Marvisi M. A case of systemic lupus erythematosus or hepatitis C virus? [letter] Chest 1998;113:1146. 23. Nepveu K, Libman B. Hepatitis C virus as another possible cause of porphyria cutanea tarda and systemic lupus erythematosus. Arthritis Rheum 1996;39:352–4. 24. Sanchez-Tapias JM, Barrera JM, Costa J, et al. Hepatitis C virus infection in patients with nonalcoholic chronic liver disease. Ann Intern Med 1990;112:921–4.
256
25. Fuyukawa S, Kajiwara E, Suzuki N, et al. Systemic lupus erythematosus after interferon therapy for chronic hepatitis C: a case report and review of the literature. Am J Gastroenterol 2000;95:310–2. 26. Cacoub P, Sbai A, Frances C, et al. Systemic sarcoidosis during interferon-alpha therapy for chronic hepatitis C virus infection. Gastroenterol Clin Biol 2000;24:364–6. 27. Sanchez-Pobre P, Gonzalez C, Paz E, et al. Chronic hepatitis C and autoimmune cholangitis: a case study and literature review. Dig Dis Sci 2002;47:1224–9. 28. Gurtubay IG, Morales G, Arechaga O, et al. Development of myasthenia gravis after interferon alpha therapy. Electromyogr Clin Neurophysiol 1999;39:75–8. 29. Eibl N, Gschwantler M, Ferenci P, et al. Development of insulin-dependent diabetes mellitus in a patient with chronic hepatitis C during therapy with interferon-alpha. Eur J Gastroenterol Hepatol 2001;13:295–8. 30. Passos de Sousa E, Evangelista Segundo PT, Jose FF, et al. Rheumatoid arthritis induced by alpha-interferon therapy. Clin Rheumatol 2001;20:297–9. 31. Ward DL, Bing-You RG. Autoimmune thyroid dysfunction induced by interferon-alpha treatment for chronic hepatitis C: screening and monitoring recommendations. Endocr Pract 2001;7:52–8. 32. Parana R, Cruz M, Santos-Jesus R, et al. Thyroid disease in HCV carriers undergoing antiviral therapy with interferon plus ribavirin. Braz J Infect Dis 2000;4:284–90. 33. Bell TM, Bansal AS, Shorthouse C, et al. Low-titer autoantibodies predicts autoimmune disease during interferonalpha treatment of chronic hepatitis C. J Gastroenterol Hepatol 1999;14:419–22.
May 2006 Volume 331 Number 5
ABSTRACT: Objective: Hepatitis C virus (HCV) infection is associated with various autoimmune disorders and can mimic systemic lupus erythematosus (SLE) clinically and serologically. There are few reports of prevalence of HCV infection in patients with SLE. The aim of this study was to determine the prevalence of HCV viremia by polymerase chain reaction (PCR) in patients with SLE. Methods: We tested sera from 40 consecutive patients with SLE collected from1993 to 2000. All of the patients had HCV viral load measured by PCR. The results were compared with the prevalence of HCV viremia in a control group of blood donors in our geographic area as well as in United States general population. Results: HCV was detected in 4 of 40 patients (10%). The prevalence of HCV in our area blood donors is 130 cases per 100,000 persons (0.13%; P ⬍
0.0001). The prevalence of HCV infection in the United States general population, screened by PCR, is 1330 cases per 100,000 people (1.33%; P ⫽ 0.002). The prevalence of HCV infection was significantly higher in our SLE patients than in our area blood donors. The frequency of HCV infection was also higher than that of the United States general population. Conclusion: Our observations support those of other investigators who have reported an increased prevalence of HCV infection in SLE patients. Further detailed investigation of this association may help in understanding the pathogenesis of SLE. HCV infection should be tested when the diagnosis of SLE is considered. KEY INDEXING TERMS: Hepatitis C virus; Systemic lupus erythematosus; Extrahepatic manifestation. [Am J Med Sci 2006;331(5):252–256.]
