- Email: [email protected]
Prospects for whole genome linkage disequilibrium mapping in thoroughbreds
Gene 346 (2005) 127 – 132 www.elsevier.com/locate/gene
Prospects for whole genome linkage disequilibrium mapping in thoroughbreds Teruaki Tozakia,*, Kei-ichi Hirotaa, Telhisa Hasegawac, Motowo Tomitab, Masahiko Kurosawaa a
Department of Molecular Genetics, Laboratory of Racing Chemistry, 1731-2 Tsurutamachi, Utsunomiya, Tochigi 320-0851, Japan b Department of Physiological Chemistry, School of Pharmaceutical Sciences, Showa University, Shinagawa, Tokyo, Japan c Equine Research Institute, Japan Racing Association, Utsunomiya, Tochigi, Japan Received 26 May 2004; received in revised form 9 September 2004; accepted 14 October 2004 Available online 22 January 2005 Received by T. Sekiya
Abstract Linkage disequilibrium (LD) mapping is often used in searches for genes governing economically significant traits and diseases. The DV coefficient is a commonly used measure of the extent of LD between all possible pairs of alleles at two markers. This study aimed to test the utility of the DVcoefficient for LD mapping of a trait in a thoroughbred population. Microsatellite genotype data and grey coat colour as a trait model in a thoroughbred population were used to assess the extent of LD. We demonstrated that LD mapping was a reasonable approach for initial genome-wide scans in a thoroughbred population. Significant LD was demonstrated at approximately 7 cM, implying that roughly 430 appropriately spaced microsatellites were needed for systematic whole-genome LD mapping in this model. LD mapping methods using DVin a thoroughbred population were useful for identifying the chromosomal regions for diseases and economic trait loci (ETL). It was suggested that a thoroughbred population represented a population particularly suitable for LD mapping. D 2004 Elsevier B.V. All rights reserved. Keywords: LD; Horse; Microsatellites; DVcoefficient
1. Introduction Thoroughbreds are a relatively recent horse breed derived from a small number of Arab stallions and native British mares about 300 years ago (Cunningham et al., 2001; Hill et al., 2002), which corresponds to 25–30 generations in Japan. The occurrence of genetic bottlenecks in thoroughbreds may have produced a founder effect because of severe breeding selection for some traits, such as speed. We sought to isolate genes governing economically significant traits and diseases in thoroughbreds. A traditional Abbreviations: cM, centi Morgan; ETL, economic trait loci; LD, linkage disequilibrium; LOD, logarithm of odd; P, probability; QTL, quantitative trait loci; SNPs, single nucleotide polymorphisms. * Corresponding author. Department of Molecular Genetics, Laboratory of Racing Chemistry, 1731-2 Tsurutamachi, Utsunomiya, Tochigi 3200851, Japan. Tel.: +81 28 647 4472; fax: +81 28 647 4473. E-mail addresses: [email protected], [email protected] (T. Tozaki). 0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2004.10.011
linkage study has often been used to detect candidate regions on horse chromosomes. However, a task for a traditional linkage study still remains; namely, preparing large phaseknown families that include over three generations. Collecting such families in an actual thoroughbred population would be difficult. Directed breeding programs for thoroughbreds are expensive and usually not acceptable to breeders. Although interbreed crosses may be the most informative, they are the least likely to gain breeders’ approval. Thus, mapping methods using existing pedigrees would seem to be the most feasible approach; thus, in a thoroughbred population, association studies using linkage disequilibrium (LD) might be one of the most desirable approaches. Recently, LD mapping has been used as a genome-scan method to isolate genes governing economically significant traits and diseases. LD mapping methods have two particular potential uses: (1) to finely map genes governing economic trait loci (ETL) and diseases already mapped on
128
T. Tozaki et al. / Gene 346 (2005) 127–132
chromosomes from traditional linkage study, and (2) to map novel genes governing ETL and diseases by a whole genome-scan. The use of LD for fine mapping has received a lot of attention and has seen a number of successful applications (Ahmed et al., 2003; Rahman et al., 2003; van Swieten et al., 2003). By contrast, initially using LD mapping to localize genes governing ETL and diseases has been limited to a few examples (Toda et al., 2003) because the extent of LD is sufficiently small in a large population such as humans, and many polymorphic markers are generally needed for a whole-genome LD scan. In recent years, there have been great advances in developing many single nucleotide polymorphisms (SNPs) on a human genome (Haga et al., 2002; Hirakawa et al., 2002). In addition, a considerable number of LD coefficients have been developed, although the majority are suitable only for biallelic markers such as SNPs. LD mapping using SNPs has became a powerful approach for detecting the many candidate regions and genes that underlie susceptibility to common diseases. A key question facing LD mapping is that of how many markers are needed to adequately cover the genome? An answer depends on the chromosomal extent of LD in the population studied. For example, it has been estimated that useful LD exists only over a distance of 3 kb in a normal human population (Kruglyak, 1999), and approximately 33.3 cM in one domestic dog breed (Hyun et al., 2003). The difference between these extents of LD depends on the population structures studied. Some phenotypes for coat colour such as grey (Henner et al., 2002; Locke et al., 2002; Swinburne et al., 2002) and LP (Terry et al., 2004) were analyzed by a traditional linkage analysis in horses because great advances in horse genome mapping have occurred in recent years. The first-generation linkage map was published in 2000 (Swinburne et al., 2000) with 31 different linkage groups using a full-sib family. Since then, another horse linkage map using half-sib families (Gue´rin et al., 2003), a radiation-hybrid map (Chowdhary et al., 2003) and further microsatellites for linkage and RH maps (Tozaki et al., 2000a,b,c, 2001) have been developed. In this study, we used grey coat colour as a model for assessing the utility of whole-genome LD mapping in a thoroughbred population. Recently, the Grey locus was mapped on ECA25 using a traditional linkage study (Henner et al., 2002; Locke et al., 2002; Swinburne et al., 2002) although a gene for the grey phenotype was not identified. Two methods were used to determine over what distance LD can be detected using each microsatellite marker with the grey phenotype. One of the methods was to simply compare marker allele frequencies between grey and non-grey groups in a thoroughbred population using an v 2 test of association. The other was used to calculate an estimate of LD, called DV, with an associated probability. We also evaluated the possibility of a whole-genome association study using the two methods in a thoroughbred population.
