- Email: [email protected]
Progesterone, glucocorticoid, but not estrogen receptor mRNA is altered in breast cancer stroma
Cancer Letters 255 (2007) 77–84 www.elsevier.com/locate/canlet
Progesterone, glucocorticoid, but not estrogen receptor mRNA is altered in breast cancer stroma Robert A. Smith a, Rod A. Lea a, Stephen R. Weinstein b, Lyn R. Griffiths a
a,*
Genomics Research Centre and Wesley Research Institute, School of Health Science, Griffith University Gold Coast, PMB 50 Gold Coast Mail Centre, Qld 9726, Australia b Department of Pathology, Gold Coast Hospital, Southport, Qld, Australia Received 13 December 2006; received in revised form 26 March 2007; accepted 26 March 2007
Abstract Our laboratory has previously found that anti-mitogenic nuclear receptor mRNA is elevated in late stage tumours and this study was performed to scrutinize the possibility of cancer-stroma crosstalk using hormone signaling in these tissues. RNA levels in stromal tissue were examined for the estrogen a, estrogen b, androgen, progesterone and glucocorticoid nuclear receptors by a semi-quantitative PCR. Significant differences in expression between the cancer stroma and control tissue were seen, analyzing for both cancer grade and estrogen receptor status. Stroma and control tissue were significantly different for the progesterone and glucocorticoid nuclear receptors (p = 5.908 · 107 and 2.761 · 105, respectively). Glucocorticoid receptor also showed a significant increase to mRNA levels in the stroma of estrogen receptor negative tumours (p = 5.85 · 105). By contrast, the estrogen receptors a and b, those most closely associated with breast tissue growth, showed no significant change in mRNA (p = 0.372 and 0.655, respectively). Androgen receptor mRNA also remained unaffected (p = 0.174). 2007 Published by Elsevier Ireland Ltd. Keywords: Nuclear receptors; Breast cancer; Stroma; mRNA; Expression
1. Introduction Breast cancer is a great source of morbidity and mortality in the developed world, being the most common cause of cancer death in Australian women and affecting roughly 1 in 10 women, with rates varying slightly by country [1,2]. The development and progression of cancers is a multi-stage process, * Corresponding author. Tel.: +61 7 5552 8664; fax: +61 7 5552 8908. E-mail address: L.Griffiths@griffith.edu.au (L.R. Griffiths).
involving numerous perturbations to normal cellular functions, especially to those genes which control cellular growth, cellular differentiation and DNA repair [3,4]. Over time, these alterations combine to change normal cells into cancerous ones that typically no longer respond to normal control stimuli and grow with great rapidity. Recent studies are showing that there is significant crosstalk between cancer and apparently healthy cells. These studies also indicate that the stroma of a tumour also plays a role in its development and progression and that this apparently
0304-3835/$ - see front matter 2007 Published by Elsevier Ireland Ltd. doi:10.1016/j.canlet.2007.03.019
78
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
healthy stromal tissue may have suffered some damage itself [5,6]. Stromal tissue may show changes which are characteristic of tumour growth well before there is any sign of abnormal morphology or behaviour in the tissue that will eventually form the tumour [7]. Studies have also indicated that the expression of genes in the stroma of a tumour may differ significantly from expression in normal, healthy tissue. These changes include the unusual expression of genes involved in wound healing and inflammation, such as desmin, smooth muscle aactin, myosin, collagenases, and other remodeling proteins [6–9]. In tumours that are more advanced, stromal cells may show more extreme perturbations to gene expression, characterised by alterations in growth patterns and rates, though these may also be present prior to tumourigenesis and may be one of the mechanisms that assist in tumour formation [7]. There are numerous ways in which stroma and tumour can influence one another, including the release of molecules that remodel the extracellular environment directly, as well as releasing signaling molecules that affect the transcription of genes in nearby cells [6–9]. It has still not been determined if the relationship between tumour and stroma is initiated by the stroma, the tumour, both together or is capable of being initiated by either one [7,9]. The nuclear receptors are a family of proteins which accept incoming signals from various molecules, and then alter gene expression or affect cell behaviour directly [10–12]. The nuclear receptors that receive signals from hormones such as estrogen and testosterone often affect cellular growth and differentiation, and have been used as successful treatment avenues, so how these genes behave in cancer is of great interest. Studies on stromal signaling have found that estrogen can be produced and released from breast stroma into nearby tissue, inducing growth in the tumour [13]. The effects of the nuclear receptor genes vary depending on tissue and these effects can be modulated by the presence of specific co-factors in the cells, as well as the presence of different splice variants. The relative concentrations of these factors can radically change the effect of receptor stimulation, making the pathways involving these genes highly complex [14,15]. The estrogen receptor (ESR) is one of the most important factors in breast cancer. There are two forms of ESR, the products of different genes, termed ESRa and ESRb. Both ESR receptors play a large role in cellular metabolism and especially in the breast. The primary ESR form, ESRa, is a
mitogenic factor in the breast, a function which is also common to other tissues [16]. Together, the two forms modulate one another’s effects, having a number of other effects, including maintaining bone density in both men and women [17]. Some advanced breast tumours will lose expression of ESR, either because the gene becomes disabled and they already produce the needed growth factors themselves or else the receptor is mutated into a permanently active state [18]. In these breast cancers the cell does not respond to estrogen stimulation and will often respond poorly to other drugs that rely on the manipulation of estrogen mediated pathways, like tamoxifen. The progesterone receptor (PgR) has many functions in various tissues, and primarily it acts as an antagonist to several other members of the steroid receptor family, including the estrogen receptor [12]. As such, it is quite important in breast cancer, and its continued expression in a tumour is a good prognostic factor, indicating that the tumour will be more responsive to hormone based treatments [19]. The expression of PgR is up-regulated by estrogen stimulation [19], this feedback relationship serving to keep signaling from both receptors balanced. Retaining this particular mechanism of ESR control is part of what makes ESR/PgR positive tumours sensitive to hormone treatments. Similarly to PgR, the glucocorticoid receptor (GR) is growth suppressive in the breast [20]. Part of this anti-proliferative effect may be due to an ability to promote differentiation, since activated glucocorticoid receptor has been observed to induce tissue differentiation in murine cancers [21]. Additionally, the glucocorticoid receptor has been found to be a general antagonist for estrogen in breast tissue [20]. Glucocorticoid treatments have been used in breast cancer, though like estrogen based approaches, some individuals show resistance to it. It has been observed that estrogen acts to down-regulate the expression of the glucocorticoid receptor gene [20], which may contribute to the resistance some tumours show to glucocorticoid treatment. The androgen receptor (AR) mediates a number of functions, not only in male specific tissues, but also in other areas, including the breast and nervous system [22]. The androgen receptor is important in breast cancer because of the inhibitory effect that androgen stimulation has on breast tissue growth. This anti-proliferative effect is believed to be dependant on AR itself, rather than interaction with estrogen or ESR, due to the fact that combined
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
androgen/anti-estrogen therapy is more effective than either treatment alone [23,24]. However, in certain tumours and breast cancer cell lines, androgens have been found to induce a proliferative response [23,25]. The nature of this role reversal is still poorly understood, but is believed to be caused by mutations to the AR gene, alterations of co-activator behaviour or the aromatase mediated conversion of androgens to estrogen in the cells or surrounding tissue [23,25]. Previous work in our laboratory has found a significant association between the expression of the progesterone, glucocorticoid and androgen nuclear receptors and breast cancer grade. This study was performed to investigate the possibility of an effect of cancer grade on nuclear receptor expression in the surrounding stroma [26,27]. 2. Materials and methods 2.1. Samples The sample population was comprised of 25 archived breast tissue sections embedded in paraffin and fixed with 10% buffered formalin on slides, with H&E stained slides as a reference. All samples were derived from infiltrating ductal carcinoma bearing tissue. There were 6 samples from tumour grade 1, 7 samples each from grades 2 and 3 and 5 samples of benign breast tissue taken from unaffected patients as the control population. The average age of the individuals from whom the biopsies were obtained were 56.88, 59.18, 60.45 and 55.93 years for the control and grades 1, 2 and 3 stroma, respectively. Due to difficulties with the PCR reaction for ESRa however, only three of each grade of tumour tissue and four of the controls produced reliable results. The average ages for this population were 57.5, 57.66, 56.0 and 59.66 years for control and grades 1, 2 and 3 stroma, respectively. The archival breast tissue samples were obtained through collaboration with the Pathology Department of the Gold Coast Hospital, with relevant ethical approvals. For consistency, cancer grade for each sample was determined by a single pathologist. Pathological tests also included immunohistochemical staining to detect ESRa proteins and a summary of the population’s ESRa status can be found in Table 1.