S
disorders such as Sjo¨gren syndrome, mixed cryoglobulinemia, porphyria cutanea tarda, membranoproliferative glomerulonephritis, vasculitis, arthritis, and thyroiditis.5 Patients with chronic HCV infections may have laboratory features associated with SLE, including a variety of autoantibodies and hypocomplementemia.5,6 In addition, treatment of HCV infection with interferon (IFN) alpha is associated with the emergence of autoimmune disorders.7 Although an association between these two conditions seems possible, few studies have evaluated the prevalence of HCV infection in patients with an established diagnosis of SLE.1,4,8,9 Because SLE patients make multiple antibodies that may cross-react with serologic tests, including HCV antibody, the prevalence of HCV seropositivity may be falsely elevated in patients with SLE. The purpose of this study was to evaluate the prevalence of HCV viremia as determined by polymerase chain-reaction (PCR) of HCV-RNA in the serum of patients with SLE.
ystemic lupus erythematosus (SLE) is a common connective tissue disease with an estimated prevalence of 15 to 200 cases per 100,000 people.1 It is the most clinically and serologically diverse of the autoimmune diseases and displays a wide spectrum of clinical and immunologic manifestations involving all organs of the body.2 The etiology of SLE as well as most of other autoimmune diseases is the subject of significant investigation, and viruses have been suggested as potential etiologic and triggering agents.3,4 Hepatitis C virus (HCV) appears to be associated with autoimmune From the Center of Excellence for Arthritis and Rheumatology and from the Section of Rheumatology, Department of Medicine (MMA, SMB, REW, MH-H, SH, EM), the Section of Infectious Diseases, Department of Medicine (CW-L), and the Department of Microbiology (JWK), Louisiana State University Health Sciences Center, Shreveport, Louisiana. Submitted for publication May 11, 2005; accepted for publication November 4, 2005. Paper presented at the Southern Regional Meeting held in New Orleans, LA from February 12-14th, 2004. Abstract published in Journal of Investigative Medicine, Vol. 52, #1, January 2004. Correspondence: Mohammed Mubashir Ahmed, MD, Assistant Professor of Medicine, Center of Excellence for Arthritis and Rheumatology, LSUHSC-S, 1501 Kings Highway, Shreveport, LA 71130-3932 (E-mail: [email protected]).
252
Methods We investigated 40 consecutive SLE patients, 38 women and 2 men (34 African-American and 6 white) seen in the lupus clinic at May 2006 Volume 331 Number 5
Ahmed et al
Louisiana State University Health Sciences Center in Shreveport from 1993 to 2000. This study was approved by the Institutional Review Board. All patients fulfilled the 1982 American College of Rheumatology revised criteria for SLE.10 All patients had documented history, physical examination findings, and Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) scores. The clinical and serologic characteristics of all patients were collected from their SLEDAI data and sera from the same date were selected for HCV testing. All of the patients had their HCV viral load measured by PCR from sera that were collected, stored at -80°C, and thawed only once prior to use. When multiple sera were available from the same patient, the earliest available sera at the time of the patient’s initial presentation and diagnosis with SLE was used for HCV viral load testing. These patients had not received any immunosuppressants at the time of collection of the sera used for HCV testing. The results were compared with the prevalence of HCV infection in a control group of blood donors in our geographic area obtained from LifeShare Blood Centers of Northern Louisiana. All donors were initially screened for anti-HCV antibodies with enzyme immunoassay (EIA), and all positive for anti-HCV antibody were subsequently confirmed with nucleic acid amplification testing (NAT). In Northern Louisiana, 88,918 donors donated 149,874 units of whole blood during the period of July 1, 2002 through June 30, 2003. There were 20,816 first-time donors. The results were also compared with prevalence of HCV infection in United States