2. Materials and methods 2.1. Thoroughbreds Seven 2-generation paternal thoroughbred families (designated 1 through 7) and one 3-generation paternal thoroughbred family segregated for the grey phenotype were selected for mapping the Grey locus by a traditional (parametric) linkage analysis (Table 1). All offspring resulted from matings of grey stallions to non-grey mares. For LD analysis, 150 thoroughbreds having a grey coat colour and 150 thoroughbreds having non-grey coat colour were collected randomly. 2.2. Microsatellites Ten microsatellites, NVHEQ43, TKY292, AHT007, TKY316, UCDEQ405, TKY302, COR018, COR080, TKY575 and UCDEQ464 on ECA25, were used for evaluating LD between each microsatellite and as a trait in thoroughbreds (Table 2). 2.3. PCR reaction and genotyping Genomic DNAs were isolated from whole blood using a MagExtractor System MFX-2000 (Toyobo, Osaka, Japan) according to the manufacturer’s protocols. For genotyping, we prepared three primers; a sequence-specific forward primer conjugated with a 5V-TGA CCG GCA GCA AAA TTG-3V tail at its 5V end, a sequence-specific reverse primer, and FAM, VIC or NED labeled 5V-TGA CCG GCA GCA AAA TTG-3V primer (Applied Biosystems, Foster City, USA). The underlining represents the sequence (18 mer) for fluorescent detection. PCR was performed in a total volume of 20 AL of the following mixture: 20 ng of equine genomic DNA, 2 pmol of the sequence-specific forward primer conjugated with a 5V-TGA CCG GCA GCA AAA TTG-3V tail at its 5V end, 5 pmol of the sequence-specific reverse primer, and 10 pmol of each fluorescent labeled 5V-TGA CCG GCA GCA AAA TTG-3Vprimer, 200 AM of dNTPs, 2 AL of 10reaction buffer; and 0.1 U of AmpliTaq Gold (Applied Biosystems). PCR amplification entailed an initial denaturation (94 8C, 4 min); 15 cycles of 1 min each at 94,
Table 1 Number of grey (G) offspring and non-grey (NG) offspring for each sire family Sire family
G
NG
Total
1 2 3 4 5 6 7
9 25 11 18 16 11 7
3 31 14 21 12 12 10
12 56 25 39 28 23 17
T. Tozaki et al. / Gene 346 (2005) 127–132
129
Table 2 Microsatellites used in the study Markers
Forward primers
Reverse primers
NVHEQ43 TKY292 AHT007 TKY316 UCDEQ405 TKY302 COR018 COR080 TKY575 UCDEQ464
TGACACAAGATAAAAGCCCAGG CCTCAACATCCTTCTAGAGG CCTTAGATCCGAGAAGGAGA CACATTCTTCCGGTCACAAC ACCTCGTCTGGCTGTTGTAAG TACATGGTGAGAAATAAGCACC AGTCTGGCAATATTGAGGATGT CGTGCTGCCAGAGGTAAATA CAGACCTGAGTCCCAGAGGA ATGCTCTGAGAATAAGTCTGG
GATTGGGAAAAGAGCACAGCC AGTACACGTTGAACGTTACC GAAGCCTCACTCCATCCAGG TGTTTAGGGACACTAAACGC ACTTGCTGTGCGACTCTG ATCTGCATCCTAGCTCACTG AGCAGCTACCCTTTGAATACTG ACTGAGATGAGGTTTGCTGC CCATTCCAGGAAATGACCTT AAAAGGCGAGAATGGAAT
55 and 72 8C, and 25 cycles of 1 min each at 94, 50 and 72 8C, and then 10 min at 72 8C for a final extension in a GeneAmp PCR System 9600. Reaction products were analyzed using an ABI3100 automated sequencer (Applied Biosystems) according to the manufacturer’s instructions and using filter set G. Genotyping data were collected and initially analyzed using Genescan (Applied Biosystems). A Genotyper (Applied Biosystems) was then used, and the alleles were scored manually, with each allele being assigned an integer value as appropriate. 2.4. Linkage and LD analysis Two-point linkage analysis was performed with the linkage analysis software package, FASTLINK (Cottingham et al., 1993; Lathrop et al., 1984), for a parametric linkage analysis. The grey phenotype was defined as a fully penetrant autosomal-dominant trait, with an allele frequency of 3% (Willett, 1989). LD analysis was performed by two methods. First, a v 2 test of association was used to compare the frequency of the alleles between grey and non-grey coat colour groups. The probability of an association between a particular allele and the presence of grey was calculated. Following the convention in linkage analysis (Chotai, 1984), a P value b0.0001 was considered significant evidence for linkage. The second approach was to calculate the LD between each marker locus and the Grey locus using genotypes that assumed the following; the grey offspring were scored as heterozygotes, and the non-grey offspring and non-grey population scored as homozygotes. The dominance of grey, combined with the selection of matings to non-grey mares allowed us to infer genotypes for all animals in the study based on phenotypes. LD scores were evaluated with DV, which has a range from 0 (linkage equilibrium) to 1 (complete linkage disequilibrium), and was the measure of LD used in this study. LD was calculated using a computer program, 2LD, available from Jin Hua Zhao (http:// www.iop.kcl.ac.uk/IoP/Departments/PsychMed/GepiBSt/ software.stm). The 2LD program gave a standard deviation of the DVestimate as well as the probability of observing the calculated DV based on a v 2 analysis of the observed
haplotype frequencies compared with those expected under the hypothesis of linkage equilibrium (i.e., DV=0).
3. Results 3.1. Microsatellites The 10 microsatellites used in this study were well amplified and genotyped using multiplex PCR sets. All microsatellites were polymorphic in a thoroughbred population, and therefore informative for mapping the Grey locus in such a population. 3.2. Linkage analysis Parametric linkage analysis only detected the linkage between the marker loci and the Grey locus using the one three-generation family. The Grey locus was mapped at a position 5.0 cM from COR018 (logarithm of odd [LOD]=11.68), 6.0 cM from UCDEQ464 (LOD=8.67), 10.1 cM from TKY302 (LOD=7.09) and 17.7 cM from UCDEQ405 (LOD=2.34). Thus, these individual data allowed us to estimate that the Grey locus was bracketed by COR018 and UCDEQ464 based on a horse linkage map (Swinburne et al., 2000), and that the Grey locus was mapped on the same region of ECA25 as previously mapped data (Henner et al., 2002; Locke et al., 2002; Swinburne et al., 2002). However, a linkage between the marker loci and the Grey locus was not detected at over 3.0 (LOD) when using only the seven 2-generation paternal families; which remains an unknown phase. 3.3. LD analyses Association v 2 probabilities for each marker are shown in Fig. 1. Significant allelic associations were detected for markers COR018 ( log 1 0 ( P )=4.5) and COR080 ( log10( P)=17.0). In particular, COR080 showed the most significant value for the grey. It was suggested that COR080 was the closest marker of those studied. DVvalues calculated using the genotypes between each marker and the Grey locus, which was assumed as shown in the Materials and Methods,
130
T. Tozaki et al. / Gene 346 (2005) 127–132
Fig. 3. DVestimates between each microsatellite as background LD. Fig. 1. Case-control study based on association v 2 probability (as log10( P)) against map positions of microsatellite markers.
ranged from 0.080 (TKY316) to 0.999 (UCDEQ464). Five markers, TKY302, COR018, COR080, TKY575 and UCDEQ464, showed significant DV scores (Fig. 2). 3.4. Background LD Background LD was estimated for 45 synthenic marker pairs using markers in this study. Fig. 3 shows the relationship between marker distance and DV. Six marker pairs linked at b7 cM, showed approximately N0.6 of DV,
Fig. 2. DV estimates between each microsatellite marker and a grey coat color; and associated probability (as log10( P)) based on haplotype frequencies on equine chromosome 25.
while all marker pairs separated by 7–45 cM showed a lower DV, approximately b0.3, except for one marker pair.