Table 1 Population ESRa immunohistochemical staining status Tumour grade
ESRa positive
ESRa negative
Total
Control Grade 1 Grade 2 Grade 3
5 6 5 2
0 0 2 5
5 6 7 7
79
2.2. Expression assay RNA was extracted as outlined in our previous publication [27]. Each slide underwent separation of stromal from tumour tissue by microdissection, using the H&E stained slides to distinguish tumour from surrounding tissue. Control tissue could not be accurately microdissected and was taken whole. Paraffin was then removed with xylene washes, the dissected tissue homogenised and then digested with TRIzol reagent. RNA was separated from DNA by adding chloroform and centrifuging. Extracted RNA was then pelleted, Rnasin and Dnase treated to protect the RNA and remove any contaminants. Finally, RNA was further purified using a Qiagen Rneasy Mini Kit. cDNA was then generated using Superscript III from Invitrogen, the reaction primed using random hexamers to maximise cDNA yield from partly degraded RNA. Newly transcribed cDNA underwent PCR with fluorescently tagged primers to amplify fragments corresponding to the mRNA for ESRa, ESRb, GR, PgR and AR. Individual samples underwent PCR in triplicate for each gene before results were pooled. Because of the large size of introns in the NR genes, intron spanning primers would be unlikely to amplify in a PCR optimized for small fragments, therefore triple primer sets were designed so that genomic DNA contamination would be indicated by amplification from a second reverse primer, placed a short distance into the intron. However, due to difficulties in obtaining functional triple ESRa and AR primer sets for the detection of DNA contamination, these nuclear receptors were multiplexed with the intronic primers for the glucocorticoid receptor gene instead. No genomic DNA contamination was observed in any sample. Primer details appear in Table 2. The fragment amplified for all receptors was approximately 100
Table 2 Primer Compositions Sequence (5 0 –3 0 )
Primer Name a
ESRaEX1-F1 ESRaEX1-R1 ESRbEX2-F1a ESRbEX2-R1 ESRbIntron2 PREX4-F1a PREX4-R1 PREX4-R2 GREX2-F1a GREX2-R1 GREX2-R2 AREX1-F1a AREX1-R1 18S-Ab 18S-B a b
CCAAAGCATCTGGGATGGCC GGATCTTGAGCTGCGGACGG CCAACACCTGGGCACCTTTC CCAGGGACTCTTTTGAGGTTC TGGCTAGCAACTATAATTCAGAATGAA ATTGATGACCAGATAACTCTCCAT CTGACGTGTTTGTAGGATCTC GTAGTTAATTTACTGCATAGAGTG GAGTACCTCTGGAGGACAGA GCTTCTGATCCTGCTGTTGA ATGTCCATTCTTAAGAAACAGGA CCTGATGTGTGGTACCCTGG CCGGAGTAGCTATCCATCCA CTTAGAGGGACAAGTCGCG GGACATCTAAGGGCATCACA
Primer labeled with TET at 5 0 . Primer labeled with HEX at 5 0 .
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
base pairs long, allowing cDNA derived from partially degraded RNA to be fully utilised. Fragments produced by any contaminating genomic DNA present was 150 bp in length for samples using the PgR or GR primers and 161 for the ESRb intronic primer. To control for PCR efficiency, all nuclear receptors were also multiplexed with the ribosomal 18S gene. Gene expression was quantified using an ABI 310 Genetic Analyser, utilizing peak height as the measure of expression.
Expression Ratio (ESRα /18S)
80
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
Control
2.3. Statistical analysis
Grade 3
0.35 0.3 0.25 0.2 0.15 0.1 0.05 0
Control
Grade 1
Grade 2
Grade 3
Fig. 2. Expression of ESRb in stroma derived from different tumor grades.
3. Results
**
Expression Ratio (PgR/18S)
0.7
The expression levels for ESRa, ESRb, PgR, GR and AR were determined for all archival tissue samples (with the exception of ESRa, as detailed in the Samples section above), with the normalised data summarised in Table 3. Comparisons were then made using the grade of tumour the stroma was derived from and the tumour’s ESRa protein status as grouping variables. Initial observations of the data indicated that several possible alterations in expression for the various groups could be occurring. ESRa expression for grade 1 stroma (see Fig. 1) shows an increase in expression compared to control and other stromal tissue, PgR (Fig. 3) showed a drop in expression for all stromal tissues, while GR and AR (Figs. 4 and 5) showed increased expression in later stage stromal tissues.
Grade 2
Fig. 1. Expression of ESRa in stroma derived from different tumor grades.
