Production of 2-methyl-1-butanol and 3-methyl-1-butanol in engineered Corynebacterium glutamicum

Author’s Accepted Manuscript Production of 2-methyl-1-butanol and 3-methyl-1butanol in engineered Corynebacterium glutamicum Michael Vogt, Christian Brüsseler, Jan van Ooyen, Michael Bott, Jan Marienhagen www.elsevier.com/locate/ymben

PII: DOI: Reference:

S1096-7176(16)30163-X http://dx.doi.org/10.1016/j.ymben.2016.10.007 YMBEN1161

To appear in: Metabolic Engineering Received date: 25 July 2016 Revised date: 11 October 2016 Accepted date: 12 October 2016 Cite this article as: Michael Vogt, Christian Brüsseler, Jan van Ooyen, Michael Bott and Jan Marienhagen, Production of 2-methyl-1-butanol and 3-methyl-1butanol in engineered Corynebacterium glutamicum, Metabolic Engineering, http://dx.doi.org/10.1016/j.ymben.2016.10.007 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Production of 2-methyl-1-butanol and 3-methyl-1butanol in engineered Corynebacterium glutamicum Michael Vogt, Christian Brüsseler, Jan van Ooyen, Michael Bott, Jan Marienhagen* Institute of Bio- and Geosciences, IBG-1: Biotechnology, Forschungszentrum Jülich, D52425 Jülich, Germany *Corresponding

author. Dr. Jan Marienhagen, Tel.: +49 2461 61 2843, j.marienhagen@fz-

juelich.de

Abstract The pentanol isomers 2-methyl-1-butanol and 3-methyl-1-butanol represent commercially interesting alcohols due to their potential application as biofuels. For a sustainable microbial production of these compounds, Corynebacterium glutamicum was engineered for producing 2methyl-1-butanol and 3-methyl-1-butanol via the Ehrlich pathway from 2-keto-3-methylvalerate and 2-ketoisocaproate, respectively. In addition to an already available 2-ketoisocaproate producer, a 2-keto-3-methylvalerate accumulating C. glutamicum strain was also constructed. For this purpose, we reduced the activity of the branched-chain amino acid transaminase in an available C. glutamicum L-isoleucine producer (K2P55) via a start codon exchange in the ilvE gene enabling accumulation of up to 3.67 g/l 2-keto-3-methylvalerate. Subsequently, nine strains expressing different gene combinations for three 2-keto acid decarboxylases and three alcohol dehydrogenases were constructed and characterized. The best strains accumulated 0.37 g/l 2-methyl-1-butanol and 2.76 g/l 3-methyl-1-butanol in defined medium within 48 h under oxygen deprivation conditions, making these strains ideal candidates for additional strain and process optimization. Keywords: biofuels, Corynebacterium glutamicum, 2-keto acids, 2-methyl-1-butanol, 3-methyl-1butanol, Ehrlich pathway

1

1. Introduction The microbial production of biofuels and chemicals from renewable resources is an important aspect of the aspired transition from our current petroleum-based economy to a more sustainable future bioeconomy (Cho et al., 2015; Stephanopoulos, 2007). Currently, ethanol represents the major biofuel that is produced by fermentation but has several drawbacks such as low energy density and high hygroscopicity (Atsumi et al., 2008b; Choi et al., 2014). Higher alcohols (C4-C5) represent attractive alternatives to ethanol, as these compounds are less hygroscopic and have a higher energy density. In this respect, higher alcohols are more similar to gasoline and thus have also the advantage of fitting well into the current fuel transportation infrastructure (Cann and Liao, 2010). Among the C4 and C5 alcohols, the straight-chain alcohol 1-butanol has been produced from a renewable source on a commercial scale (Chen and Liao, 2016; Dürre, 2008), using Clostridium and engineered E. coli as microbial production hosts (Atsumi et al., 2008a; Schiel-Bengelsdorf et al., 2013; Shen and Liao, 2008). Branched-chain C4 and C5 alcohols such as isobutanol, 2-methyl-1-butanol (2MB), and 3-methyl-1-butanol (3MB) are of special interest since they have a higher octane number compared to their straight-chain counterparts (Atsumi et al., 2008b). In addition to the potential application as advanced biofuels, pentanol isomers 2MB and 3MB can also be used as solvents for chemical reactions, liquid extractions, or as starting material, e.g. for the synthesis of the flavor ester isoamyl acetate (Cann and Liao, 2010). Higher alcohols can be produced from 2-keto acids by employing the last two steps of the Ehrlich pathway for the biosynthesis of fusel alcohols originally found in yeast (Hazelwood et al., 2008). In the Ehrlich pathway, 2-keto acids first undergo a decarboxylation reaction by a 2ketoacid decarboxylase (KDC), yielding an aldehyde and CO2. In a second step, the aldehyde is reduced to the corresponding alcohol by an alcohol dehydrogenase (ADH). The application of this pathway represents a promising biotechnological approach for biofuel production. Atsumi and co-workers were the first to report a metabolic engineering-based approach to implement the last steps of the Ehrlich pathway in Escherichia coli for the microbial production of higher 2

alcohols (Atsumi et al., 2008b). Interestingly, in addition to their role as precursor for the Ehrlich pathway, 2-keto acids themselves also do have several applications in the food, feed and pharmaceutical industry (Song et al., 2015) or serve as building blocks for the synthesis of important chemicals such as aliphatic ketones or carboxylic acids (Jambunathan and Zhang, 2014; Tashiro et al., 2015). Corynebacterium glutamicum is a well-studied platform organism in industrial biotechnology (Burkovski, 2008; Eggeling and Bott, 2005; Yukawa and Inui, 2013). It has potential to produce a wide variety of interesting compounds, e.g. organic acids (Otten et al., 2015; Wieschalka et al., 2013) or plant-derived polyphenols (Kallscheuer et al., 2016). However, by far the most prominent application of C. glutamicum is the fermentative production of amino acids, especially the flavor enhancer L-glutamate and the feed additive L-lysine, in multi-millionton-scale annually (Heider and Wendisch, 2015). Potent C. glutamicum strains for the production of other amino acids have been constructed, such as L-arginine (Park et al., 2014) and the branched-chain amino acids (BCAAs) L-valine (Blombach et al., 2008; Chen et al., 2015; Hasegawa et al., 2012; Marienhagen and Eggeling, 2008; Radmacher et al., 2002), L-isoleucine (Vogt et al., 2015b; Yin et al., 2012), and L-leucine (Vogt et al., 2014). The direct precursors of these BCAAs are the 2-keto acids 2-ketoisovalerate (KIV), 2-keto-3-methylvalerate (KMV), and 2-ketoisocaproate (KIC), respectively (Fig. 1). Promising C. glutamicum producer strains for KIV (Krause et al., 2010) and KIC (Buckle-Vallant et al., 2014; Vogt et al., 2015a) are already available. As already mentioned, 2-keto acids can be converted to higher alcohols via the Ehrlich pathway and C. glutamicum strains for production of isobutanol have been described (Blombach et al., 2011; Smith et al., 2010; Yamamoto et al., 2013). Moreover, the production of 2,3butanediol derived from the ß-ketoacid α-acetolactate via decarboxylation to acetoin and subsequent reduction could also be successfully demonstrated for C. glutamicum (Rados et al., 2015). In this study, we report on the construction of C. glutamicum strains for overproduction of 2MB and 3MB from the 2-keto acids KMV and KIC by plasmid-borne expression of genes encoding KDCs and ADHs in the respective 2-keto acid producers. The recombinant strains were 3