4. Discussion In this study, we used three methods for mapping the Grey locus on an equine chromosome. First, we evaluated the candidate region of the Grey locus using a parametric linkage analysis. Results showed that the Grey locus was on ECA25; confirming that a parametric linkage study was an excellent method for identifying a Mendelian inheritance in this case. We detected the candidate region with a high LOD score although the region had a long distance of approximately 10–18 cM when just the three-generation family was used for a parametric linkage analysis. However, the use of this method had the condition that it was restricted to using only phase-known families for obtaining a high LOD score. Thus, no important linkage was revealed when using just the two-generation families in this study. Although one 3-generation family was prepared in this study, preparing families in a thoroughbred population is generally difficult, suggesting that this method might not be feasible for a thoroughbred population. Next, the LD between each marker and the Grey locus was estimated using the DV coefficient and the v 2 test. The results presented here predict that the extent of useful levels of LD in a thoroughbred population are approximately 7 cM in the trait model, when the DV coefficient was used for LD mapping. The presence of long-range LD in a thoroughbred population suggests that genome-wide LD mapping is likely to be possible with existing microsatellite marker resources. The v 2 association test between grey and non-grey populations also showed important LD between markers and the trait, although short-range LD compared to the DV coefficient was found. These methods demonstrated that fine mapping could be used to identify the specific
T. Tozaki et al. / Gene 346 (2005) 127–132
chromosomal region responsible for a trait in a thoroughbred population. Inferring a general level of LD across the genome might be difficult because LD is not uniform across the genome (Service et al., 2001). Thus, although we cannot simply infer a general level of LD across the horse genome, the prediction that the useful extent of LD is about 7 cM implies that roughly 430 appropriately spaced microsatellites will be needed for systematic whole-genome LD studies in thoroughbreds spanning approximately 30 M (Swinburne et al., 2000). This is an encouraging result from the point of view of the potential utility of LD in a wholegenome scan, because approximately 400 microsatellites are presently available on horse genetic maps. In addition, the mapping of at least 1000 microsatellites with the next few years has been proposed. Generally, the extent of LD is different among breeds and the populations studied, and LD mapping is likely to be restricted to special populations. The best candidate populations for detecting association with common variants are isolates with a small effective number of unrelated founders that experience slow growth during the early generations following the initial bottleneck (de la Chapelle and Wright, 1998; Gordon et al., 2000). It was confirmed that a thoroughbred population was suitable for LD mapping using DV as an estimator in the study. Historical information and the results of several genetic investigations indicate that thoroughbreds constitute a genetic isolate (Cunningham et al., 2001; Hill et al., 2002). Thoroughbreds derived from the three stallions and British mares are only 25–30 generations old, indicating that recombination has had less time to whittle down the extent of LD around risk-conferring variants. Thus, LD mapping is frequently discussed as being carried out with fewer markers in recently established genetic isolates, such as a thoroughbred population. Determining the threshold of DV for tracing genes governing ETL and diseases is often difficult, although v 2 probability was calculated between estimated and observed haplotype frequencies in this study. Thus, measuring background LD in the populations studied is crucial. Investigation of background LD may assess the suitability of a specific population to localize genes governing ETL and diseases by LD mapping. In this study, DV scores among all marker pairs were calculated for the background LD. High scores (approximately N0.6) of DV existed at distances of b7 cM, and low scores of DV (approximately b0.3) existed at distances of N10 cM. It is expected that DV declines as a function of the distance between markers. These lower values (approximately b0.3) were similar to DV between non-synthenic marker pairs on other chromosomes (data not shown). It was expected that background LD would be b0.3 in the population utilized, suggesting that DV N0.6 was important for LD in this case. Many studies have also shown that background LD is not distributed uniformly across the genome, and that few
131
differences exist among populations. Thus, in thoroughbreds, it is important to characterize background LD across the genome. In this study, DVbetween UCDEQ464 and the Grey locus showed a high score (0.999), although the candidate region might be in the area of COR080. The high score could be caused by rare alleles of UCDEQ464, because a high DV score is generally attributable to the presence of rare alleles. The phenomenon has been also observed in non-synthenic marker pairs with low variability (McRae et al., 2002). McRae et al. have also discussed that the relationship between non-synthenic marker pairs with low variability and a high DV score is attributable to rare alleles rather than to the presence of quantitative trait loci (QTL). Recently, many candidate genes for diseases in humans have been isolated using an extensive human genome map based on a number of polymorphic markers, such as SNPs and microsatellites, while candidate genes for physical performances have not been well studied. Horses, and in particular thoroughbreds, are used worldwide for racing, and data are recorded for breeding of better racehorses. It is possible that a thoroughbred population could become a model for identifying candidate genes governing physical performances. Thus, a thoroughbred population has been successfully exploited in the mapping and cloning of many genes for physical performances. In conclusion, we have demonstrated that LD mapping methods using a DVcoefficient are useful for mapping genes governing ETL and diseases in a thoroughbred population, and have indicated that a thoroughbred population represents one of those special populations deemed particularly suitable for LD mapping. By using further density microsatellites, this population may also be suitable for mapping genes underlying complex traits because strong LD is expected around the loci of diseases.
Acknowledgments We would like to thank the Japan Racing Association, which provided samples from horses for this study, and supported it by a grant-in-aid (2001–2004).
References Ahmed, Z.M., Morell, R.J., Riazuddin, S., Gropman, A., Shaukat, S., Ahmad, M.M., Mohiddin, S.A., Fananapazir, L., Caruso, R.C., Husnain, T., Khan, S.N., Riazuddin, S., Griffith, A.J., Friedman, T.B., Wilcox, E.R., 2003. Mutations of MYO6 are associated with recessive deafness DFNB37. Am. J. Hum. Genet. 72, 1315 – 1322. Chotai, J., 1984. On the lod score method in linkage analysis. Ann. Hum. Genet. 48, 359 – 378. Chowdhary, B.P., et al., 2003. The first-generation whole-genome radiation hybrid map in the horse identifies conserved segments in human and mouse genomes. Genome Res. 13, 742 – 751. Cottingham Jr., R.W., Idury, R.M., Sch7ffer, A.A., 1993. Faster sequential genetic linkage computations. Am. J. Hum. Genet. 53, 252 – 263.