Expression Ratio (ESRβ/18S)
Expression data obtained for all receptors was expressed as a ratio of the expression of the receptor to expression of 18S, which had been multiplexed with each stromal and control sample. As mentioned above, this controls for PCR efficiency by normalizing the data. Normalized values for each triplicate sample were then averaged to give the final data used. Normalized final data was analysed using One-way Analysis of Variance (ANOVA) to determine if there was a significant difference of expression between tumour grades. A second ANOVA test was performed to determine whether expression of the nuclear receptors was significantly affected by ESRa status. Appropriate post hoc tests were subsequently performed to elucidate any differences found. The conventional a-level of 0.05 was specified as the significance threshold. The software package SPSS version 10.1 was employed for all statistical analyses.
Grade 1
0.6 0.5 0.4 0.3 0.2 0.1 0
Control
Grade 1
Grade 2
* p= 0.05-0.001
Grade 3
** p= <-0.001
Fig. 3. Expression of PgR in stroma derived from different tumor grades.
Table 3 Normalised data for nr expression by tumour grade (NR/18S) Tissue
ESRa
ESRb
PgR
GR
AR
Control Grade 1 stroma Grade 2 stroma Grade 3 stroma
0.429228 0.651124 0.537429 0.25739
0.223349 0.238575 0.239743 0.280238
0.56524 0.064177 0.085006 0.117354
0.221925 0.306093 0.43453 0.696899
0.274586 0.215329 0.356536 0.340419
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84 **
Expression Ratio (GR/18S)
0.8
**
0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
Control
Grade 1
Grade 2
* p= 0.05-0.001
Grade 3
** p= <-0.001
Fig. 4. Expression of GR in stroma derived from different tumor grades.
81
a p value of 0.655. Post hoc tests indicated that the expression of PgR was significantly lower in all stromal tissues compared to control, while expression of GR increased in stroma from grades 2 and 3 tumour tissue, with grade 1 forming an intermediate step between control and grade 2 stroma, being significantly different from neither. The initial data for the comparison by ESRa protein status showed some relatively minor changes in all samples, but the two most pronounced differences were for PgR and GR, showing a drop and a rise in receptor expression, respectively. After ANOVA analysis however, only the difference observed in GR expression proved to be significant (p = 0.00005), with all other differences in the tested receptors being insignificant. A summary of all ANOVA results, for both grade and ESRa protein status comparisons can be found in Table 4.
4. Discussion Expression Ratio (AR/18S)
0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0
Control
Grade 1
Grade 2
Grade 3
Fig. 5. Expression of AR in stroma derived from different tumor grades.
By comparison, the data for ESRb indicated that there is little variance in ESRb expression, regardless of what stage of cancer the tissue is derived from (see Fig. 2). However, when ANOVA testing was applied, significant results were only returned for the progesterone and glucocorticoid receptors (both p < 0.0001), with the alterations shown in ESRa and AR being insignificant (p = 0.372 and 0.174, respectively). Changes in ESRb were, as the preliminary data indicated, insignificant, with
The results of these experiments have shown that there were some significant differences in gene expression between normal control breast tissue and the stromal tissue from cancer. Whilst stromal expression of progesterone receptors showed significant alteration to their expression compared with controls, significant alteration of glucocorticoid receptor expression was seen in the stroma of grades 2 and 3 tumors only. Additionally, when analysed by ESRa protein status, differences in glucocorticoid expression were also detected. For the progesterone receptor, this was manifested in a significant drop in expression for all grades of cancer when compared to control. This is in marked contrast to the mRNA pattern observed in the tumours, which showed increasing expression of PgR as cancer grade increased, with a significant difference in grade 3 as compared to control [26]. These expression patterns for the stromal samples indicate that something significant is happening to the signals they receive at around the time of carcinogenesis and that the tumour itself may be the culprit. It is, of course, in the interest of
Table 4 ANOVA results for NR expression by tumour grade and ESRa status Tumour grade
ESRa ESRb PgR GR AR
ESRa protein status
F statistic
Significance
F statistic
Significance
1.249 0.547 23.799 14.228 1.822
0.372 0.655 5.908 · 107 2.761 · 105 0.174
0.532 0.533 2.425 24.093 2.228
0.487 0.473 0.133 5.85 · 105 0.149
82
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
the tumour that the tissue that supports it will be fully differentiated and capable of performing all of the various functions the tumour requires. Therefore, it is possible that in order to promote differentiation in the stromal cells, the tumour cells are signaling the stromal tissue through the progesterone pathway, resulting in a reduction of PgR expression as should occur in most cells when stimulated. However, if this were the case, we would expect to see a rise in ESRa expression in response to PgR stimulation as part of the feedback loop, which is not present. This could be explained by the lower number of samples that were able to produce successful results for ESRa. There is a rise in ESRa expression in early tumours in the data, but this is not significant, however, the inclusion of additional samples may have shown a significant increase. Alternately, the tumours may be signaling the pathway at a point which causes the down-regulation of PgR, but does not affect ESRa. In either case, additional research will be needed to discover the mechanism at work. The glucocorticoid receptor also showed a significant alteration to its expression in the tested tissues, when both grade and ESRa protein status were examined. Expression of GR was increased in stromal tissue supporting grades 2 and 3 tumours as compared to control tissues and grade 3 stroma compared to all tissue types. Expression of GR was also significantly elevated in stroma derived from ESRa negative tumours. It is important to note that ESRa negative tumours in this population are restricted completely to grades 2 and 3, though these grades are not universally ESRa negative, as indicated in Table 1. Thus, it is possible that these results may be measuring the same effect, and that the increase in GR expression may be an increase in stress signals on the cells as the tumours develop, or it may be the result of an alteration in tumour signaling which occurs at or near the time when ESRa expression is lost. If the increase is a result of cumulative signaling on the stroma, it may be a defensive response by the stroma to increase its susceptibility to glucocorticoid induced apoptosis, or the result of signals to the tumour for the same reasons, since our previous experiments have shown an increase in GR expression in the same tumours [26]. It is also possible that the increased GR mRNA levels observed in the grades 2 and 3 tissues may not reflect an actual increase in GR protein in the cell, with mRNA being degraded prior to translation, truncated to produce a non-functional protein or