cultivated under oxygen deprivation conditions and analyzed regarding their production performance to explore the possibility of employing C. glutamicum for microbial 2MB and 3MB production. 2. Materials and methods 2.1 Bacterial strains, plasmids, media, and growth conditions Bacterial strains and plasmids including their characteristics and sources are listed in Table 1. All C. glutamicum strains are derived from wild-type strain ATCC 13032 (Abe et al., 1967) and, if not stated otherwise, were routinely cultivated aerobically at 30 °C in brain heart infusion (BHI) medium (Difco Laboratories, Detroit, USA) or defined CGXII minimal medium (Keilhauer et al., 1993) with 30 mg/l protocatechuic acid and 4 % (w/v) glucose as sole carbon and energy source. For recombinant DNA work, E. coli DH5α was used, and routinely cultivated in Lysis Broth (LB) medium (Bertani, 1951) at 37 °C. Kanamycin (25 µg/ml for C. glutamicum strains, 50 µg/ml for E. coli DH5α) and 1 mM isopropyl β-D-thiogalactoside (IPTG) were added to the medium where appropriate. Determination of bacterial growth was performed by following the optical density at 600 nm (OD600).

2.2 Toxicity tests with 2MB and 3MB With the aim to determine the product toxicity of 2MB and 3MB, the C. glutamicum wild type ATCC 13032 was cultivated in presence of varying amounts of externally added pentanols c 0 - 2 % (v/v). 48-well Flowerplates (m2p-labs GmbH, Baesweiler, Germany) containing 750 μl CGXII medium with 4 % (w/v) glucose and 1 mM of each L-valine, L-isoleucine, and L-leucine were inoculated from a preculture to an OD600 of 1 and cultivated at 30 °C, 1200 rpm, a humidity of 85 % and a throw of ø 3 mm in a BioLector device (m2p-labs GmbH) capable of online growth monitoring. Formation of biomass was followed by measuring the backscattered light intensity at a wavelength of 620 nm (signal gain factor 10). For a direct comparison to E. coli, C. glutamicum wild type cells and E. coli DH5α cells were cultivated in BHI complex medium in presence of varying amounts of 2MB and 3MB at 4

concentrations ranging from 0 - 1 % (v/v). For this purpose, 1000 μl BHI medium were inoculated from precultures to an OD600 of 1 and cultivated in 48-well flowerplates at 30 °C (C. glutamicum) or 37 °C (E. coli) under the same conditions as mentioned above. Formation of biomass was followed by measuring the backscattered light intensity at a wavelength of 620 nm (signal gain factor 15).

2.3 Cultivation of C. glutamicum strains for the synthesis 2-keto acids and alcohols For 2-keto acid production, C. glutamicum strains were cultivated in 500 ml baffled Erlenmeyer flasks at 120 rpm on a rotary shaker. For cultivation of strain K2P55 and its derivatives, cells were grown overnight in BHI medium, harvested by centrifugation (4,000 x g for 10 min) and then resuspended to an OD600 of 2 in 50 ml CGXII medium with 4 % (w/v) glucose and 1 mM each of L-valine, L-isoleucine, and L-leucine. Strain MV-KICF1 and its derivatives were cultivated in 50 ml CGXII medium with 4 % (w/v) glucose and 1 mM each of Lvaline, L-isoleucine, and L-leucine (initial OD600 = 1) as described previously (Vogt et al., 2015a). For alcohol production, C. glutamicum strains were first grown aerobically for formation of biomass as described for 2-keto acid production in 50 ml CGXII medium with 4 % (w/v) glucose and 1 mM each of L-valine, L-isoleucine, L-leucine, and IPTG. Cells were harvested by centrifugation (4,000 x g for 10 min) and then resuspended in 50 ml CGXII medium with 4 % (w/v) glucose and 1 mM each of L-valine, L-isoleucine, L-leucine, and IPTG to an OD600 of 15. The cell suspensions were transferred into 500 ml screw-cap glass bottles (Duran Group, Wertheim, Germany) and cultivated on a rotary shaker at 120 rpm. When inoculated, cultures were initially aerobic but rapidly became anaerobic due to the consumption of oxygen. During all cultivations, samples were taken for determining cell densities and for preparing cell-free supernatants via centrifugation at 16,000 x g for 5 min. The supernatants were used for quantification of 2-keto acids, alcohols, or glucose.

5

2.4 Construction of strains and plasmids Standard protocols (Sambrook and Russell, 2001) were used for performing molecular cloning methods, e.g. PCR, DNA restriction, and ligation. Molecular methods specific for C. glutamicum, such as electroporation for transformation of strains, were performed as described previously (Eggeling and Bott, 2005). All enzymes for recombinant DNA work were purchased from ThermoScientific (Schwerte, Germany). The genes aro10, thi3, and adh2 from S. cerevisiae, kivd from L. lactis, and yqhD from E. coli were purchased from LifeTechnologies (Darmstadt, Germany) as codon-optimized genes for expression in C. glutamicum. DNA oligonucleotides used in this study were synthesized by Eurofins MWG Operon (Ebersfeld, Germany) and are listed in Table 2. Exchange of the start codon of ilvE from ATG to GTG, in-frame deletion of ldhA, and in-frame deletion of ilvA was performed by employing a two-step homologous recombination method using the plasmids pK19mobsacB-GTG-ilvE, pK19mobsacB-ΔldhA, and pK19mobsacB-ΔilvA, respectively, as described previously (Litsanov et al., 2012; Sahm and Eggeling, 1999; Vogt et al., 2015a). Vector pEKEx2 carrying an IPTG-inducible tac promoter (Eikmanns et al., 1991) was used for plasmid-based gene expression. For the construction of pEKEx2-based expression plasmids, genes were amplified using suitable DNA oligonucleotides, thereby introducing restriction sites and a Shine-Dalgarno sequence (Table 2). The PCR fragments were cloned sequentially into pEKEx2 using the introduced restriction sites to yield expression plasmids with nine different combinations of KDC- and ADH-encoding genes (Table 1). DNA sequencing performed by Eurofins MWG Operon was used to verify the DNA sequences of all constructed plasmids and introduced chromosomal modifications in engineered strains.