132
T. Tozaki et al. / Gene 346 (2005) 127–132
Cunningham, E.P., Dooley, J.J., Splan, R.K., Bradley, D.G., 2001. Microsatellite diversity, pedigree relatedness and the contributions of founder lineages to thoroughbred horses. Anim. Genet. 32, 360 – 364. de la Chapelle, A., Wright, F.A., 1998. Linkage disequilibrium mapping in isolated populations: the example of Finland revisited. Proc. Natl. Acad. Sci. U. S. A. 95, 12416 – 12423. Gordon, D., Simonic, I., Ott, J., 2000. Significant evidence for linkage disequilibruim over a 5-cM region among Afrikaners. Genomics 66, 87 – 92. Gue´rin, G., et al., 2003. The second generation of the International Equine Gene Mapping Workshop half-sibling linkage map. Anim. Genet. 34, 161 – 168. Haga, H., Yamada, R., Ohnishi, Y., Nakamura, Y., Tanaka, T., 2002. Gene-based SNP discovery as part of the Japanese Millennium Genome Project: identification of 190,562 genetic variations in the human genome. Single-nucleotide polymorphism. J. Hum. Genet. 47, 605 – 610. Henner, J., Poncet, P.-A., Gue´rin, G., Hagger, C., Stranzinger, G., Rieder, S., 2002. Genetic mapping of the (G)-locus, responsible for the coat color phenotype bprogressive greying with ageQ in horses (Equus caballus). Mamm. Genome 13, 535 – 537. Hill, E.W., Bradley, D.G., Al-Barody, M., Ertugrul, O., Splan, R.K., Zakharov, I., Cunningham, E.P., 2002. History and integrity of thoroughbred dam lines revealed in equine mtDNA variation. Anim. Genet. 33, 287 – 294. Hirakawa, M., Tanaka, T., Hashimoto, Y., Kuroda, M., Takagi, T., Nakamura, Y., 2002. JSNP: a database of common gene variations in the Japanese population. Nucleic Acids Res. 30, 158 – 162. Hyun, C., Filippich, L.J., Lea, R.A., Shepherd, G., Hughes, I.P., Griffiths, L.R., 2003. Prospects for whole genome linkage disequilibrium mapping in domestic dog breeds. Mamm. Genome 14, 640 – 649. Kruglyak, L., 1999. Prospects for whole-genome linkage disequilibrium mapping of common disease genes. Nat. Genet. 22, 139 – 144. Lathrop, G.M., Lalouel, J.M., Julier, C., Ott, J., 1984. Strategies for multilocus linkage analysis in humans. Proc. Natl. Acad. Sci. U. S. A. 81, 3443 – 3446. Locke, M.M., Penedo, M.C.D., Bricker, S.J., Millon, L.V., Murray, J.D., 2002. Linkage of the grey coat colour locus to microsatellites on horse chromosome 25. Anim. Genet. 33, 329 – 337. McRae, A.F., McEwan, J.C., Dodds, K.G., Wilson, T., Crawford, A.M., Slate, J., 2002. Linkage disequilibrium in domestic sheep. Genetics 160, 1113 – 1122. Rahman, N., Dunstan, M., Teare, M.D., Hanks, S., Douglas, J., Coleman, K., Bottomly, W.E., Campbell, M.E., Berglund, B., Nordenskjold, M., Forssell, B., Burrows, N., Lunt, P., Young, I., Williams, N., Bignell,
G.R., Futreal, P.A., Pope, F.M., 2003. Ehlers–Danlos syndrome with severe early-onset periodontal disease (EDS-VIII) is a distinct, heterogeneous disorder with one predisposition gene at chromosome 12p13. Am. J. Hum. Genet. 73, 198 – 204. Service, S.K., Ophoff, R.A., Freimer, N.B., 2001. The genome-wide distribution of background linkage disequilibrium in a population isolate. Hum. Mol. Genet. 10, 545 – 551. Swinburne, J., Gerstenberg, C., Breen, M., Aldridge, V., Lockhart, L., Marti, E., Antczak, D., Eggleston-Stott, M., Bailey, E., Mickelson, J., Rbed, K., Lindgren, G., von Haeringen, W., Gue´rin, G., Bjarnason, J., Allen, T., Binns, M., 2000. First comprehensive low-density horse linkage map based on two 3-generation, full-sibling, cross-bred horse reference families. Genomics 66, 123 – 134. Swinburne, J.E., Hopkins, A., Binns, M.M., 2002. Assignment of the horse grey coat colour gene to ECA25 using whole genome scanning. Anim. Genet. 33, 338 – 342. Terry, R.B., Archer, S., Brooks, S., Bernoco, D., Bailey, E., 2004. Assignment of the appaloosa coat colour gene (LP) to equine chromosome 1. Anim. Genet. 35, 134 – 137. Toda, T., Momose, Y., Murata, M., Tamiya, G., Yamamoto, M., Hattori, N., Inoko, H., 2003. Toward identification of susceptibility genes for sporadic Parkinson’s disease. J. Neurol. 250 (Suppl. 3), III40 – III43. Tozaki, T., Inoue, S., Mashima, S., Ohta, M., Miura, N., Tomita, M., 2000a. Sequence analysis of trinucleotide repeat microsatellites from an enrichment library of the equine genome. Genome 43, 354 – 365. Tozaki, T., Kakoi, H., Mashima, S., Hirota, K., Hasegawa, T., Ishida, N., Miura, N., Tomita, M., 2000b. The isolation and characterization of 18 equine microsatellite loci TKY272–TKY289. Anim. Genet. 31, 149 – 150. Tozaki, T., Kakoi, H., Mashima, S., Hirota, K., Hasegawa, T., Ishida, N., Miura, N., Tomita, M., 2000c. The isolation and characterization of 34 equine microsatellite loci TKY290–TKY323. Anim. Genet. 31, 234 – 236. Tozaki, T., Mashima, S., Hirota, K., Miura, N., Choi-Miura, N., Tomita, M., 2001. Characterization of equine microsatellites and microsatellitelinked repetitive elements (eMLREs) by efficient cloning and genotyping methods. DNA Res. 8, 33 – 45. van Swieten, J.C., Brusse, E., de Graaf, B.M., Krieger, E., van de Graaf, R., de Koning, I., Maat-Kievit, A., Leegwater, P., Dooijes, D., Oostra, B.A., Heutink, P., 2003. A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia. Am. J. Hum. Genet. 72, 191 – 199. Willet, P. 1989. The classic racehorse. Stanley Paul, London, p. 24. Anim. Genet. 33, 338–342.