spliced into the alternate isoform of GR which antagonizes the primary form. There was also some perturbation to expression of ESRa, ESRb and AR across cancer grades, but these changes were insignificant and no real conclusions can be drawn from them. It is interesting to note however, that AR expression was found to be significantly affected by cancer grade within the tumours themselves in our previous experiments [27]. Like both PgR and GR, the expression of AR in these tumours was found to increase along with cancer grade. It was postulated in the publication for that study that the elevated expression of AR in the tumour tissue might be a self-induced event, used as a means of side-stepping normal sensitivity to the anti-mitogenic nuclear receptors. Highly expressed AR would sequester available chaperone molecules common to the nuclear receptor family and thus render the high levels of PgR and GR observed in the tumours non-functional. The data from this experiment lends some credence to this theory, since AR expression is only changed within the tumour itself, with the stroma maintaining a normal level of AR expression. However, it is also possible that the stroma was causing the upregulation of AR expression in the tumours through some signaling mechanism, either as part of the aforementioned de-sensitization to PgR and GR, or as part of a normal growth arrest mechanisms to attempt to slow the growth of the tumour. The data offers no solid conclusions on this theory, but it does indicate that the tumour was not affecting AR expression in the stroma, excepting the possibility that it was keeping it unchanged. The data for both estrogen receptors did not show any significant alteration in their expression for any cancer grade, nor when ESRa protein status of the tumour was considered. However, the tumours themselves also showed no change in expression, yet many of the advanced tumours in this population had no detectable ESRa protein present within them. Therefore the control of ESRa expression, if not also that of ESRb which also remains static regardless of grade, would appear to be controlled at a level after mRNA transcription. Since the stroma also showed no significant alteration in expression, it is possible that changes to ESR expression in the stroma also occur at a post-transcriptional level, perhaps in the splicing of the mRNA into the various alternate isoforms of ESR a and b, which modulate the effect of estrogen stimulation on the cell. It is worth considering,
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
however, that the ESRa population in this study was smaller than the other NRs, due to PCR difficulties, and that if a larger population had been examined, the alterations present in the data may have shown a significant result. The data from this experiment indicates that there were significant effects on the expression of PgR and GR in tumour stroma, showing a drop in mRNA levels for PgR in the stroma of all grades of cancer and an increase of mRNA levels for GR in stroma derived from grades 2 and 3 tumours as well as ESRa protein negative tissues. The expression of ESRa, ESRb and AR remained unchanged. The precise implications of these results are unclear, as this data does not elucidate the ratios of the various isoforms of these receptors in the tissues, but it is possible that the stromal tissues of advanced tumours would show an increased sensitivity to glucocorticoids and thus an increased rate of apoptosis if faced with GR stimulation. Additional information on the behavior of tumour stroma would be revealed by studies concentrating on what ratios of the NR isoforms are present in the cells and how the expression of the co-factors of the nuclear receptors are affected by ESRa protein status or the grade of cancer they support. References [1] Australian Institute of Health and Welfare, Cancer in Australia 2001.
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
83
receptor by steroid antagonists in human breast cancer and osteosarcoma cells, The Journal of Biological Chemistry 275 (2000) 17771–17777. M. Misrahi, P-Y. Venencie, P. Saugier-Veber, S. Sar, P. Dessen, E. Milgrom, Structure of the human progesterone receptor gene, Biochemica et Biophisica Acta 1216 (1993) 289–292. M.-C. Keightley, Steroid receptor isoforms: exception or rule?, Molecular and Cellular Endocrinology 137 (1998) 1–5 R.J. Santen, S.J. Santner, R.J. Pauley, L. Tait, J. Kaseta, L.M. Demers, et al., Estrogen production via the aromatase enzyme in breast carcinoma: which cell type is responsible? Journal of Steroid Biochemistry and Molecular Biology 61 (1997) 267–271. S.A. Leonhardt, V. Boonyaratanakornkit, D.P. Edwards, Progesterone receptor transcription and non-transcription signaling mechanisms, Steroids 68 (2003) 761–770. P.N. MacDonald, T.A. Baudino, H. Tokumaru, D.R. Dowd, C. Zhang, Vitamin D receptor and nuclear receptor coactivators: crucial interactions in vitamin D-mediated transcription, Steroids 66 (2001) 171–176. S. Nilsson, S. Makela, E. Trueter, M. Tujague, J. Thomsen, G. Andersson, et al., Mechanisms of estrogen action, Physiological Reviews 81 (2001) 1535–1565. K.A.J. Grandien, A. Berkenstam, J.-A. Gustafsson, The Estrogen Receptor Gene: Promoter Organisation and Expression, The International Journal of Biochemistry & Cell Biology 29 (1997) 1343–1369. K.-Y. Yoo, K. Tajima, S.-K. Park, D. Kang, S.-U. Kim, K. Hirose, et al., Postmenopausal obesity as a breast cancer risk factor according to estrogen and progesterone receptor status (Japan), Cancer Letters 167 (2001) 57–63. A. Fazzari, M.G. Catalano, A. Comba, M. Becchis, M. Raineri, R. Frairia, et al., The control of progesterone receptor expression in MCF-7 breast cancer cells: effects of estradiol and sex hormone-binding globulin (SHBG), Molecular and Cellular Endocrinology 172 (2001) 31–36. A.V. Krishnan, S. Swami, D. Feldman, Estradiol inhibits glucocorticoid receptor expression and induces glucocorticoid resistance in MCF-7 human breast cancer cells, Journal of Steroid Biochemistry and Molecular Biology 77 (2001) 29–37. Y.-N. Lee, H.-Y. Lee, Y.M. Lee, H.-Y. Chung, S.-I. Kim, S.-K. Lee, et al., Involvement of glucocorticoid receptor in the induction of differentiation by ginsenosides in F9 teratocarcinoma cells, Journal of Steroid Biochemistry and Molecular Biology 67 (1998) 105–111. H.E. MacLean, G.L. Warne, J.D. Zajac, Defects of androgen receptor function: from sex reversal to motor neurone disease, Molecular and Cellular Endocrinology 112 (1995) 133–141. P. Ferro, M.G. Catalano, R. Dell’Eva, N. Fortunati, U. Pfeffer, The androgen receptor CAG repeat: a modifier of carcinogenesis? Molecular and Cellular Endocrinology 193 (2002) 109–120. V. Kuenen-Boumeester, T.H. Van der Kwast, C.C. Claassen, M.P. Look, G.S. Liem, J.G.M. Klijn, et al., The clinical significance of androgen receptors in breast cancer and their relation to histological and cell biological parameters, The European Journal of Cancer 32A (1996) 1560–1565.
84
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
[25] S.N. Birrell, J.M. Bentel, T.E. Hickey, C. Ricciardelli, M.A. Weger, D.J. Horsfall, W.D. Tilley, et al., Androgens induce divergent proliferative responses in human breast cancer cell lines, The Journal of Steroid Biochemistry and Molecular Biology 52 (1995) 459–467. [26] R.A. Smith, R.A. Lea, J.E. Curran, S.R. Weinstein, L.R. Griffiths, Expression of glucocorticoid and progesterone
nuclear receptor genes in archival breast cancer tissue, Breast Cancer Research 5 (2003) R9–R12. [27] R.A. Smith, R.A. Lea, S.R. Weinstein, L.R. Griffiths, Detection of mRNA levels for the estrogen alpha, estrogen beta and androgen nuclear receptor genes in sporadic breast cancer tissue, Cancer Letters 237 (2005) 248–255.