2.5 Quantification of 2-keto acids, glucose, and alcohols Determination of 2-keto acids and glucose in cell-free culture supernatants was carried out using HPLC methods as previously described (Vogt et al., 2015a). Alcohols in culture supernatants were separated and quantified using a 7890A capillary gas chromatography device 6

from Agilent Technologies (Waldbronn, Germany) equipped with a HP-5 column ((5 % phenyl)methylpolysiloxane, 30 m, 0.32 mm, 0.25 μm, Agilent Technologies). Helium was employed as carrier gas (flow rate 1 ml/min) and separation of alcohols was achieved at a constant column temperature of 30 °C. Combi PAL GC autosampler from CTC Analytics GmbH (Zwingen, Germany) was used for sample injection (1 μl) via split injection (1:50). A flame ionization detector (FID) was employed for detection of alcohols at a detector temperature of 250 °C. Quantification of alcohols was done via determination of peak areas using calibration with external isobutanol, 2MB, and 3MB standards and employing ChemStation software (Agilent Technologies). Yields were calculated as the proportion of the amount of alcohol produced and the amount of glucose consumed. 3. Results and Discussion The strategy for production of the alcohols 2MB and 3MB with C. glutamicum was as follows: (1) testing the toxicity of the desired products 2MB and 3MB on growth of C. glutamicum; (2) use of an available KIC producer and construction of a KMV producer to provide these 2-keto acids as precursors for the biosynthesis of 2MB and 3MB, respectively; (3) conducting further genetic modifications of both 2-keto acid producers to prepare them for pentanol production under oxygen deprivation conditions, and (4) expressing different combinations of genes encoding KDCs and ADHs in these modified 2-keto acid producers for alcohol production under oxygendeprived conditions.

3.1 Cytotoxic effects of 2MB and 3MB on C. glutamicum As alcohols with longer alkyl chains are more cytotoxic than alcohols with shorter alkyl chains such as ethanol, microbial production of pentanols could have severe adverse effects on the metabolism of C. glutamicum during production (Connor et al., 2010). For this reason, toxicity tests with 2MB and 3MB were performed. We cultivated C. glutamicum cells in the defined production medium CGXII containing 4 % glucose and 1 mM each of L-valine, Lisoleucine and L-leucine in the presence of varying 2MB- and 3MB-concentrations ranging from 7

0 – 16.5 g/l, respectively (Fig. S1). In the course of these experiments C. glutamicum proved to be quite robust as the growth rate remained unaffected at pentanol concentrations of 4 g/l 2MB and 5.5 g/l 3MB respectively. High concentrations of 6.5 g/l 2MB or 6.5 g/l 3MB still allowed for moderate growth as these concentrations reduced the growth rate of C. glutamicum from 0.40 h1

to only 0.30 h-1 or 0.35 h-1, respectively. Only very high pentanol concentrations of 12 g/l 2MB

or 3MB completely abolished growth of C. glutamicum (Fig. S1). It was reported previously that an E. coli strain used for 3MB production showed already a severe growth deficiency at an alcohol concentration of only 3 g/l 3MB (Connor et al., 2010). However, these experiments were performed under different conditions. For a direct comparison we cultivated C. glutamicum wild type cells and E. coli DH5α cells in BHI complex medium with supplementation of different concentrations of 2MB and 3MB at 30 °C (C. glutamicum) or 37 °C (E. coli) under otherwise identical conditions. As both organisms exhibit different growth rates, we set the growth rate without any pentanol supplementation to 100 %, and calculated relative growth rates of both microorganisms at different 2MB and 3MB concentrations (Fig. S2). Already at 3 g/l 2MB, the growth rate of E. coli drops to 55 %, whereas C. glutamicum can grow at 92 % of its maximum growth rate. In the presence of 8 g/l 2MB, E. coli almost stopped growth (8 %), whereas the growth rate of C. glutamicum was reduced to only 60 %. Supplementation of 3MB appears to be even more toxic to E. coli as only 42 % of the maximum growth rate could be determined in the presence of 3 g/l 3MB. At this concentration C. glutamicum maintained 86 % of its maximum growth rate. Even at the highest 3MB concentration of 8 g/l tested, the relative growth rate of C. glutamicum could be determined to be 51 %, whereas E. coli almost stopped growth (9 %). These results demonstrate the resilience of C. glutamicum to the cytotoxic effects of 2MB or 3MB, rendering it a suitable production host for these alcohols.

8

3.2 Construction of a KMV-accumulating C. glutamicum strain Initially, C. glutamicum strains capable of accumulating the 2MB- and 3MB-precursor 2-keto acids KIC and KMV were needed as starting strains for alcohol production via the Ehrlich pathway. The plasmid-free KIC-producing C. glutamicum strain MV-KICF1 was previously constructed by us (Vogt et al., 2015a) by chromosomally exchanging the start codon of the BCAA transaminase-encoding gene ilvE from ATG to GTG in a very potent L-leucine production strain, thereby reducing ilvE mRNA translation and IlvE activity (Vogt et al., 2014; Vogt et al., 2015a). In CGXII medium with 4 % (w/v) glucose and 1 mM each of L-valine, L-isoleucine, and L-leucine this strain accumulated up to 3.55 g/l KIC with a yield of 0.09 g KIC per g glucose, but also up to 0.34 g/l KIV and 1.49 g/l KMV as by-products (Fig. 2). This KIC producer strain served as starting strain for engineering C. glutamicum towards a 3MB producer. For the construction of a KMV-producing C. glutamicum strain for the development of a 2MB producer, the plasmid-free, leucine-auxotrophic L-isoleucine producer K2P55 previously constructed by us was used (Vogt et al., 2015b). In analogy to the construction of MV-KICF1, we exchanged the ilvE start codon from ATG to GTG to yield a KMV-accumulating strain. This strain, designated CB-KMVF1, was cultivated in CGXII medium with 4 % (w/v) glucose. In addition to supplementing 1 mM L-leucine for compensating the leucine auxotrophy, 1 mM each of L-valine and L-isoleucine was also added to the medium to avoid shortage of BCAAs due to reduced IlvE transamination activity. As expected, CB-KMVF1 was able to accumulate up to 3.67 g/l KMV in the supernatant, whereas the starting strain K2P55 showed only a maximum KMV accumulation of 0.28 g/l (Fig. 3). The transaminase IlvE is mainly responsible for converting KMV into Lisoleucine (Marienhagen et al., 2005) so that reduction of its activity in C. glutamicum via the start codon exchange resulted in a significant accumulation of the 2-keto acid KMV. Similar to K2P55 being able to overproduce L-isoleucine without accumulation of noteworthy amounts of other amino acids as by-products (Vogt et al., 2015b), CB-KMVF1 showed only low accumulation of KIV (0.20 g/l). Moreover, there was no KIC formation, since strain CB-KMVF1 is originally based on the L-leucine-auxotrophic strain MH20-22B being devoid of isopropylmalate 9

dehydratase activity (Fig. 1) (Schrumpf et al., 1992). This L-leucine auxotrophy allows for 2MB synthesis from KMV without formation of any 3MB as the L-leucine precursor KIC is not available. Strain CB-KMVF1 can serve not only as precursor strain for 2MB production, but also for producing KMV. The three BCAA precursors KIV, KIC, and KMV represent interesting products due to applications in the medical, biological and food area (Vogt et al., 2015a).