Prospects for whole genome linkage disequilibrium mapping in thoroughbreds Teruaki Tozakia,*, Kei-ichi Hirotaa, Telhisa Hasegawac, Motowo Tomitab, Masahiko Kurosawaa a
Department of Molecular Genetics, Laboratory of Racing Chemistry, 1731-2 Tsurutamachi, Utsunomiya, Tochigi 320-0851, Japan b Department of Physiological Chemistry, School of Pharmaceutical Sciences, Showa University, Shinagawa, Tokyo, Japan c Equine Research Institute, Japan Racing Association, Utsunomiya, Tochigi, Japan Received 26 May 2004; received in revised form 9 September 2004; accepted 14 October 2004 Available online 22 January 2005 Received by T. Sekiya
Abstract Linkage disequilibrium (LD) mapping is often used in searches for genes governing economically significant traits and diseases. The DV coefficient is a commonly used measure of the extent of LD between all possible pairs of alleles at two markers. This study aimed to test the utility of the DVcoefficient for LD mapping of a trait in a thoroughbred population. Microsatellite genotype data and grey coat colour as a trait model in a thoroughbred population were used to assess the extent of LD. We demonstrated that LD mapping was a reasonable approach for initial genome-wide scans in a thoroughbred population. Significant LD was demonstrated at approximately 7 cM, implying that roughly 430 appropriately spaced microsatellites were needed for systematic whole-genome LD mapping in this model. LD mapping methods using DVin a thoroughbred population were useful for identifying the chromosomal regions for diseases and economic trait loci (ETL). It was suggested that a thoroughbred population represented a population particularly suitable for LD mapping. D 2004 Elsevier B.V. All rights reserved. Keywords: LD; Horse; Microsatellites; DVcoefficient
1. Introduction Thoroughbreds are a relatively recent horse breed derived from a small number of Arab stallions and native British mares about 300 years ago (Cunningham et al., 2001; Hill et al., 2002), which corresponds to 25–30 generations in Japan. The occurrence of genetic bottlenecks in thoroughbreds may have produced a founder effect because of severe breeding selection for some traits, such as speed. We sought to isolate genes governing economically significant traits and diseases in thoroughbreds. A traditional Abbreviations: cM, centi Morgan; ETL, economic trait loci; LD, linkage disequilibrium; LOD, logarithm of odd; P, probability; QTL, quantitative trait loci; SNPs, single nucleotide polymorphisms. * Corresponding author. Department of Molecular Genetics, Laboratory of Racing Chemistry, 1731-2 Tsurutamachi, Utsunomiya, Tochigi 3200851, Japan. Tel.: +81 28 647 4472; fax: +81 28 647 4473. E-mail addresses: [email protected], [email protected] (T. Tozaki). 0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2004.10.011
linkage study has often been used to detect candidate regions on horse chromosomes. However, a task for a traditional linkage study still remains; namely, preparing large phaseknown families that include over three generations. Collecting such families in an actual thoroughbred population would be difficult. Directed breeding programs for thoroughbreds are expensive and usually not acceptable to breeders. Although interbreed crosses may be the most informative, they are the least likely to gain breeders’ approval. Thus, mapping methods using existing pedigrees would seem to be the most feasible approach; thus, in a thoroughbred population, association studies using linkage disequilibrium (LD) might be one of the most desirable approaches. Recently, LD mapping has been used as a genome-scan method to isolate genes governing economically significant traits and diseases. LD mapping methods have two particular potential uses: (1) to finely map genes governing economic trait loci (ETL) and diseases already mapped on
128
T. Tozaki et al. / Gene 346 (2005) 127–132
chromosomes from traditional linkage study, and (2) to map novel genes governing ETL and diseases by a whole genome-scan. The use of LD for fine mapping has received a lot of attention and has seen a number of successful applications (Ahmed et al., 2003; Rahman et al., 2003; van Swieten et al., 2003). By contrast, initially using LD mapping to localize genes governing ETL and diseases has been limited to a few examples (Toda et al., 2003) because the extent of LD is sufficiently small in a large population such as humans, and many polymorphic markers are generally needed for a whole-genome LD scan. In recent years, there have been great advances in developing many single nucleotide polymorphisms (SNPs) on a human genome (Haga et al., 2002; Hirakawa et al., 2002). In addition, a considerable number of LD coefficients have been developed, although the majority are suitable only for biallelic markers such as SNPs. LD mapping using SNPs has became a powerful approach for detecting the many candidate regions and genes that underlie susceptibility to common diseases. A key question facing LD mapping is that of how many markers are needed to adequately cover the genome? An answer depends on the chromosomal extent of LD in the population studied. For example, it has been estimated that useful LD exists only over a distance of 3 kb in a normal human population (Kruglyak, 1999), and approximately 33.3 cM in one domestic dog breed (Hyun et al., 2003). The difference between these extents of LD depends on the population structures studied. Some phenotypes for coat colour such as grey (Henner et al., 2002; Locke et al., 2002; Swinburne et al., 2002) and LP (Terry et al., 2004) were analyzed by a traditional linkage analysis in horses because great advances in horse genome mapping have occurred in recent years. The first-generation linkage map was published in 2000 (Swinburne et al., 2000) with 31 different linkage groups using a full-sib family. Since then, another horse linkage map using half-sib families (Gue´rin et al., 2003), a radiation-hybrid map (Chowdhary et al., 2003) and further microsatellites for linkage and RH maps (Tozaki et al., 2000a,b,c, 2001) have been developed. In this study, we used grey coat colour as a model for assessing the utility of whole-genome LD mapping in a thoroughbred population. Recently, the Grey locus was mapped on ECA25 using a traditional linkage study (Henner et al., 2002; Locke et al., 2002; Swinburne et al., 2002) although a gene for the grey phenotype was not identified. Two methods were used to determine over what distance LD can be detected using each microsatellite marker with the grey phenotype. One of the methods was to simply compare marker allele frequencies between grey and non-grey groups in a thoroughbred population using an v 2 test of association. The other was used to calculate an estimate of LD, called DV, with an associated probability. We also evaluated the possibility of a whole-genome association study using the two methods in a thoroughbred population.