general population.11 Viral RNA was isolated from lupus patients’ sera using the QIAamp (Qiagen, Valencia, CA). The levels of HCV-RNA were determined using quantitative real time PCR with the following primers and probe: forward primer (5=AACTACTGTCTTCACGCAGAAAGC3=), reverse primer (5=CCCAACACTACTCGGCTAG3=), and TaqMan probe (5=FAMTGGCGTTAGTATGAGTGTCGTGCAG3=TAMRA). The quantitative real time PCR technique was validated against the branched DNA assay (Bayer, Emeryville, CA), and shown to exhibit a 10-fold greater sensitivity with an R2 of 0.98. For each assay, a series of Hepatitis C virus RNA standards (Accurun 405, Boston Biomedica, West Bridgewater, MA) were analyzed (R2⫽0.99) to allow determination of copy number and as a quality control for reagents.12 Because real-time PCR uses specific primers as well as a probe that is specific for the PCR product, the rate of false positives for real time PCR is virtually zero. If the primers were to amplify nonspecific DNA, then the probe that is specific for the correct PCR product will not bind the amplified DNA between the forward and reverse primers. Consequently, the probe will not be cleaved by the Taq polymerase and generate a fluorescent signal. In addition, the following measurements and tests were performed on patients with SLE: blood urea nitrogen, serum creatinine, aspartate transaminase, alanine transaminase, albumin, complete blood cell count, urinalysis, 24-hour urine protein and creatinine or calculation of protein-to-creatinine ratio in random spot urine samples, antinuclear antibodies against doublestranded DNA, precipitating antibodies to the extractable nuclear antigens (U1 RNP, Sm, Ro/SSA and La/SSB), complement C3 and C4, rapid protein reagin and anticardiolipin antibodies, lupus anticoagulant, and human immunodeficiency virus type-1 and 2 (HIV-1/HIV-2) (when appropriate).
confirmed with NAT for the presence of HCV-RNA. The prevalence of HCV in our area blood donors was 130 per 100,000 donors (0.13%; P ⬍ 0.0001) relative to SLE patients. Among the 20,816 first-time donors, 114 were positive for anti-HCV antibody by EIA and 92 first-time donors were found positive for HCV-RNA by NAT for a prevalence of 440 per 100,000 donors (0.44%; P ⬍ 0.0001) compared to SLE patients. The prevalence of chronic HCV infection in the United States general population, screened by PCR, is 1330 per 100,000 persons (1.33%; P ⫽ 0.002) relative to our SLE patients (Table 1). Clinical, immunologic, and serologic characteristics of the four SLE patients positive for active HCV infection by PCR are summarized in Table 2. All four patients were female. Their risk factors for HCV infection were unknown. Their transaminase levels were normal and remained normal for a long period after the diagnosis of SLE. There were no clinical signs of hepatopathy. Clinical, immunologic features, and Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) in patients with and without chronic HCV infection are summarized in Table 3. There was no difference in the SLEDAI between HCV-positive and HCV-negative SLE patients. All of the patients received standard treatment as indicated by their predominant disease manifestations and the extent of the organ involvement including steroids, azathioprine, cyclophosphamide, hydroxychlorquine, methotrexate, and nonsteroidal anti-inflammatory drugs. Discussion Viruses have been suggested as potential etiologic and triggering agents in the pathogenesis of systemic autoimmune diseases.3,4 HCV infection appears to be associated with several autoimmune disorders and can mimic SLE clinically and serologically.5,6 Although the major risks of HCV infection are the development of cirrhosis in up to 20% of chronically infected patients and the risk for hepatocellular carcinoma and liver failure, numerous extrahepatic manifestations have been reported with HCV infection including Sjo¨gren syndrome,13,14 cryoglobulinemia, vasculitis, arthritis, thyroiditis, sialadenitis, lichen planus, porphyria cutanea tarda,
Statistical Analysis We used the Fisher exact test to analyze differences in frequency. A P-value of less than 0.05 was taken to indicate statistical significance.