3.3 Genomic modifications of the 2-keto acid producing C. glutamicum strains prior to engineering for pentanol synthesis Previous approaches for producing alcohols with engineered C. glutamicum strains such as ethanol, 2,3-butanediol, and isobutanol showed that it is advantageous to cultivate the strains under oxygen deprivation conditions (Blombach et al., 2011; Inui et al., 2004a; Rados et al., 2015). Under these conditions, C. glutamicum shows only negligible growth with glucose (Michel et al. 2015) and available resources are shifted towards alcohol production, resulting in high product yields and low by-product formation (Inui et al., 2004a). Moreover, the availability of NADH, required for the reduction of aldehydes to their corresponding alcohol by NADPHdependent alcohol dehydrogenases, is increased under oxygen deprivation (Blombach et al., 2011). Due to the observation that 2-keto acid-based pathways maintain highly active also under anaerobic conditions (Tashiro et al., 2015), a production strategy using oxygen deprivation was feasible. Indeed, a more than 2-fold higher product yield was obtained during isobutanol production with C. glutamicum under oxygen-limited conditions in comparison to standard aerobic cultivation (Blombach and Eikmanns, 2011). For this reason, we aimed at the production of 2MB and 3MB in a defined medium under non-growing and oxygen-deprived conditions. L-lactate usually accumulates as main by-product under such conditions in C. glutamicum withdrawing resources, which could also be rerouted towards product formation (Michel et al., 2015; Okino et al., 2005). Previously, deletion of the gene ldhA encoding the L-lactate dehydrogenase proved to be beneficial for ethanol production (Inui et al., 2004a). For isobutanol production, a product that also derives from the 2-keto acid 10

KIV, deletion of ldhA proved to be essential under oxygen-deprivation conditions (Blombach et al., 2011). With the aim to minimize L-lactate formation during 2-keto acid formation under oxygen deprivation, we also deleted ldhA in our 2-keto acid producers MV-KICF1 and CBKMVF1. Characterization of the resulting strains and comparison to the parent strains regarding growth and by-product formation under aerobic conditions showed comparable results (Fig. 2 and 3), indicating that ldhA deletion has no significant impact on growth or 2-keto acid synthesis. However, since the pathways for KIV, KMV and KIC biosynthesis overlap (Fig. 1), undesired KIV accumulation could be detected during all cultivations. The C. glutamicum strains CB-KMVF1 and CB-KMVF1 ΔldhA showed no accumulation of KIC as by-product. In contrast, strain MV-KICF1 ΔldhA accumulated significant amounts of KMV (up to 1.2 g/l) in addition to the desired 2-keto acid KIC. With the aim to reduce or even abolish KMV accumulation in this strain, the ilvA gene encoding threonine dehydratase was additionally deleted in MV-KICF1 ΔldhA, as only ilvA is specific for L-isoleucine formation in the interconnected pathways for BCAA biosynthesis (Fig. 1). As desired, this deletion led to a complete abolishment of KMV formation and additionally increased the KIC titer to 4.04 g/l, with 0.26 g/l KIV as by-product. This enhancement can be explained by an increased availability of BCAA precursors, which are no longer channeled into competing pathway for KMV biosynthesis. Strains CB-KMV-F1 ΔldhA and MV-KICF1 ΔldhA ΔilvA were used as starting strains for the engineering of C. glutamicum towards 2MB and 3MB synthesis, respectively.

3.4 Production of the pentanol isomers 2MB and 3MB with C. glutamicum For synthesis of the pentanols 2MB and 3MB with C. glutamicum, the 2-keto acid precursors KMV and KIC have to be converted via the Ehrlich pathway, employing the combined activities of KDC and ADH. The 2-keto acid producers MVKICF1 ΔldhA ΔilvA and CB-KMVF1 ΔldhA were transformed with IPTG-inducible pEKEx2 expression plasmids, each one carrying a KDC- and an ADH-encoding gene. We evaluated two genes encoding KDCs (kivd from L. lactis and aro10 from S. cerevisiae), and three genes coding for ADHs (adh2 from S. cerevisiae, adhA from C. 11

glutamicum, and yqhD from E. coli) for pentanol synthesis with C. glutamicum, as these genes were already successfully employed for branched-chain higher alcohol production using strains of E. coli and C. glutamicum (Atsumi et al., 2008b; Atsumi et al., 2010; Blombach et al., 2011; Smith et al., 2010). Additionally, the gene encoding for the putative KDC Thi3 of S. cerevisiae was tested (synonymous: YDL080c or KID1 for ketoisocaproate decarboxylase), which has been described as major decarboxylase for KIC and also appears to be involved in decarboxylation of KMV

(Dickinson

et

al.,

2000;

Dickinson

et

al.,

1997).

All

nine

possible

decarboxylase/dehydrogenase gene combinations were cloned into the expression vector pEKEx2 and tested for alcohol production under oxygen deprivation conditions. Production of both alcohols, 2MB and 3MB, was possible with all combinations using genes kivd and aro10 combined with either adh2, adhA, and yqhD, except for the combination aro10 and adhA expressed in MV-KICF1 ΔldhA ΔilvA (Fig. 4 and 5). Thi3 from S. cerevisiae did not lead to 2MB and 3MB production in this study. This can be explained with the previous assumption that Thi3 is not a functional decarboxylase, but rather has a regulatory role in thiamine biosynthesis in yeast, thereby also affecting decarboxylase activity due to its thiamine pyrophosphate-dependency (Romagnoli et al., 2012). Titers of 2MB, produced via expression of the different gene combinations in CB-KMVF1 ΔldhA, ranged from 0.23 g/l for pEKEx2-kivd-adh2 to 0.37 g/l for pEKEx2-kivd-yqhD after 48 h of cultivation (Fig. 4). In comparison to 2MB formation, the produced 3MB titers using strain MVKICF1 ΔldhA ΔilvA were substantially higher: Product titers ranged from 1.4 g/l 3MB for pEKEx2-kivd-yqhD to 2.76 g/l 3MB for pEKEx2-aro10-yqhD after 48 h of cultivation (Fig. 5). As expected, the engineered C. glutamicum strains exclusively produced either 2MB or 3MB, but additionally accumulated isobutanol due to accumulation of the precursor KIV and its subsequent conversion to isobutanol by the introduced KDC and ADH activities. No accumulation of the 2-keto acids KIV, KMV, and KIC during pentanol synthesis could be observed, indicating that these precursors are efficiently converted to their corresponding alcohols by KDC and ADH (data not shown). Furthermore, the produced amounts of the three 12