2. Materials and methods 2.1. Thoroughbreds Seven 2-generation paternal thoroughbred families (designated 1 through 7) and one 3-generation paternal thoroughbred family segregated for the grey phenotype were selected for mapping the Grey locus by a traditional (parametric) linkage analysis (Table 1). All offspring resulted from matings of grey stallions to non-grey mares. For LD analysis, 150 thoroughbreds having a grey coat colour and 150 thoroughbreds having non-grey coat colour were collected randomly. 2.2. Microsatellites Ten microsatellites, NVHEQ43, TKY292, AHT007, TKY316, UCDEQ405, TKY302, COR018, COR080, TKY575 and UCDEQ464 on ECA25, were used for evaluating LD between each microsatellite and as a trait in thoroughbreds (Table 2). 2.3. PCR reaction and genotyping Genomic DNAs were isolated from whole blood using a MagExtractor System MFX-2000 (Toyobo, Osaka, Japan) according to the manufacturer’s protocols. For genotyping, we prepared three primers; a sequence-specific forward primer conjugated with a 5V-TGA CCG GCA GCA AAA TTG-3V tail at its 5V end, a sequence-specific reverse primer, and FAM, VIC or NED labeled 5V-TGA CCG GCA GCA AAA TTG-3V primer (Applied Biosystems, Foster City, USA). The underlining represents the sequence (18 mer) for fluorescent detection. PCR was performed in a total volume of 20 AL of the following mixture: 20 ng of equine genomic DNA, 2 pmol of the sequence-specific forward primer conjugated with a 5V-TGA CCG GCA GCA AAA TTG-3V tail at its 5V end, 5 pmol of the sequence-specific reverse primer, and 10 pmol of each fluorescent labeled 5V-TGA CCG GCA GCA AAA TTG-3Vprimer, 200 AM of dNTPs, 2 AL of 10reaction buffer; and 0.1 U of AmpliTaq Gold (Applied Biosystems). PCR amplification entailed an initial denaturation (94 8C, 4 min); 15 cycles of 1 min each at 94,
Table 1 Number of grey (G) offspring and non-grey (NG) offspring for each sire family Sire family
G
NG
Total
1 2 3 4 5 6 7
9 25 11 18 16 11 7
3 31 14 21 12 12 10
12 56 25 39 28 23 17
T. Tozaki et al. / Gene 346 (2005) 127–132
129
Table 2 Microsatellites used in the study Markers
Forward primers
Reverse primers
NVHEQ43 TKY292 AHT007 TKY316 UCDEQ405 TKY302 COR018 COR080 TKY575 UCDEQ464
TGACACAAGATAAAAGCCCAGG CCTCAACATCCTTCTAGAGG CCTTAGATCCGAGAAGGAGA CACATTCTTCCGGTCACAAC ACCTCGTCTGGCTGTTGTAAG TACATGGTGAGAAATAAGCACC AGTCTGGCAATATTGAGGATGT CGTGCTGCCAGAGGTAAATA CAGACCTGAGTCCCAGAGGA ATGCTCTGAGAATAAGTCTGG
GATTGGGAAAAGAGCACAGCC AGTACACGTTGAACGTTACC GAAGCCTCACTCCATCCAGG TGTTTAGGGACACTAAACGC ACTTGCTGTGCGACTCTG ATCTGCATCCTAGCTCACTG AGCAGCTACCCTTTGAATACTG ACTGAGATGAGGTTTGCTGC CCATTCCAGGAAATGACCTT AAAAGGCGAGAATGGAAT
55 and 72 8C, and 25 cycles of 1 min each at 94, 50 and 72 8C, and then 10 min at 72 8C for a final extension in a GeneAmp PCR System 9600. Reaction products were analyzed using an ABI3100 automated sequencer (Applied Biosystems) according to the manufacturer’s instructions and using filter set G. Genotyping data were collected and initially analyzed using Genescan (Applied Biosystems). A Genotyper (Applied Biosystems) was then used, and the alleles were scored manually, with each allele being assigned an integer value as appropriate. 2.4. Linkage and LD analysis Two-point linkage analysis was performed with the linkage analysis software package, FASTLINK (Cottingham et al., 1993; Lathrop et al., 1984), for a parametric linkage analysis. The grey phenotype was defined as a fully penetrant autosomal-dominant trait, with an allele frequency of 3% (Willett, 1989). LD analysis was performed by two methods. First, a v 2 test of association was used to compare the frequency of the alleles between grey and non-grey coat colour groups. The probability of an association between a particular allele and the presence of grey was calculated. Following the convention in linkage analysis (Chotai, 1984), a P value b0.0001 was considered significant evidence for linkage. The second approach was to calculate the LD between each marker locus and the Grey locus using genotypes that assumed the following; the grey offspring were scored as heterozygotes, and the non-grey offspring and non-grey population scored as homozygotes. The dominance of grey, combined with the selection of matings to non-grey mares allowed us to infer genotypes for all animals in the study based on phenotypes. LD scores were evaluated with DV, which has a range from 0 (linkage equilibrium) to 1 (complete linkage disequilibrium), and was the measure of LD used in this study. LD was calculated using a computer program, 2LD, available from Jin Hua Zhao (http:// www.iop.kcl.ac.uk/IoP/Departments/PsychMed/GepiBSt/ software.stm). The 2LD program gave a standard deviation of the DVestimate as well as the probability of observing the calculated DV based on a v 2 analysis of the observed
haplotype frequencies compared with those expected under the hypothesis of linkage equilibrium (i.e., DV=0).
3. Results 3.1. Microsatellites The 10 microsatellites used in this study were well amplified and genotyped using multiplex PCR sets. All microsatellites were polymorphic in a thoroughbred population, and therefore informative for mapping the Grey locus in such a population. 3.2. Linkage analysis Parametric linkage analysis only detected the linkage between the marker loci and the Grey locus using the one three-generation family. The Grey locus was mapped at a position 5.0 cM from COR018 (logarithm of odd [LOD]=11.68), 6.0 cM from UCDEQ464 (LOD=8.67), 10.1 cM from TKY302 (LOD=7.09) and 17.7 cM from UCDEQ405 (LOD=2.34). Thus, these individual data allowed us to estimate that the Grey locus was bracketed by COR018 and UCDEQ464 based on a horse linkage map (Swinburne et al., 2000), and that the Grey locus was mapped on the same region of ECA25 as previously mapped data (Henner et al., 2002; Locke et al., 2002; Swinburne et al., 2002). However, a linkage between the marker loci and the Grey locus was not detected at over 3.0 (LOD) when using only the seven 2-generation paternal families; which remains an unknown phase. 3.3. LD analyses Association v 2 probabilities for each marker are shown in Fig. 1. Significant allelic associations were detected for markers COR018 ( log 1 0 ( P )=4.5) and COR080 ( log10( P)=17.0). In particular, COR080 showed the most significant value for the grey. It was suggested that COR080 was the closest marker of those studied. DVvalues calculated using the genotypes between each marker and the Grey locus, which was assumed as shown in the Materials and Methods,
130
T. Tozaki et al. / Gene 346 (2005) 127–132
Fig. 3. DVestimates between each microsatellite as background LD. Fig. 1. Case-control study based on association v 2 probability (as log10( P)) against map positions of microsatellite markers.
ranged from 0.080 (TKY316) to 0.999 (UCDEQ464). Five markers, TKY302, COR018, COR080, TKY575 and UCDEQ464, showed significant DV scores (Fig. 2). 3.4. Background LD Background LD was estimated for 45 synthenic marker pairs using markers in this study. Fig. 3 shows the relationship between marker distance and DV. Six marker pairs linked at b7 cM, showed approximately N0.6 of DV,
Fig. 2. DV estimates between each microsatellite marker and a grey coat color; and associated probability (as log10( P)) based on haplotype frequencies on equine chromosome 25.
while all marker pairs separated by 7–45 cM showed a lower DV, approximately b0.3, except for one marker pair.