Table 1. Prevalence of HCV Viremia in SLE Patients, Area Blood Donors, and US Population Group
Results Hepatitis C virus was detected in 4 of our 40 lupus patients (10%). One hundred forty LifeShare Blood donors were initially found to be positive for antiHCV antibodies by EIA, and 113 were subsequently THE AMERICAN JOURNAL OF THE MEDICAL SCIENCES
LSUHSC-S SLE Patients Area Blood Donors First-Time Area Blood Donors US Population a
HCV Positive, %
P-valuea
10.00 0.13 0.44 1.33
— ⬍ 0.0001 ⬍ 0.0001 ⬍ 0.002
Versus LSUHSC-S SLE patients using Fisher exact test.
253
Prevalence of HCV in SLE
Table 2. Clinical and Immunologic Features of Patients with Systemic Lupus Erythematosus and Chronic Hepatitis C Virus Infection Age, y 44 43 28 44
Arthritis, Arthritis, Arthritis, Arthritis,
SLE criteria
ANA
dsDNA
Anti Sm
ACL
Hypocomp
ALT
SSAßSB
HIV
Nephritis, Nephritis, Nephritis, Nephritis,
640 320 1280 640
⫺ ⫺ ⫹ ⫺
⫺ ⫺ ⫺ ⫺
⫹ ⫹ ⫺ ND
⫹ ⫹ ⫹ ⫺
N N N N
⫹/⫹ ⫹/⫹ ⫺/⫺ ⫺/⫹
⫺ ND ND ⫺
Hemo, Discoid Serositis Oral ulcers
ACL, anticardiolipin antibodies; ANA, antinuclear antibodies; dsDNA, anti-double stranded DNA; Hemo, hemocytopenias; HIV, human immunodeficiency virus; Hypocomp, hypocomplimentia; N, normal; ND, not done; - , absent; ⫹, present.
mesangiocapillary glomerulonephritis , type II diabetes mellitus, celiac sprue,15 myocarditis,16 and Bcell non-Hodgkin lymphoma.17,18 Several of the most frequent extrahepatic manifestations of HCV infection such as arthralgia, myalgia, sicca syndrome, and antinuclear antibodies may mimic a true connective tissue disease, particularly SLE. Patients with chronic HCV infections are frequently positive for autoantibodies, such as antinuclear antibodies (10-30%), anti-dsDNA at low titers, anticardiolipin antibodies, antithyroidal antibodies, anti-smooth muscle antibodies, anti-liver/kidney microsome type 1 antibodies,19 cryoglobulins, rheumatoid factor (75%), and hypocomplementemia, all features seen in patients with SLE. In addition, there is a case report of a patient with chronic HCV infection who presented with nephrotic syndrome in whom kidney biopsy was diagnostic of lupus membranous nephritis and serologic studies confirmed the diagnosis of SLE.20 Some authors have analyzed the prevalence of HCV infection in SLE patients based on the presence of anti-HCV antibodies,8,9,21 and case reports of their association have also been published.22,23 Cacoub et al21 found anti-HCV antibodies (by ELISA-2) in 7 (11%) of 62 SLE patients, but only two had detectable HCV-RNA (3%). In another study, Kowdley et al9 found anti-HCV antibodies (by ELISA-2) in 5 (12%) of 42 SLE patients, but only three patients (7%) were antibody positive in the immunoblot analysis and two (5%) were positive by PCR. None of these patients had chronic liver disease symptoms, and only one had abnormal findings in the liver. In a recent study, Ramos-Casals et al5 investigated 134 SLE patients and found antibodies to HCV in 18 lupus patients (13%) and in 2 of 200 (1%) blood donors studied. Among the anti-HCV–positive group, HCV viremia was confirmed (by RIBA-3 and polymerase chain reaction) in 15 SLE patients (11%) and in the two blood donors (1%) (P ⬍ 0.001). This prevalence is significantly higher than the prevalence of HCV infection found in the control group (1%) of blood donors from the same geographic area and in the general population in Catalonia (1.2%),24 and the authors suggested a possible link between HCV infection and SLE. In the present study, we looked at the prevalence 254