alcohols were below the toxicity tolerance levels determined in this study and those reported for isobutanol. Formation of the by-product isobutanol is strongly depended on the decarboxylase employed. For 2MB production, the use of the decarboxylase Aro10 resulted in isobutanol formation of up to 0.32 g/l after 48 h, whereas higher production of up to 0.95 g/l isobutanol was observed with Kivd (Fig. 4 and 5). Also in the case of 3MB production, Kivd led to higher isobutanol levels (up to 5.29 g/l) than Aro10 (up to 1.54 g/l), but the overall levels were much higher than in the case of 2MB. The increased isobutanol amounts observed for kivd-carrying plasmids could be explained by the kinetic parameters of Kivd, which has the highest activity with KIV as substrate, whereas it is 4- to 6-fold less active with KIC and KMV, respectively (de la Plaza et al., 2004). Whereas the determined maximum 2MB product titers were similar when expressing kivd or aro10, Aro10 activity allowed for higher 3MB titers in the respective 3MB-strains (up to 2.76 g/l), with simultaneous reduction of isobutanol formation. This enzyme was identified as broadsubstrate Ehrlich pathway decarboxylase and key contributor to the production of branchedchain fusel alcohols in S. cerevisiae (Romagnoli et al., 2012; Vuralhan et al., 2005). It was successfully employed in the production of these alcohols with E. coli, outperforming other yeast decarboxylase genes expressed in this organism (Atsumi et al., 2008b; Su et al., 2014). This enzyme shows a higher affinity for KIC (KM = 2 mM) in comparison to KMV (KM = 5 mM) and KIV (KM = 12 mM) (Romagnoli et al., 2012). This could explain the increased accumulation of 3MB and reduction of isobutanol formation in comparison to Kivd that shows a higher affinity for the isobutanol precursor KIV (KM = 1.9 mM) (de la Plaza et al., 2004). The results showed that the choice of the KDC-activity had a huge impact on the production profile of 2MB, 3MB, and isobutanol with C. glutamicum, whereas the different ADHs mainly had an effect on the accumulation of isobutanol. The chromosomally encoded alcohol dehydrogenase AdhA of C. glutamicum was shown to prefer linear short-chain alcohol as substrates, such as ethanol and methanol, over other alcohols, but also contributes substantially to isobutanol production with C. glutamicum via reduction of isobutyraldehyde (Arndt et al., 2008; Blombach 13

et al., 2011; Smith et al., 2010; Witthoff et al., 2013). Therefore, native expression of endogenous adhA might also contribute to reduction of 2-methyl-butyraldehyde and isovaleraldehyde for biosynthesis of 2MB and 3MB, respectively, in our strains. Indeed, overexpression of adhA from C. glutamicum in combination with kivd in MV-KICF1 ΔldhA ΔilvA resulted in a substantial formation of isobutanol of 5.3 g/l, which is already comparable to isobutanol titers (approx. 5-6 g/l) reported for other C. glutamicum strains specifically engineered for isobutanol production (Blombach et al., 2011; Smith et al., 2010). Under oxygen limited conditions, C. glutamicum converts glucose to the organic acids lactate, succinate, and acetate (Dominguez et al., 1993; Inui et al., 2004b). As expected, no lactate was detected due to the deletion of ldhA coding for L-lactate dehydrogenase, but strains accumulated high amounts of succinate and acetate. Titers of these organic acids ranged from 7.1-9.2 g/l succinate and 3.4-4.2 g/l acetate for the 2MB production strains and 7.1-15.4 g/l succinate and 0.6-1.2 g/l acetate for the 3MB-producing strains. Additional metabolic engineering efforts should address the reduction of by-product formation of these organic acids. To the best of our knowledge, C. glutamicum CB-KMVF1 pEKEx2-kivd-yqhD engineered for 2MB production (product titer: 0.37 g/l; yield: 0.02 g 2MB per g glucose) and C. glutamicum MVKICF1 ΔldhA ΔilvA pEKEx2-aro10-yqhD engineered for 3MB production (product titer: 2.76 g/l; yield: 0.10 g 3MB per g glucose) are the best C. glutamicum strains for pentanol isomer production reported. Up to now, 2MB was only reported as a by-product of an isobutanol production strain that accumulated 0.1 g/l 2MB and 0.43 g/l 3MB as by-products (Smith et al., 2010). In another very recent study, a C. glutamicum strain was constructed, which accumulated 0.50 g/l 3MB in complex medium supplemented with glucose (Xiao et al., 2016). In direct comparison, the rationally designed strains presented in our study allow for higher product titers in a defined medium, which reduces substrate costs. A previously published E. coli strain for 2MB production allows for a higher product titer (1.25 g/l) and product yield (0.17 g/g) compared to the C. glutamicum strains presented here, but these parameters were obtained when cultivating E. coli in medium supplemented with 14

complex medium ingredients (Cann and Liao, 2008). The best microbial 3MB production with E. coli, also when supplemented with complex medium ingredients, could be achieved by using a randomly mutagenized strain cultivated in a two-phase fermentation process. In this process, a product titer of 9.5 g/l 3MB, and a product yield of 0.11 g 3MB per g glucose could be a reached (Connor et al., 2010). A similar approach offers the potential for further optimization of the C. glutamicum 2MB and 3MB producers presented in this study. Taken together, when considering the 2-keto acid production capabilities of C. glutamicum and its high tolerance towards the cytotoxic effects of branched-chain higher alcohols in comparison to E. coli, the C. glutamicum strains presented in this study represent ideal candidates for further strain engineering towards a sustainable microbial production of 2MB and 3MB.

Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at XXX

References Abe, S., Takayama, K. I., Kinoshita, S. 1967. Taxonomical studies on glutamic acid-producing bacteria. J. Gen. Appl. Microbiol. 13, 279-301. Arndt, A., Auchter, M., Ishige, T., Wendisch, V. F., Eikmanns, B. J., 2008. Ethanol catabolism in Corynebacterium glutamicum. J. Mol. Microbiol. Biotechnol. 15, 222-233. Atsumi, S., Cann, A. F., Connor, M. R., Shen, C. R., Smith, K. M., Brynildsen, M. P., Chou, K. J., Hanai, T., Liao, J. C., 2008a. Metabolic engineering of Escherichia coli for 1-butanol production. Metab. Eng. 10, 305-311. Atsumi, S., Hanai, T., Liao, J. C., 2008b. Non-fermentative pathways for synthesis of branchedchain higher alcohols as biofuels. Nature. 451, 86-89. Atsumi, S., Wu, T. Y., Eckl, E. M., Hawkins, S. D., Buelter, T., Liao, J. C., 2010. Engineering the isobutanol biosynthetic pathway in Escherichia coli by comparison of three aldehyde reductase/alcohol dehydrogenase genes. Appl. Microbiol. Biotechnol. 85, 651-657. Bertani, G., 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62, 293-300. Blombach, B., Eikmanns, B. J., 2011. Current knowledge on isobutanol production with Escherichia coli, Bacillus subtilis and Corynebacterium glutamicum. Bioeng. Bugs. 2, 346350. Blombach, B., Riester, T., Wieschalka, S., Ziert, C., Youn, J. W., Wendisch, V. F., Eikmanns, B. J., 2011. Corynebacterium glutamicum tailored for efficient isobutanol production. Appl. Environ. Microbiol. 77, 3300-3310. 15