4. Discussion In this study, we used three methods for mapping the Grey locus on an equine chromosome. First, we evaluated the candidate region of the Grey locus using a parametric linkage analysis. Results showed that the Grey locus was on ECA25; confirming that a parametric linkage study was an excellent method for identifying a Mendelian inheritance in this case. We detected the candidate region with a high LOD score although the region had a long distance of approximately 10–18 cM when just the three-generation family was used for a parametric linkage analysis. However, the use of this method had the condition that it was restricted to using only phase-known families for obtaining a high LOD score. Thus, no important linkage was revealed when using just the two-generation families in this study. Although one 3-generation family was prepared in this study, preparing families in a thoroughbred population is generally difficult, suggesting that this method might not be feasible for a thoroughbred population. Next, the LD between each marker and the Grey locus was estimated using the DV coefficient and the v 2 test. The results presented here predict that the extent of useful levels of LD in a thoroughbred population are approximately 7 cM in the trait model, when the DV coefficient was used for LD mapping. The presence of long-range LD in a thoroughbred population suggests that genome-wide LD mapping is likely to be possible with existing microsatellite marker resources. The v 2 association test between grey and non-grey populations also showed important LD between markers and the trait, although short-range LD compared to the DV coefficient was found. These methods demonstrated that fine mapping could be used to identify the specific
T. Tozaki et al. / Gene 346 (2005) 127–132
chromosomal region responsible for a trait in a thoroughbred population. Inferring a general level of LD across the genome might be difficult because LD is not uniform across the genome (Service et al., 2001). Thus, although we cannot simply infer a general level of LD across the horse genome, the prediction that the useful extent of LD is about 7 cM implies that roughly 430 appropriately spaced microsatellites will be needed for systematic whole-genome LD studies in thoroughbreds spanning approximately 30 M (Swinburne et al., 2000). This is an encouraging result from the point of view of the potential utility of LD in a wholegenome scan, because approximately 400 microsatellites are presently available on horse genetic maps. In addition, the mapping of at least 1000 microsatellites with the next few years has been proposed. Generally, the extent of LD is different among breeds and the populations studied, and LD mapping is likely to be restricted to special populations. The best candidate populations for detecting association with common variants are isolates with a small effective number of unrelated founders that experience slow growth during the early generations following the initial bottleneck (de la Chapelle and Wright, 1998; Gordon et al., 2000). It was confirmed that a thoroughbred population was suitable for LD mapping using DV as an estimator in the study. Historical information and the results of several genetic investigations indicate that thoroughbreds constitute a genetic isolate (Cunningham et al., 2001; Hill et al., 2002). Thoroughbreds derived from the three stallions and British mares are only 25–30 generations old, indicating that recombination has had less time to whittle down the extent of LD around risk-conferring variants. Thus, LD mapping is frequently discussed as being carried out with fewer markers in recently established genetic isolates, such as a thoroughbred population. Determining the threshold of DV for tracing genes governing ETL and diseases is often difficult, although v 2 probability was calculated between estimated and observed haplotype frequencies in this study. Thus, measuring background LD in the populations studied is crucial. Investigation of background LD may assess the suitability of a specific population to localize genes governing ETL and diseases by LD mapping. In this study, DV scores among all marker pairs were calculated for the background LD. High scores (approximately N0.6) of DV existed at distances of b7 cM, and low scores of DV (approximately b0.3) existed at distances of N10 cM. It is expected that DV declines as a function of the distance between markers. These lower values (approximately b0.3) were similar to DV between non-synthenic marker pairs on other chromosomes (data not shown). It was expected that background LD would be b0.3 in the population utilized, suggesting that DV N0.6 was important for LD in this case. Many studies have also shown that background LD is not distributed uniformly across the genome, and that few
131
differences exist among populations. Thus, in thoroughbreds, it is important to characterize background LD across the genome. In this study, DVbetween UCDEQ464 and the Grey locus showed a high score (0.999), although the candidate region might be in the area of COR080. The high score could be caused by rare alleles of UCDEQ464, because a high DV score is generally attributable to the presence of rare alleles. The phenomenon has been also observed in non-synthenic marker pairs with low variability (McRae et al., 2002). McRae et al. have also discussed that the relationship between non-synthenic marker pairs with low variability and a high DV score is attributable to rare alleles rather than to the presence of quantitative trait loci (QTL). Recently, many candidate genes for diseases in humans have been isolated using an extensive human genome map based on a number of polymorphic markers, such as SNPs and microsatellites, while candidate genes for physical performances have not been well studied. Horses, and in particular thoroughbreds, are used worldwide for racing, and data are recorded for breeding of better racehorses. It is possible that a thoroughbred population could become a model for identifying candidate genes governing physical performances. Thus, a thoroughbred population has been successfully exploited in the mapping and cloning of many genes for physical performances. In conclusion, we have demonstrated that LD mapping methods using a DVcoefficient are useful for mapping genes governing ETL and diseases in a thoroughbred population, and have indicated that a thoroughbred population represents one of those special populations deemed particularly suitable for LD mapping. By using further density microsatellites, this population may also be suitable for mapping genes underlying complex traits because strong LD is expected around the loci of diseases.
Acknowledgments We would like to thank the Japan Racing Association, which provided samples from horses for this study, and supported it by a grant-in-aid (2001–2004).
References Ahmed, Z.M., Morell, R.J., Riazuddin, S., Gropman, A., Shaukat, S., Ahmad, M.M., Mohiddin, S.A., Fananapazir, L., Caruso, R.C., Husnain, T., Khan, S.N., Riazuddin, S., Griffith, A.J., Friedman, T.B., Wilcox, E.R., 2003. Mutations of MYO6 are associated with recessive deafness DFNB37. Am. J. Hum. Genet. 72, 1315 – 1322. Chotai, J., 1984. On the lod score method in linkage analysis. Ann. Hum. Genet. 48, 359 – 378. Chowdhary, B.P., et al., 2003. The first-generation whole-genome radiation hybrid map in the horse identifies conserved segments in human and mouse genomes. Genome Res. 13, 742 – 751. Cottingham Jr., R.W., Idury, R.M., Sch7ffer, A.A., 1993. Faster sequential genetic linkage computations. Am. J. Hum. Genet. 53, 252 – 263.