Progesterone, glucocorticoid, but not estrogen receptor mRNA is altered in breast cancer stroma Robert A. Smith a, Rod A. Lea a, Stephen R. Weinstein b, Lyn R. Griffiths a
a,*
Genomics Research Centre and Wesley Research Institute, School of Health Science, Griffith University Gold Coast, PMB 50 Gold Coast Mail Centre, Qld 9726, Australia b Department of Pathology, Gold Coast Hospital, Southport, Qld, Australia Received 13 December 2006; received in revised form 26 March 2007; accepted 26 March 2007
Abstract Our laboratory has previously found that anti-mitogenic nuclear receptor mRNA is elevated in late stage tumours and this study was performed to scrutinize the possibility of cancer-stroma crosstalk using hormone signaling in these tissues. RNA levels in stromal tissue were examined for the estrogen a, estrogen b, androgen, progesterone and glucocorticoid nuclear receptors by a semi-quantitative PCR. Significant differences in expression between the cancer stroma and control tissue were seen, analyzing for both cancer grade and estrogen receptor status. Stroma and control tissue were significantly different for the progesterone and glucocorticoid nuclear receptors (p = 5.908 · 107 and 2.761 · 105, respectively). Glucocorticoid receptor also showed a significant increase to mRNA levels in the stroma of estrogen receptor negative tumours (p = 5.85 · 105). By contrast, the estrogen receptors a and b, those most closely associated with breast tissue growth, showed no significant change in mRNA (p = 0.372 and 0.655, respectively). Androgen receptor mRNA also remained unaffected (p = 0.174). 2007 Published by Elsevier Ireland Ltd. Keywords: Nuclear receptors; Breast cancer; Stroma; mRNA; Expression
1. Introduction Breast cancer is a great source of morbidity and mortality in the developed world, being the most common cause of cancer death in Australian women and affecting roughly 1 in 10 women, with rates varying slightly by country [1,2]. The development and progression of cancers is a multi-stage process, * Corresponding author. Tel.: +61 7 5552 8664; fax: +61 7 5552 8908. E-mail address: L.Griffiths@griffith.edu.au (L.R. Griffiths).
involving numerous perturbations to normal cellular functions, especially to those genes which control cellular growth, cellular differentiation and DNA repair [3,4]. Over time, these alterations combine to change normal cells into cancerous ones that typically no longer respond to normal control stimuli and grow with great rapidity. Recent studies are showing that there is significant crosstalk between cancer and apparently healthy cells. These studies also indicate that the stroma of a tumour also plays a role in its development and progression and that this apparently
0304-3835/$ - see front matter 2007 Published by Elsevier Ireland Ltd. doi:10.1016/j.canlet.2007.03.019
78
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
healthy stromal tissue may have suffered some damage itself [5,6]. Stromal tissue may show changes which are characteristic of tumour growth well before there is any sign of abnormal morphology or behaviour in the tissue that will eventually form the tumour [7]. Studies have also indicated that the expression of genes in the stroma of a tumour may differ significantly from expression in normal, healthy tissue. These changes include the unusual expression of genes involved in wound healing and inflammation, such as desmin, smooth muscle aactin, myosin, collagenases, and other remodeling proteins [6–9]. In tumours that are more advanced, stromal cells may show more extreme perturbations to gene expression, characterised by alterations in growth patterns and rates, though these may also be present prior to tumourigenesis and may be one of the mechanisms that assist in tumour formation [7]. There are numerous ways in which stroma and tumour can influence one another, including the release of molecules that remodel the extracellular environment directly, as well as releasing signaling molecules that affect the transcription of genes in nearby cells [6–9]. It has still not been determined if the relationship between tumour and stroma is initiated by the stroma, the tumour, both together or is capable of being initiated by either one [7,9]. The nuclear receptors are a family of proteins which accept incoming signals from various molecules, and then alter gene expression or affect cell behaviour directly [10–12]. The nuclear receptors that receive signals from hormones such as estrogen and testosterone often affect cellular growth and differentiation, and have been used as successful treatment avenues, so how these genes behave in cancer is of great interest. Studies on stromal signaling have found that estrogen can be produced and released from breast stroma into nearby tissue, inducing growth in the tumour [13]. The effects of the nuclear receptor genes vary depending on tissue and these effects can be modulated by the presence of specific co-factors in the cells, as well as the presence of different splice variants. The relative concentrations of these factors can radically change the effect of receptor stimulation, making the pathways involving these genes highly complex [14,15]. The estrogen receptor (ESR) is one of the most important factors in breast cancer. There are two forms of ESR, the products of different genes, termed ESRa and ESRb. Both ESR receptors play a large role in cellular metabolism and especially in the breast. The primary ESR form, ESRa, is a
mitogenic factor in the breast, a function which is also common to other tissues [16]. Together, the two forms modulate one another’s effects, having a number of other effects, including maintaining bone density in both men and women [17]. Some advanced breast tumours will lose expression of ESR, either because the gene becomes disabled and they already produce the needed growth factors themselves or else the receptor is mutated into a permanently active state [18]. In these breast cancers the cell does not respond to estrogen stimulation and will often respond poorly to other drugs that rely on the manipulation of estrogen mediated pathways, like tamoxifen. The progesterone receptor (PgR) has many functions in various tissues, and primarily it acts as an antagonist to several other members of the steroid receptor family, including the estrogen receptor [12]. As such, it is quite important in breast cancer, and its continued expression in a tumour is a good prognostic factor, indicating that the tumour will be more responsive to hormone based treatments [19]. The expression of PgR is up-regulated by estrogen stimulation [19], this feedback relationship serving to keep signaling from both receptors balanced. Retaining this particular mechanism of ESR control is part of what makes ESR/PgR positive tumours sensitive to hormone treatments. Similarly to PgR, the glucocorticoid receptor (GR) is growth suppressive in the breast [20]. Part of this anti-proliferative effect may be due to an ability to promote differentiation, since activated glucocorticoid receptor has been observed to induce tissue differentiation in murine cancers [21]. Additionally, the glucocorticoid receptor has been found to be a general antagonist for estrogen in breast tissue [20]. Glucocorticoid treatments have been used in breast cancer, though like estrogen based approaches, some individuals show resistance to it. It has been observed that estrogen acts to down-regulate the expression of the glucocorticoid receptor gene [20], which may contribute to the resistance some tumours show to glucocorticoid treatment. The androgen receptor (AR) mediates a number of functions, not only in male specific tissues, but also in other areas, including the breast and nervous system [22]. The androgen receptor is important in breast cancer because of the inhibitory effect that androgen stimulation has on breast tissue growth. This anti-proliferative effect is believed to be dependant on AR itself, rather than interaction with estrogen or ESR, due to the fact that combined
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
androgen/anti-estrogen therapy is more effective than either treatment alone [23,24]. However, in certain tumours and breast cancer cell lines, androgens have been found to induce a proliferative response [23,25]. The nature of this role reversal is still poorly understood, but is believed to be caused by mutations to the AR gene, alterations of co-activator behaviour or the aromatase mediated conversion of androgens to estrogen in the cells or surrounding tissue [23,25]. Previous work in our laboratory has found a significant association between the expression of the progesterone, glucocorticoid and androgen nuclear receptors and breast cancer grade. This study was performed to investigate the possibility of an effect of cancer grade on nuclear receptor expression in the surrounding stroma [26,27]. 2. Materials and methods 2.1. Samples The sample population was comprised of 25 archived breast tissue sections embedded in paraffin and fixed with 10% buffered formalin on slides, with H&E stained slides as a reference. All samples were derived from infiltrating ductal carcinoma bearing tissue. There were 6 samples from tumour grade 1, 7 samples each from grades 2 and 3 and 5 samples of benign breast tissue taken from unaffected patients as the control population. The average age of the individuals from whom the biopsies were obtained were 56.88, 59.18, 60.45 and 55.93 years for the control and grades 1, 2 and 3 stroma, respectively. Due to difficulties with the PCR reaction for ESRa however, only three of each grade of tumour tissue and four of the controls produced reliable results. The average ages for this population were 57.5, 57.66, 56.0 and 59.66 years for control and grades 1, 2 and 3 stroma, respectively. The archival breast tissue samples were obtained through collaboration with the Pathology Department of the Gold Coast Hospital, with relevant ethical approvals. For consistency, cancer grade for each sample was determined by a single pathologist. Pathological tests also included immunohistochemical staining to detect ESRa proteins and a summary of the population’s ESRa status can be found in Table 1.