Blombach, B., Schreiner, M. E., Bartek, T., Oldiges, M., Eikmanns, B. J., 2008. Corynebacterium glutamicum tailored for high-yield L-valine production. Appl. Microbiol. Biotechnol. 79, 471-479. Bückle-Vallant, V., Krause, F. S., Messerschmidt, S., Eikmanns, B. J., 2014. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisocaproate production. Appl. Microbiol. Biotechnol. 98, 297-311. Burkovski, A., 2008. Corynebacteria : genomics and molecular biology. Caister Academic Press, Norfolk, UK. Cann, A. F., Liao, J. C., 2008. Production of 2-methyl-1-butanol in engineered Escherichia coli. Appl. Microbiol. Biotechnol. 81, 89-98. Cann, A. F., Liao, J. C., 2010. Pentanol isomer synthesis in engineered microorganisms. Appl. Microbiol. Biotechnol. 85, 893-9. Chen, C., Li, Y., Hu, J., Dong, X., Wang, X., 2015. Metabolic engineering of Corynebacterium glutamicum ATCC13869 for L-valine production. Metab. Eng. 29, 66-75. Chen, C. T., Liao, J. C., 2016. Frontiers in microbial 1-butanol and isobutanol production. FEMS Microbiol. Lett. 363. Cho, C., Choi, S. Y., Luo, Z. W., Lee, S. Y., 2015. Recent advances in microbial production of fuels and chemicals using tools and strategies of systems metabolic engineering. Biotechnol. Adv. 33, 1455-1466. Choi, Y. J., Lee, J., Jang, Y. S., Lee, S. Y., 2014. Metabolic engineering of microorganisms for the production of higher alcohols. mBio. 5, e01524-14. Connor, M. R., Cann, A. F., Liao, J. C., 2010. 3-Methyl-1-butanol production in Escherichia coli: random mutagenesis and two-phase fermentation. Appl. Microbiol. Biotechnol. 86, 11551164. de la Plaza, M., Fernandez de Palencia, P., Pelaez, C., Requena, T., 2004. Biochemical and molecular characterization of α-ketoisovalerate decarboxylase, an enzyme involved in the formation of aldehydes from amino acids by Lactococcus lactis. FEMS Microbiol. Lett. 238, 367-374. Dickinson, J. R., Harrison, S. J., Dickinson, J. A., Hewlins, M. J., 2000. An investigation of the metabolism of isoleucine to active amyl alcohol in Saccharomyces cerevisiae. J. Biol. Chem. 275, 10937-10942. Dickinson, J. R., Lanterman, M. M., Danner, D. J., Pearson, B. M., Sanz, P., Harrison, S. J., Hewlins, M. J., 1997. A 13C nuclear magnetic resonance investigation of the metabolism of leucine to isoamyl alcohol in Saccharomyces cerevisiae. J. Biol. Chemistry. 272, 26871-26878. Dominguez, H., Nezondet, C., Lindley, N. D., Cocaign, M., 1993. Modified carbon flux during oxygen limited growth of Corynebacterium glutamicum and the consequences for aminoacid overproduction. Biotechnology Letters. 15, 449-454. Dürre, P., 2008. Fermentative butanol production: bulk chemical and biofuel. Ann. NY. Acad. Sci. 1125, 353-362. Eggeling, L., Bott, M., 2005. Handbook of Corynebacterium glutamicum. Taylor & Francis, Boca Raton. Eikmanns, B. J., Kleinertz, E., Liebl, W., Sahm, H., 1991. A family of Corynebacterium glutamicum/Escherichia coli shuttle vectors for cloning, controlled gene expression, and promoter probing. Gene. 102, 93-98. Hasegawa, S., Uematsu, K., Natsuma, Y., Suda, M., Hiraga, K., Jojima, T., Inui, M., Yukawa, H., 2012. Improvement of the redox balance increases L-valine production by Corynebacterium glutamicum under oxygen deprivation conditions. Appl. Environ. Microbiol. 78, 865-875. Hazelwood, L. A., Daran, J. M., van Maris, A. J., Pronk, J. T., Dickinson, J. R., 2008. The Ehrlich pathway for fusel alcohol production: a century of research on Saccharomyces cerevisiae metabolism. Appl. Environ. Microbiol. 74, 2259-2266. Heider, S. A., Wendisch, V. F., 2015. Engineering microbial cell factories: Metabolic engineering of Corynebacterium glutamicum with a focus on non-natural products. Biotechnol. J. 10, 1170-1184. 16

Inui, M., Kawaguchi, H., Murakami, S., Vertes, A. A., Yukawa, H., 2004a. Metabolic engineering of Corynebacterium glutamicum for fuel ethanol production under oxygen-deprivation conditions. J. Mol. Microbiol. Biotechnol. 8, 243-254. Inui, M., Murakami, S., Okino, S., Kawaguchi, H., Vertes, A. A., Yukawa, H., 2004b. Metabolic analysis of Corynebacterium glutamicum during lactate and succinate productions under oxygen deprivation conditions. J. Mol. Microbiol. Biotechnol. 7, 182-196. Jambunathan, P., Zhang, K., 2014. Novel pathways and products from 2-keto acids. Curr. Opin. Biotechnol. 29C, 1-7. Kallscheuer, N., Vogt, M., Stenzel, A., Gatgens, J., Bott, M., Marienhagen, J., 2016. Construction of a Corynebacterium glutamicum platform strain for the production of stilbenes and (2S)flavanones. Metab. Eng. 38, 47-55. Keilhauer, C., Eggeling, L., Sahm, H., 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon. J. Bacteriol. 175, 5595-5603. Krause, F. S., Blombach, B., Eikmanns, B. J., 2010. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisovalerate production. Appl. Environ. Microbiol. 76, 8053-8061. Litsanov, B., Brocker, M., Bott, M., 2012. Toward homosuccinate fermentation: metabolic engineering of Corynebacterium glutamicum for anaerobic production of succinate from glucose and formate. Appl. Environ. Microbiol. 78, 3325-3337. Marienhagen, J., Eggeling, L., 2008. Metabolic function of Corynebacterium glutamicum aminotransferases AlaT and AvtA and impact on L-valine production. Appl. Environ. Microbiol. 74, 7457-7462. Marienhagen, J., Kennerknecht, N., Sahm, H., Eggeling, L., 2005. Functional analysis of all aminotransferase proteins inferred from the genome sequence of Corynebacterium glutamicum. J. Bacteriol. 187, 7639-7646. Michel, A., Koch-Koerfges, A., Krumbach, K., Brocker, M., Bott, M., 2015. Anaerobic growth of Corynebacterium glutamicum via mixed-acid fermentation. Appl. Environ. Microbiol. 81, 7496-7508. Okino, S., Inui, M., Yukawa, H., 2005. Production of organic acids by Corynebacterium glutamicum under oxygen deprivation. Appl. Microbiol. Biotechnol. 68, 475-480. Otten, A., Brocker, M., Bott, M., 2015. Metabolic engineering of Corynebacterium glutamicum for the production of itaconate. Metab. Eng. 30, 156-165. Park, S. H., Kim, H. U., Kim, T. Y., Park, J. S., Kim, S. S., Lee, S. Y., 2014. Metabolic engineering of Corynebacterium glutamicum for L-arginine production. Nat. Commun. 5, 4618. Radmacher, E., Vaitsikova, A., Burger, U., Krumbach, K., Sahm, H., Eggeling, L., 2002. Linking central metabolism with increased pathway flux: L-valine accumulation by Corynebacterium glutamicum. Appl. Environ. Microbiol. 68, 2246-2250. Rados, D., Carvalho, A. L., Wieschalka, S., Neves, A. R., Blombach, B., Eikmanns, B. J., Santos, H., 2015. Engineering Corynebacterium glutamicum for the production of 2,3-butanediol. Microb. Cell Fact. 14, 171. Romagnoli, G., Luttik, M. A., Kotter, P., Pronk, J. T., Daran, J. M., 2012. Substrate specificity of thiamine pyrophosphate-dependent 2-oxo-acid decarboxylases in Saccharomyces cerevisiae. Appl. Environ. Microbiology. 78, 7538-7548. Sahm, H., Eggeling, L., 1999. D-Pantothenate synthesis in Corynebacterium glutamicum and use of panBC and genes encoding L-valine synthesis for D-pantothenate overproduction. Appl. Environ. Microbiol. 65, 1973-1979. Sambrook, J., Russell, D. W., 2001. Molecular cloning : a laboratory manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. Schiel-Bengelsdorf, B., Montoya, J., Linder, S., Dürre, P., 2013. Butanol fermentation. Environ. Technol. 34, 1691-1710. Schrumpf, B., Eggeling, L., Sahm, H., 1992. Isolation and prominent characteristics of an L-lysine hyperproducing strain of Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 37, 566-571. Shen, C. R., Liao, J. C., 2008. Metabolic engineering of Escherichia coli for 1-butanol and 1propanol production via the keto-acid pathways. Metab. Eng. 10, 312-320. 17