132
T. Tozaki et al. / Gene 346 (2005) 127–132
Cunningham, E.P., Dooley, J.J., Splan, R.K., Bradley, D.G., 2001. Microsatellite diversity, pedigree relatedness and the contributions of founder lineages to thoroughbred horses. Anim. Genet. 32, 360 – 364. de la Chapelle, A., Wright, F.A., 1998. Linkage disequilibrium mapping in isolated populations: the example of Finland revisited. Proc. Natl. Acad. Sci. U. S. A. 95, 12416 – 12423. Gordon, D., Simonic, I., Ott, J., 2000. Significant evidence for linkage disequilibruim over a 5-cM region among Afrikaners. Genomics 66, 87 – 92. Gue´rin, G., et al., 2003. The second generation of the International Equine Gene Mapping Workshop half-sibling linkage map. Anim. Genet. 34, 161 – 168. Haga, H., Yamada, R., Ohnishi, Y., Nakamura, Y., Tanaka, T., 2002. Gene-based SNP discovery as part of the Japanese Millennium Genome Project: identification of 190,562 genetic variations in the human genome. Single-nucleotide polymorphism. J. Hum. Genet. 47, 605 – 610. Henner, J., Poncet, P.-A., Gue´rin, G., Hagger, C., Stranzinger, G., Rieder, S., 2002. Genetic mapping of the (G)-locus, responsible for the coat color phenotype bprogressive greying with ageQ in horses (Equus caballus). Mamm. Genome 13, 535 – 537. Hill, E.W., Bradley, D.G., Al-Barody, M., Ertugrul, O., Splan, R.K., Zakharov, I., Cunningham, E.P., 2002. History and integrity of thoroughbred dam lines revealed in equine mtDNA variation. Anim. Genet. 33, 287 – 294. Hirakawa, M., Tanaka, T., Hashimoto, Y., Kuroda, M., Takagi, T., Nakamura, Y., 2002. JSNP: a database of common gene variations in the Japanese population. Nucleic Acids Res. 30, 158 – 162. Hyun, C., Filippich, L.J., Lea, R.A., Shepherd, G., Hughes, I.P., Griffiths, L.R., 2003. Prospects for whole genome linkage disequilibrium mapping in domestic dog breeds. Mamm. Genome 14, 640 – 649. Kruglyak, L., 1999. Prospects for whole-genome linkage disequilibrium mapping of common disease genes. Nat. Genet. 22, 139 – 144. Lathrop, G.M., Lalouel, J.M., Julier, C., Ott, J., 1984. Strategies for multilocus linkage analysis in humans. Proc. Natl. Acad. Sci. U. S. A. 81, 3443 – 3446. Locke, M.M., Penedo, M.C.D., Bricker, S.J., Millon, L.V., Murray, J.D., 2002. Linkage of the grey coat colour locus to microsatellites on horse chromosome 25. Anim. Genet. 33, 329 – 337. McRae, A.F., McEwan, J.C., Dodds, K.G., Wilson, T., Crawford, A.M., Slate, J., 2002. Linkage disequilibrium in domestic sheep. Genetics 160, 1113 – 1122. Rahman, N., Dunstan, M., Teare, M.D., Hanks, S., Douglas, J., Coleman, K., Bottomly, W.E., Campbell, M.E., Berglund, B., Nordenskjold, M., Forssell, B., Burrows, N., Lunt, P., Young, I., Williams, N., Bignell,
G.R., Futreal, P.A., Pope, F.M., 2003. Ehlers–Danlos syndrome with severe early-onset periodontal disease (EDS-VIII) is a distinct, heterogeneous disorder with one predisposition gene at chromosome 12p13. Am. J. Hum. Genet. 73, 198 – 204. Service, S.K., Ophoff, R.A., Freimer, N.B., 2001. The genome-wide distribution of background linkage disequilibrium in a population isolate. Hum. Mol. Genet. 10, 545 – 551. Swinburne, J., Gerstenberg, C., Breen, M., Aldridge, V., Lockhart, L., Marti, E., Antczak, D., Eggleston-Stott, M., Bailey, E., Mickelson, J., Rbed, K., Lindgren, G., von Haeringen, W., Gue´rin, G., Bjarnason, J., Allen, T., Binns, M., 2000. First comprehensive low-density horse linkage map based on two 3-generation, full-sibling, cross-bred horse reference families. Genomics 66, 123 – 134. Swinburne, J.E., Hopkins, A., Binns, M.M., 2002. Assignment of the horse grey coat colour gene to ECA25 using whole genome scanning. Anim. Genet. 33, 338 – 342. Terry, R.B., Archer, S., Brooks, S., Bernoco, D., Bailey, E., 2004. Assignment of the appaloosa coat colour gene (LP) to equine chromosome 1. Anim. Genet. 35, 134 – 137. Toda, T., Momose, Y., Murata, M., Tamiya, G., Yamamoto, M., Hattori, N., Inoko, H., 2003. Toward identification of susceptibility genes for sporadic Parkinson’s disease. J. Neurol. 250 (Suppl. 3), III40 – III43. Tozaki, T., Inoue, S., Mashima, S., Ohta, M., Miura, N., Tomita, M., 2000a. Sequence analysis of trinucleotide repeat microsatellites from an enrichment library of the equine genome. Genome 43, 354 – 365. Tozaki, T., Kakoi, H., Mashima, S., Hirota, K., Hasegawa, T., Ishida, N., Miura, N., Tomita, M., 2000b. The isolation and characterization of 18 equine microsatellite loci TKY272–TKY289. Anim. Genet. 31, 149 – 150. Tozaki, T., Kakoi, H., Mashima, S., Hirota, K., Hasegawa, T., Ishida, N., Miura, N., Tomita, M., 2000c. The isolation and characterization of 34 equine microsatellite loci TKY290–TKY323. Anim. Genet. 31, 234 – 236. Tozaki, T., Mashima, S., Hirota, K., Miura, N., Choi-Miura, N., Tomita, M., 2001. Characterization of equine microsatellites and microsatellitelinked repetitive elements (eMLREs) by efficient cloning and genotyping methods. DNA Res. 8, 33 – 45. van Swieten, J.C., Brusse, E., de Graaf, B.M., Krieger, E., van de Graaf, R., de Koning, I., Maat-Kievit, A., Leegwater, P., Dooijes, D., Oostra, B.A., Heutink, P., 2003. A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia. Am. J. Hum. Genet. 72, 191 – 199. Willet, P. 1989. The classic racehorse. Stanley Paul, London, p. 24. Anim. Genet. 33, 338–342.