Table 1 Population ESRa immunohistochemical staining status Tumour grade
ESRa positive
ESRa negative
Total
Control Grade 1 Grade 2 Grade 3
5 6 5 2
0 0 2 5
5 6 7 7
79
2.2. Expression assay RNA was extracted as outlined in our previous publication [27]. Each slide underwent separation of stromal from tumour tissue by microdissection, using the H&E stained slides to distinguish tumour from surrounding tissue. Control tissue could not be accurately microdissected and was taken whole. Paraffin was then removed with xylene washes, the dissected tissue homogenised and then digested with TRIzol reagent. RNA was separated from DNA by adding chloroform and centrifuging. Extracted RNA was then pelleted, Rnasin and Dnase treated to protect the RNA and remove any contaminants. Finally, RNA was further purified using a Qiagen Rneasy Mini Kit. cDNA was then generated using Superscript III from Invitrogen, the reaction primed using random hexamers to maximise cDNA yield from partly degraded RNA. Newly transcribed cDNA underwent PCR with fluorescently tagged primers to amplify fragments corresponding to the mRNA for ESRa, ESRb, GR, PgR and AR. Individual samples underwent PCR in triplicate for each gene before results were pooled. Because of the large size of introns in the NR genes, intron spanning primers would be unlikely to amplify in a PCR optimized for small fragments, therefore triple primer sets were designed so that genomic DNA contamination would be indicated by amplification from a second reverse primer, placed a short distance into the intron. However, due to difficulties in obtaining functional triple ESRa and AR primer sets for the detection of DNA contamination, these nuclear receptors were multiplexed with the intronic primers for the glucocorticoid receptor gene instead. No genomic DNA contamination was observed in any sample. Primer details appear in Table 2. The fragment amplified for all receptors was approximately 100
Table 2 Primer Compositions Sequence (5 0 –3 0 )
Primer Name a
ESRaEX1-F1 ESRaEX1-R1 ESRbEX2-F1a ESRbEX2-R1 ESRbIntron2 PREX4-F1a PREX4-R1 PREX4-R2 GREX2-F1a GREX2-R1 GREX2-R2 AREX1-F1a AREX1-R1 18S-Ab 18S-B a b
CCAAAGCATCTGGGATGGCC GGATCTTGAGCTGCGGACGG CCAACACCTGGGCACCTTTC CCAGGGACTCTTTTGAGGTTC TGGCTAGCAACTATAATTCAGAATGAA ATTGATGACCAGATAACTCTCCAT CTGACGTGTTTGTAGGATCTC GTAGTTAATTTACTGCATAGAGTG GAGTACCTCTGGAGGACAGA GCTTCTGATCCTGCTGTTGA ATGTCCATTCTTAAGAAACAGGA CCTGATGTGTGGTACCCTGG CCGGAGTAGCTATCCATCCA CTTAGAGGGACAAGTCGCG GGACATCTAAGGGCATCACA
Primer labeled with TET at 5 0 . Primer labeled with HEX at 5 0 .
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
base pairs long, allowing cDNA derived from partially degraded RNA to be fully utilised. Fragments produced by any contaminating genomic DNA present was 150 bp in length for samples using the PgR or GR primers and 161 for the ESRb intronic primer. To control for PCR efficiency, all nuclear receptors were also multiplexed with the ribosomal 18S gene. Gene expression was quantified using an ABI 310 Genetic Analyser, utilizing peak height as the measure of expression.
Expression Ratio (ESRα /18S)
80
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
Control
2.3. Statistical analysis
Grade 3
0.35 0.3 0.25 0.2 0.15 0.1 0.05 0
Control
Grade 1
Grade 2
Grade 3
Fig. 2. Expression of ESRb in stroma derived from different tumor grades.
3. Results
**
Expression Ratio (PgR/18S)
0.7
The expression levels for ESRa, ESRb, PgR, GR and AR were determined for all archival tissue samples (with the exception of ESRa, as detailed in the Samples section above), with the normalised data summarised in Table 3. Comparisons were then made using the grade of tumour the stroma was derived from and the tumour’s ESRa protein status as grouping variables. Initial observations of the data indicated that several possible alterations in expression for the various groups could be occurring. ESRa expression for grade 1 stroma (see Fig. 1) shows an increase in expression compared to control and other stromal tissue, PgR (Fig. 3) showed a drop in expression for all stromal tissues, while GR and AR (Figs. 4 and 5) showed increased expression in later stage stromal tissues.
Grade 2
Fig. 1. Expression of ESRa in stroma derived from different tumor grades.