Smith, K. M., Cho, K. M., Liao, J. C., 2010. Engineering Corynebacterium glutamicum for isobutanol production. Appl. Microbiol. Biotechnol. 87, 1045-1055. Song, Y., Li, J., Shin, H. D., Du, G., Liu, L., Chen, J., 2015. One-step biosynthesis of α-ketoisocaproate from L-leucine by an Escherichia coli whole-cell biocatalyst expressing an L-amino acid deaminase from Proteus vulgaris. Sci. Rep. 5, 12614. Stephanopoulos, G., 2007. Challenges in engineering microbes for biofuels production. Science. 315, 801-804. Su, H., Zhao, Y., Zhao, H., Wang, M., Li, Q., Jiang, J., Lu, Q., 2014. Identification and assessment of the effects of yeast decarboxylases expressed in Escherichia coli for producing higher alcohols. J. Appl. Microbiol. 117, 126-138. Tashiro, Y., Rodriguez, G. M., Atsumi, S., 2015. 2-Keto acids based biosynthesis pathways for renewable fuels and chemicals. Journal of industrial microbiology & biotechnology. 42, 361-73. Vogt, M., Haas, S., Klaffl, S., Polen, T., Eggeling, L., van Ooyen, J., Bott, M., 2014. Pushing product formation to its limit: metabolic engineering of Corynebacterium glutamicum for Lleucine overproduction. Metab. Eng. 22, 40-52. Vogt, M., Haas, S., Polen, T., van Ooyen, J., Bott, M., 2015a. Production of 2-ketoisocaproate with Corynebacterium glutamicum strains devoid of plasmids and heterologous genes. Microb. Biotechnol. 8, 351-360. Vogt, M., Krumbach, K., Bang, W. G., van Ooyen, J., Noack, S., Klein, B., Bott, M., Eggeling, L., 2015b. The contest for precursors: channelling L-isoleucine synthesis in Corynebacterium glutamicum without byproduct formation. Appl. Microbiol. Biotechnol. 99, 791-800. Vuralhan, Z., Luttik, M. A., Tai, S. L., Boer, V. M., Morais, M. A., Schipper, D., Almering, M. J., Kotter, P., Dickinson, J. R., Daran, J. M., Pronk, J. T., 2005. Physiological characterization of the ARO10-dependent, broad-substrate-specificity 2-oxo acid decarboxylase activity of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 71, 3276-3284. Wieschalka, S., Blombach, B., Bott, M., Eikmanns, B. J., 2013. Bio-based production of organic acids with Corynebacterium glutamicum. Microb. Biotechnol. 6, 87-102. Witthoff, S., Mühlroth, A., Marienhagen, J., Bott, M., 2013. C1 metabolism in Corynebacterium glutamicum: an endogenous pathway for oxidation of methanol to carbon dioxide. Appl. Environ, Microbiol. 79, 6974-6983. Xiao, S., Xu, J., Chen, X., Li, X., Zhang, Y., Yuan, Z., 2016. 3-methyl-1-butanol biosynthesis in an engineered Corynebacterium glutamicum. Mol. Biotechnol. 58, 311-18. Yamamoto, S., Suda, M., Niimi, S., Inui, M., Yukawa, H., 2013. Strain optimization for efficient isobutanol production using Corynebacterium glutamicum under oxygen deprivation. Biotechnol. Bioeng. 110, 2938-2948 Yin, L., Hu, X., Xu, D., Ning, J., Chen, J., Wang, X., 2012. Co-expression of feedback-resistant threonine dehydratase and acetohydroxy acid synthase increase L-isoleucine production in Corynebacterium glutamicum. Metab. Eng. 14, 542-50. Yukawa, H., Inui, M., 2013. Corynebacterium glutamicum biology and biotechnology. Microbiology monographs. Springer, Heidelberg. Table 1. Strains and plasmids used in this study. Strain or plasmid

Relevant characteristicsa, b

Source or reference

C. glutamicum strains Wild type

wild type ATCC 13032, biotin auxotrophic

Abe et al., 1967

MV-LeuF1

Rational designed L-leucine producer, based on C. glutamicum wild type ATCC 13032

Vogt et al., 2014

MV-KICF1

MV-LeuF1 derivative with chromosomal replacement of ATG start codon of gene ilvE by 18

Vogt et al.,

GTG start codon

2015a

MV-KICF1 ΔldhA

MV-LeuF1 derivative with in-frame deletion of gene ldhA

This study

MV-KICF1 ΔldhA ΔilvA

MV-KICF1 ΔldhA derivative with in-frame deletion of gene ilvA

This study

K2P55

Rationally designed L-isoleucine producer, leucine auxotrophic, based on C. glutamicum strain MH2022B (derived from wild type ATCC 13032)

Schrumpf et al., 1992; Vogt et al., 2015b

CB-KMVF1

CB-KMVF1 derivative with chromosomal replacement of the ATG start codon of ilvE by GTG

This study

CB-KMVF1 ΔldhA

CB-KMVF1 derivative with in-frame deletion of gene ldhA

This study

F– Φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17 (rK–, mK+) phoA supE44 λ– thi-1 gyrA96 relA1

Invitrogen (Karlsruhe, Germany)

pK19mobsacB-GTGilvE

Kanr, plasmid for replacement of ATG start codon of ilvE gene by GTG

Vogt et al., 2015a

pK19mobsacB-ΔldhA

Kanr, plasmid for in-frame deletion of ldhA gene

Litsanov et al., 2012

pK19mobsacB-ΔilvA

Kanr, plasmid for in-frame deletion of ilvA gene

Sahm and Eggeling, 1999

pEKEx2

Kanr; E. coli/C. glutamicum shuttle vector for inducible gene expression (Ptac, lacIq, pBL1 oriVC.g.,pUC18 oriVE.c.)