of HCV viremia as evidenced by PCR detection of HCV-RNA in the serum of patients with SLE. We found active HCV infection in 10% of our unselected SLE patients, similar to the prevalence noted in the study by Ramos-Casals et al.5 This prevalence is significantly higher than the prevalence of active HCV infection in the blood donors, including the first-time donors in our geographic area as well as compared with prevalence of HCV infection in United States general population. There was no difference in the SLEDAI between HCV-positive and HCV-negative SLE patients in our study. The treatment of HCV infection with interferonalpha is associated with the development of autoimmune disorders in 4% to 19% of patients receiving interferon-alpha, though SLE-like syndromes are only seen in 0.15% to 0.7%.7 Clinical and laboratory features of SLE in this setting, including arthralgia/ arthritis, serositis, headaches, alopecia, positive antinuclear antibodies, and dsDNA, resemble idiopathic disease, typically with a good outcome after discontinuation of the drug. Recently, Fuyukawa et al.25 reported a patient who developed SLE after receiving alpha2-interferon therapy for HCV infection, and reviewed 11 additional cases that had been previously reported. Other autoimmune disorders have been reported to develop after treatment with type 1 interferon.26 –33 The role of other viruses (including retroviruses) as potential etiologic and triggering agents in some genetically susceptible individuals has been proposed.3,4 Patients with HIV infection and SLE show marked overlap with respect to the characteristics of their immune response, and the clinical manifestations of both diseases can sometimes be indistinguishable. Nevertheless, HIV infection and SLE are rarely seen in the same patient. It has also been reported that treatment of one condition may cause the other to become worse in patients with both diseases. Two of the four HCV-positive SLE patients in our study were HIV-negative. The HIV status of other two patients is not known. All of these patients had long-standing SLE with major organ involvement including nephritis and have received various immunosuppressants including steroids and cyclophosphamide over time after their sera collection dates (the sera used for HCV-RNA testing). Both May 2006 Volume 331 Number 5
Ahmed et al
Table 3. Clinical, Immunologic Features, and Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) in Patients with and without Chronic Hepatitis C Virus infectiona
Manifestation Neurologicb Arthritis Myositis Cutaneousc Mucosal ulcers Serositis Nephropathyd Hemocytopenias ANA DsDNA Anti Sm Low C3 Low C4 SLEDAI at the time Of HCV testing (mean)
SLE patients without HCV, n ⫽ 36 6 (17) 9 (25) 3 (8) 10 (28) 5 (14) 2 (6) 17 (47) 4 (11) 36 (100) 12 (33) 9 (25) 23 (64) 10 (28) 9.6
SLE patients with HCV, n⫽4 0 (0) 4 (100) 0 (0) 0 (0) 0 (0) 1 (25) 4 (100) 0 (0) 4 (100) 1 (25) 0 (0) 3 (75) 1 (25) 10.5
P-value ⬎0.99 0.008 ⬎0.99 0.56 ⬎0.99 0.28 0.11 ⬎0.99 — ⬎0.99 ⬎0.99 ⬎0.56 0.99 0.93
ANA, antinuclear antibodies; dsDNA, anti-double stranded DNA; Hemo, hemocytopenias; SLEDAI, Systemic Lupus Erythematosus Disease Activity Index. a Values represent the number (%) of patients. b Neurologic: presence of seizure, psychosis, organic brain syndrome, cranial neuropathy, lupus headache, and/or cerebrovascular accident. c Cutaneous: malar rash, discoid lesions, subacute cutaneous lesions, and/or photosensitivity. d Nephropathy: presence of heme granular casts, hematuria, proteinuria ⬎ 0.5 g/24 hrs and/or sterile pyuria.