Expression Ratio (ESRβ/18S)
Expression data obtained for all receptors was expressed as a ratio of the expression of the receptor to expression of 18S, which had been multiplexed with each stromal and control sample. As mentioned above, this controls for PCR efficiency by normalizing the data. Normalized values for each triplicate sample were then averaged to give the final data used. Normalized final data was analysed using One-way Analysis of Variance (ANOVA) to determine if there was a significant difference of expression between tumour grades. A second ANOVA test was performed to determine whether expression of the nuclear receptors was significantly affected by ESRa status. Appropriate post hoc tests were subsequently performed to elucidate any differences found. The conventional a-level of 0.05 was specified as the significance threshold. The software package SPSS version 10.1 was employed for all statistical analyses.
Grade 1
0.6 0.5 0.4 0.3 0.2 0.1 0
Control
Grade 1
Grade 2
* p= 0.05-0.001
Grade 3
** p= <-0.001
Fig. 3. Expression of PgR in stroma derived from different tumor grades.
Table 3 Normalised data for nr expression by tumour grade (NR/18S) Tissue
ESRa
ESRb
PgR
GR
AR
Control Grade 1 stroma Grade 2 stroma Grade 3 stroma
0.429228 0.651124 0.537429 0.25739
0.223349 0.238575 0.239743 0.280238
0.56524 0.064177 0.085006 0.117354
0.221925 0.306093 0.43453 0.696899
0.274586 0.215329 0.356536 0.340419
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84 **
Expression Ratio (GR/18S)
0.8
**
0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
Control
Grade 1
Grade 2
* p= 0.05-0.001
Grade 3
** p= <-0.001
Fig. 4. Expression of GR in stroma derived from different tumor grades.
81
a p value of 0.655. Post hoc tests indicated that the expression of PgR was significantly lower in all stromal tissues compared to control, while expression of GR increased in stroma from grades 2 and 3 tumour tissue, with grade 1 forming an intermediate step between control and grade 2 stroma, being significantly different from neither. The initial data for the comparison by ESRa protein status showed some relatively minor changes in all samples, but the two most pronounced differences were for PgR and GR, showing a drop and a rise in receptor expression, respectively. After ANOVA analysis however, only the difference observed in GR expression proved to be significant (p = 0.00005), with all other differences in the tested receptors being insignificant. A summary of all ANOVA results, for both grade and ESRa protein status comparisons can be found in Table 4.
4. Discussion Expression Ratio (AR/18S)
0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0
Control
Grade 1
Grade 2
Grade 3
Fig. 5. Expression of AR in stroma derived from different tumor grades.
By comparison, the data for ESRb indicated that there is little variance in ESRb expression, regardless of what stage of cancer the tissue is derived from (see Fig. 2). However, when ANOVA testing was applied, significant results were only returned for the progesterone and glucocorticoid receptors (both p < 0.0001), with the alterations shown in ESRa and AR being insignificant (p = 0.372 and 0.174, respectively). Changes in ESRb were, as the preliminary data indicated, insignificant, with
The results of these experiments have shown that there were some significant differences in gene expression between normal control breast tissue and the stromal tissue from cancer. Whilst stromal expression of progesterone receptors showed significant alteration to their expression compared with controls, significant alteration of glucocorticoid receptor expression was seen in the stroma of grades 2 and 3 tumors only. Additionally, when analysed by ESRa protein status, differences in glucocorticoid expression were also detected. For the progesterone receptor, this was manifested in a significant drop in expression for all grades of cancer when compared to control. This is in marked contrast to the mRNA pattern observed in the tumours, which showed increasing expression of PgR as cancer grade increased, with a significant difference in grade 3 as compared to control [26]. These expression patterns for the stromal samples indicate that something significant is happening to the signals they receive at around the time of carcinogenesis and that the tumour itself may be the culprit. It is, of course, in the interest of
Table 4 ANOVA results for NR expression by tumour grade and ESRa status Tumour grade
ESRa ESRb PgR GR AR
ESRa protein status
F statistic
Significance
F statistic
Significance
1.249 0.547 23.799 14.228 1.822
0.372 0.655 5.908 · 107 2.761 · 105 0.174
0.532 0.533 2.425 24.093 2.228
0.487 0.473 0.133 5.85 · 105 0.149
82
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
the tumour that the tissue that supports it will be fully differentiated and capable of performing all of the various functions the tumour requires. Therefore, it is possible that in order to promote differentiation in the stromal cells, the tumour cells are signaling the stromal tissue through the progesterone pathway, resulting in a reduction of PgR expression as should occur in most cells when stimulated. However, if this were the case, we would expect to see a rise in ESRa expression in response to PgR stimulation as part of the feedback loop, which is not present. This could be explained by the lower number of samples that were able to produce successful results for ESRa. There is a rise in ESRa expression in early tumours in the data, but this is not significant, however, the inclusion of additional samples may have shown a significant increase. Alternately, the tumours may be signaling the pathway at a point which causes the down-regulation of PgR, but does not affect ESRa. In either case, additional research will be needed to discover the mechanism at work. The glucocorticoid receptor also showed a significant alteration to its expression in the tested tissues, when both grade and ESRa protein status were examined. Expression of GR was increased in stromal tissue supporting grades 2 and 3 tumours as compared to control tissues and grade 3 stroma compared to all tissue types. Expression of GR was also significantly elevated in stroma derived from ESRa negative tumours. It is important to note that ESRa negative tumours in this population are restricted completely to grades 2 and 3, though these grades are not universally ESRa negative, as indicated in Table 1. Thus, it is possible that these results may be measuring the same effect, and that the increase in GR expression may be an increase in stress signals on the cells as the tumours develop, or it may be the result of an alteration in tumour signaling which occurs at or near the time when ESRa expression is lost. If the increase is a result of cumulative signaling on the stroma, it may be a defensive response by the stroma to increase its susceptibility to glucocorticoid induced apoptosis, or the result of signals to the tumour for the same reasons, since our previous experiments have shown an increase in GR expression in the same tumours [26]. It is also possible that the increased GR mRNA levels observed in the grades 2 and 3 tissues may not reflect an actual increase in GR protein in the cell, with mRNA being degraded prior to translation, truncated to produce a non-functional protein or