Eikmanns et al., 1991

pEKEx2_aro10-adh2

Kanr; pEKEx2 derivative containing aro10 gene from S. cerevisiae and adh2 gene from S. cerevisiae

This study

pEKEx2_aro10-adhA

Kanr; pEKEx2 derivative containing aro10 gene from S. cerevisiae and adhA gene from C. glutamicum

This study

pEKEx2_aro10-yqhD

Kanr; pEKEx2 derivative containing aro10 gene from S. cerevisiae and yqhD gene from E. coli

This study

pEKEx2_kivd-adh2

Kanr; pEKEx2 derivative containing kivd gene from L. lactis and adh2 gene from S. cerevisiae

This study

pEKEx2_kivd-adhA

Kanr; pEKEx2 derivative containing kivd gene from L. lactis and adhA gene from C. glutamicum

This study

pEKEx2_kivd-yqhD

Kanr; pEKEx2 derivative containing kivd gene from L. lactis and yqhD gene from E. coli

This study

pEKEx2_thi3-adh2

Kanr; pEKEx2 derivative containing thi3 gene from S. cerevisiae and adh2 gene from S. cerevisiae

This study

pEKEx2_ thi3-adhA

Kanr; pEKEx2 derivative containing thi3 gene from S. cerevisiae and adhA gene from C. glutamicum

This study

E. coli strains DH5α

Plasmids

19

pEKEx2_ thi3-yqhD

Kanr; pEKEx2 derivative containing thi3 gene from S. cerevisiae and yqhD gene from E. coli

This study

a Kanr;

kanamycin resistance aro10/thi3/adh2 from S. cerevisiae, kivd from L. lactis, and yqhD from E. coli were codonoptimized versions for heterologous expression in C. glutamicum. b Genes

Table 2. DNA-oligonucleotides used in this study. Name

DNA Sequence (5´- 3´)a, b

Restriction site

aro10_For

GGAACTGCAGAAGGAGGATCACCATGGCACCA GTGACCATCGAAAAG

PstI

aro10_Rev

GGGAGGATCCTTACTTCTTGTTGCGCTTCAGT G

BamHI

kivd_For

AAAACTGCAGAAGGAGGATCACCATGTACACC GTGGGCGATTAC

PstI

kivd_Rev

GGAAGGATCCTTAGGACTTGTTCTGTTCTGCG

BamHI

thi3_For

GGGACTGCAGAAGGAGGATCACCATGAACTCC TCTTACACCCAG

PstI

thi3_Rev

GGGAGGATCCTTAGTAGCCGACCTGGTTCTTC

BamHI

adh2_For

GGAAGGATCCTCTAAGGAGGATCACCATGTCC ATCCCAGAAACCCAGAAGG

BamHI

adh2_Rev

GGAAGAGCTCTTACTTGGAGGTATCCACCACG

SacI

adhA_For

GGAAGGTACCTCTAAGGAGGATCACCATGACC ACTGCTGCACCCCAAGAATTTAC

KpnI

adhA_Rev

GGGGGAATTCTTAGAAACGAATCGCCACACGA CCATC

EcoRI

yqhD_For

GGGAGGATCCTCTAAGGAGGATCACCATGAAC AACTTCAACCTGCAC

BamHI

yqhD_Rev

GGGAGAGCTCTTAGCGTGCTGCTTCGTAGATG

SacI

a Introduced b Introduced

recognition sites for restriction endonucleases are underlined. Shine-Dalgarno sequences are shown in bold

Fig. 1. Schematic representation of the biosynthesis pathway of the three branched-chain amino acids in C. glutamicum, their corresponding 2-keto acids, and the alcohols that can be derived thereof. Biosynthesis of L-lactate is additionally shown. Enzymes and their corresponding genes are shown in boxes. Enzymatic activities of 2-keto acid decarboxylases (KDC) and alcohol dehydrogenases (ADH) introduced through heterologous gene expression are shown in grey 20

boxes. Abbreviations (respective enzyme-encoding genes in brackets): 2MB, 2-methyl-1butanol; 3MB, 3-methyl-1-butanol, AHAS, acetohydroxyacid synthase (ilvBN); AHAIR, acetohydroxyacid isomeroreductase (ilvC); BCAAT, branched-chain amino acid transaminase (ilvE); DHAD, dihydroxyacid dehydratase (ilvD); IPMD, 3-isopropylmalate dehydratase (leuCD); IPMDH, 3-isopropylmalate dehydrogenase (leuB); IPMS, 2-isopropylmalate synthase (leuA); KIC, 2-ketoisocaproate; KIV, 2-ketoisovalerate; KMV, 2-keto-3-methylvalerate; LDH, L-lactate dehydrogenase (ldhA); TD, threonine dehydratase (ilvA); TCA, tricarboxylic acid cycle. Fig. 2. Comparison of C. glutamicum strains MV-KICF1 (panel A), MV-KICF1 ΔldhA (panel B), and MV-KICF1 ΔldhA ΔilvA (panel C) during shake-flask cultivations in defined CGXII medium with 4 % (w/v) glucose and 1 mM each of L-valine, L -isoleucine, and L -leucine. Growth, KIV formation, KMV formation, and KIC formation are shown. The data represent mean values and standard deviations obtained from three independent cultivations. Fig. 3. Comparison of the C. glutamicum strains K2P55 (panel A), CB-KMVF1 (panel B), and CBKMV ΔldhA (panel C) during shake-flask cultivation in defined CGXII medium with 4 % (w/v) glucose and 1 mM of each L -valine, L -isoleucine, and L -leucine. Growth, KIV formation, KMV formation, and KIC formation are shown. The data represent mean values and standard deviations obtained from three independent cultivations. Fig. 4. Comparison of C. glutamicum strain CB-KMVF1 ΔldhA carrying either pEKEx2-kivd-adh2 (A), pEKEx2-kivd-adhA (B), pEKEx2-kivd-yqhD (C), pEKEx2-aro10-adh2 (D), pEKEx2-aro10-adhA (E), or pEKEx2-aro10-yqhD (F) during glass bottle cultivation in defined CGXII medium with 4 % (w/v) glucose and 1 mM each of L-valine, L-isoleucine, L-leucine, and IPTG under oxygendeprivation conditions. Isobutanol formation, 2MB formation, and 3MB formation are shown. The data represent mean values and standard deviations obtained from three independent cultivations. Fig. 5. Comparison of C. glutamicum strain MV-KICF1 ΔldhA ΔilvA carrying either pEKEx2-kivdadh2 (A), pEKEx2-kivd-adhA (B), pEKEx2-kivd-yqhD (C), pEKEx2-aro10-adh2 (D), pEKEx221

aro10-adhA (E), or pEKEx2-aro10-yqhD (F) during glass bottle cultivation in defined CGXII medium with 4 % (w/v) glucose and 1 mM each of L-valine, L -isoleucine, L –leucine, and IPTG under oxygen-deprivation conditions. Isobutanol formation, 2MB formation, and 3MB formation are shown. The data represent mean values and standard deviations obtained from three independent cultivations.

Highlights: 

C. glutamicum strains for the synthesis of 2- and 3-methyl-1-butanol are available



Pentanol synthesizing strains are based on potent C. glutamicum 2-keto acid-producers



Nine combinations of decarboxylases and dehydrogenases were tested for production



Best performing C. glutamicum strains for pentanol production reported so far

22

23

24

25