patients whose HIV status is not known were diagnosed with SLE prior to 1993 and have been followed at our clinic since then. Their SLE is in remission and there were no clinical manifestations of HIV coinfection. Conclusion Hepatitis C virus infection is associated with various autoimmune disorders and can mimic SLE clinically and serologically. Patients presenting with arthritis, arthralgia, myalgia, sicca symptoms, or leucopenia who are suspected of SLE should be tested for chronic HCV infection. Conversely, patients with chronic HCV infection and extrahepatic manifestations mimicking SLE should be tested for highly specific antibodies for SLE such as anti-Sm, anti-dsDNA, and anti-nucleosome antibodies to be considered as having definite SLE. Although there is no established role of HCV in the pathogenesis of SLE, the possibility that viral and other microbiologic agents may act as triggering factors in some genetically susceptible individuals has been discussed.3–5 The extraordinary association between HCV infection and mixed cryoglobulinemia, often in association with vasculitis and with other autoimmune diseases, has encouraged the suspicion that THE AMERICAN JOURNAL OF THE MEDICAL SCIENCES
infection by this agent might also account for SLE at least in some patients. The prevalence of HCV infection as determined by PCR was significantly higher in our SLE patients than in the healthy blood donors in our geographic area. The frequency of HCV infection in our patients was also significantly higher compared to the U.S. general population. Larger studies are needed to determine whether the higher prevalence of HCV infection seen in our SLE patients is seen in other SLE populations, and whether treatment of the HCV with interferon and ribavirin will have an impact on the patient’s disease. Patients with SLE should be evaluated for possible HCV infection. Further detailed investigation of this association may help in understanding the pathogenesis of SLE. Acknowledgments The authors are grateful to Mrs. Jane Carroll, Manager Shreveport Center, LifeShare Blood Centers, for her assistance with the data collection. References 1. Perlemuter G, Cacoub P, Sbai A, et al. Hepatitis C virus in SLE. J Rheumatol 2003;30:1473–8. 2. Cacoub P, Renou C, Rosenthal E, et al. Extrahepatic manifestations associated with hepatitis C virus infection: a prospective multicenter study of 321 patients. Medicine (Baltimore) 2000;79:47–56. 3. Denman AM. Systemic lupus erythematosus: is a viral etiology a credible hypothesis? J Infect 2000;40:229–33. 4. Obermayer-Straub P, Manns M. Hepatitis C and D: retroviruses and autoimmune manifestations. Autoimmun 2001; 16:275–285. 5. Ramos-Casals M, Font J, Garcia-Carrasco M, et al. Hepatitis C virus infection mimicking systemic lupus erythematosus. Arthritis Rheum 2000;43:2801–6. 6. Cacoub P, Poynard T, Ghallani P, et al. Extrahepatic manifestations of chronic hepatitis C. MULTIVIRC Group. Multidepartment Virus C Arthritis Rheum 1999;42:2204–12. 7. Wilson LE, Widman D, Dickman SH, et al. Autoimmune disease complicating antiviral therapy for hepatitis C virus infection. Semin Arthritis Rheum 2002;32:163–73. 8. Marchesoni A, Battafarano N, Podico M, et al. Hepatitis C virus antibodies and systemic lupus erythematosus [letter]. Clin Exp Rheumatol 1995;13:267. 9. Kowdley KV, Subler DE, Scheffel J, et al. Hepatitis C virus antibodies in systemic lupus erythematosus. J Clin Gastroenterol 1997;25:437–9. 10. Tan EM, Cohen AS, Fries JF, et al. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1982;25:1271–7. 11. Alter M, Kruszon-Moran D, Nainan O, et al. The prevalence of hepatitis C virus in United States, 1988 through 1994. N Engl J Med. 1999 Aug 19;341:556–62. 12. Jorgensen PA, Neuwald PD. Standardized hepatitis C virus RNA panels for nucleic acid testing assays. J Clin Virol 2001;20:35–40. 13. Ramos-Casals M, Garcia-Carrasco M, Cervera R, et al. Hepatitis C virus mimicking primary Sjogren’s syndrome: a clinical and immunologic description of 35 cases. Medicine 2001;80:1–8.