spliced into the alternate isoform of GR which antagonizes the primary form. There was also some perturbation to expression of ESRa, ESRb and AR across cancer grades, but these changes were insignificant and no real conclusions can be drawn from them. It is interesting to note however, that AR expression was found to be significantly affected by cancer grade within the tumours themselves in our previous experiments [27]. Like both PgR and GR, the expression of AR in these tumours was found to increase along with cancer grade. It was postulated in the publication for that study that the elevated expression of AR in the tumour tissue might be a self-induced event, used as a means of side-stepping normal sensitivity to the anti-mitogenic nuclear receptors. Highly expressed AR would sequester available chaperone molecules common to the nuclear receptor family and thus render the high levels of PgR and GR observed in the tumours non-functional. The data from this experiment lends some credence to this theory, since AR expression is only changed within the tumour itself, with the stroma maintaining a normal level of AR expression. However, it is also possible that the stroma was causing the upregulation of AR expression in the tumours through some signaling mechanism, either as part of the aforementioned de-sensitization to PgR and GR, or as part of a normal growth arrest mechanisms to attempt to slow the growth of the tumour. The data offers no solid conclusions on this theory, but it does indicate that the tumour was not affecting AR expression in the stroma, excepting the possibility that it was keeping it unchanged. The data for both estrogen receptors did not show any significant alteration in their expression for any cancer grade, nor when ESRa protein status of the tumour was considered. However, the tumours themselves also showed no change in expression, yet many of the advanced tumours in this population had no detectable ESRa protein present within them. Therefore the control of ESRa expression, if not also that of ESRb which also remains static regardless of grade, would appear to be controlled at a level after mRNA transcription. Since the stroma also showed no significant alteration in expression, it is possible that changes to ESR expression in the stroma also occur at a post-transcriptional level, perhaps in the splicing of the mRNA into the various alternate isoforms of ESR a and b, which modulate the effect of estrogen stimulation on the cell. It is worth considering,
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
however, that the ESRa population in this study was smaller than the other NRs, due to PCR difficulties, and that if a larger population had been examined, the alterations present in the data may have shown a significant result. The data from this experiment indicates that there were significant effects on the expression of PgR and GR in tumour stroma, showing a drop in mRNA levels for PgR in the stroma of all grades of cancer and an increase of mRNA levels for GR in stroma derived from grades 2 and 3 tumours as well as ESRa protein negative tissues. The expression of ESRa, ESRb and AR remained unchanged. The precise implications of these results are unclear, as this data does not elucidate the ratios of the various isoforms of these receptors in the tissues, but it is possible that the stromal tissues of advanced tumours would show an increased sensitivity to glucocorticoids and thus an increased rate of apoptosis if faced with GR stimulation. Additional information on the behavior of tumour stroma would be revealed by studies concentrating on what ratios of the NR isoforms are present in the cells and how the expression of the co-factors of the nuclear receptors are affected by ESRa protein status or the grade of cancer they support. References [1] Australian Institute of Health and Welfare, Cancer in Australia 2001.
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
83
receptor by steroid antagonists in human breast cancer and osteosarcoma cells, The Journal of Biological Chemistry 275 (2000) 17771–17777. M. Misrahi, P-Y. Venencie, P. Saugier-Veber, S. Sar, P. Dessen, E. Milgrom, Structure of the human progesterone receptor gene, Biochemica et Biophisica Acta 1216 (1993) 289–292. M.-C. Keightley, Steroid receptor isoforms: exception or rule?, Molecular and Cellular Endocrinology 137 (1998) 1–5 R.J. Santen, S.J. Santner, R.J. Pauley, L. Tait, J. Kaseta, L.M. Demers, et al., Estrogen production via the aromatase enzyme in breast carcinoma: which cell type is responsible? Journal of Steroid Biochemistry and Molecular Biology 61 (1997) 267–271. S.A. Leonhardt, V. Boonyaratanakornkit, D.P. Edwards, Progesterone receptor transcription and non-transcription signaling mechanisms, Steroids 68 (2003) 761–770. P.N. MacDonald, T.A. Baudino, H. Tokumaru, D.R. Dowd, C. Zhang, Vitamin D receptor and nuclear receptor coactivators: crucial interactions in vitamin D-mediated transcription, Steroids 66 (2001) 171–176. S. Nilsson, S. Makela, E. Trueter, M. Tujague, J. Thomsen, G. Andersson, et al., Mechanisms of estrogen action, Physiological Reviews 81 (2001) 1535–1565. K.A.J. Grandien, A. Berkenstam, J.-A. Gustafsson, The Estrogen Receptor Gene: Promoter Organisation and Expression, The International Journal of Biochemistry & Cell Biology 29 (1997) 1343–1369. K.-Y. Yoo, K. Tajima, S.-K. Park, D. Kang, S.-U. Kim, K. Hirose, et al., Postmenopausal obesity as a breast cancer risk factor according to estrogen and progesterone receptor status (Japan), Cancer Letters 167 (2001) 57–63. A. Fazzari, M.G. Catalano, A. Comba, M. Becchis, M. Raineri, R. Frairia, et al., The control of progesterone receptor expression in MCF-7 breast cancer cells: effects of estradiol and sex hormone-binding globulin (SHBG), Molecular and Cellular Endocrinology 172 (2001) 31–36. A.V. Krishnan, S. Swami, D. Feldman, Estradiol inhibits glucocorticoid receptor expression and induces glucocorticoid resistance in MCF-7 human breast cancer cells, Journal of Steroid Biochemistry and Molecular Biology 77 (2001) 29–37. Y.-N. Lee, H.-Y. Lee, Y.M. Lee, H.-Y. Chung, S.-I. Kim, S.-K. Lee, et al., Involvement of glucocorticoid receptor in the induction of differentiation by ginsenosides in F9 teratocarcinoma cells, Journal of Steroid Biochemistry and Molecular Biology 67 (1998) 105–111. H.E. MacLean, G.L. Warne, J.D. Zajac, Defects of androgen receptor function: from sex reversal to motor neurone disease, Molecular and Cellular Endocrinology 112 (1995) 133–141. P. Ferro, M.G. Catalano, R. Dell’Eva, N. Fortunati, U. Pfeffer, The androgen receptor CAG repeat: a modifier of carcinogenesis? Molecular and Cellular Endocrinology 193 (2002) 109–120. V. Kuenen-Boumeester, T.H. Van der Kwast, C.C. Claassen, M.P. Look, G.S. Liem, J.G.M. Klijn, et al., The clinical significance of androgen receptors in breast cancer and their relation to histological and cell biological parameters, The European Journal of Cancer 32A (1996) 1560–1565.
84
R.A. Smith et al. / Cancer Letters 255 (2007) 77–84
[25] S.N. Birrell, J.M. Bentel, T.E. Hickey, C. Ricciardelli, M.A. Weger, D.J. Horsfall, W.D. Tilley, et al., Androgens induce divergent proliferative responses in human breast cancer cell lines, The Journal of Steroid Biochemistry and Molecular Biology 52 (1995) 459–467. [26] R.A. Smith, R.A. Lea, J.E. Curran, S.R. Weinstein, L.R. Griffiths, Expression of glucocorticoid and progesterone
nuclear receptor genes in archival breast cancer tissue, Breast Cancer Research 5 (2003) R9–R12. [27] R.A. Smith, R.A. Lea, S.R. Weinstein, L.R. Griffiths, Detection of mRNA levels for the estrogen alpha, estrogen beta and androgen nuclear receptor genes in sporadic breast cancer tissue, Cancer Letters 237 (2005) 248–255.