255
Prevalence of HCV in SLE
14. Ramos-Casals M, Garcı´a-Carrasco M, Cervera R, et al. Sjo¨gren’s syndrome and hepatitis C virus. Clin Rheumatol 1999;18:93–100. 15. Fine KD, Ogunji F, Saloum Y, et al. Celiac sprue: another autoimmune syndrome associated with hepatitis C. Am J Gastroenterol 2001;96:138–45. 16. Frustaci , Calabrese F, Chimenti C, et al. Lone hepatitis C virus myocarditis responsive to immunosuppressive therapy. Chest 2002;122:1348–56. 17. Starkebaum G, Sasso E. Hepatitis C and B cells: induction of autoimmunity and lymphoproliferation may reflect chronic stimulation through cell-surface receptors [editorial]. J Rheumatol 2004;31:416–8. 18. Ramos-Casals M, Trejo O, Garcia-Carrasco M, et al. Triple association between HCV infection, systemic autoimmune diseases, and B cell lymphoma. J Rheumatol 2004;31:495–9. 19. Lunel F, Cacoub P. Treatment of autoimmune and extrahepatic manifestations of HCV infection. Ann Med Interne 2000;151:58–64. 20. Danesh FR, Lynch P, Kanwar YS. Lupus membranous glomerulonephritis mimicking hepatitis C-associated nephropathy. Am J Kidney Dis 2002;39:E19. 21. Cacoub P, Lunel F, Huong LT. Polyarteritis nodosa and hepatitis C virus infection [letter]. Ann Intern Med 1992;116:605–6. 22. Marvisi M. A case of systemic lupus erythematosus or hepatitis C virus? [letter] Chest 1998;113:1146. 23. Nepveu K, Libman B. Hepatitis C virus as another possible cause of porphyria cutanea tarda and systemic lupus erythematosus. Arthritis Rheum 1996;39:352–4. 24. Sanchez-Tapias JM, Barrera JM, Costa J, et al. Hepatitis C virus infection in patients with nonalcoholic chronic liver disease. Ann Intern Med 1990;112:921–4.
256
25. Fuyukawa S, Kajiwara E, Suzuki N, et al. Systemic lupus erythematosus after interferon therapy for chronic hepatitis C: a case report and review of the literature. Am J Gastroenterol 2000;95:310–2. 26. Cacoub P, Sbai A, Frances C, et al. Systemic sarcoidosis during interferon-alpha therapy for chronic hepatitis C virus infection. Gastroenterol Clin Biol 2000;24:364–6. 27. Sanchez-Pobre P, Gonzalez C, Paz E, et al. Chronic hepatitis C and autoimmune cholangitis: a case study and literature review. Dig Dis Sci 2002;47:1224–9. 28. Gurtubay IG, Morales G, Arechaga O, et al. Development of myasthenia gravis after interferon alpha therapy. Electromyogr Clin Neurophysiol 1999;39:75–8. 29. Eibl N, Gschwantler M, Ferenci P, et al. Development of insulin-dependent diabetes mellitus in a patient with chronic hepatitis C during therapy with interferon-alpha. Eur J Gastroenterol Hepatol 2001;13:295–8. 30. Passos de Sousa E, Evangelista Segundo PT, Jose FF, et al. Rheumatoid arthritis induced by alpha-interferon therapy. Clin Rheumatol 2001;20:297–9. 31. Ward DL, Bing-You RG. Autoimmune thyroid dysfunction induced by interferon-alpha treatment for chronic hepatitis C: screening and monitoring recommendations. Endocr Pract 2001;7:52–8. 32. Parana R, Cruz M, Santos-Jesus R, et al. Thyroid disease in HCV carriers undergoing antiviral therapy with interferon plus ribavirin. Braz J Infect Dis 2000;4:284–90. 33. Bell TM, Bansal AS, Shorthouse C, et al. Low-titer autoantibodies predicts autoimmune disease during interferonalpha treatment of chronic hepatitis C. J Gastroenterol Hepatol 1999;14:419–22.
May 2006 Volume 331 Number 5