Protein N-glycosylation in the early stage of Spiroplasma eriocheiris infect Eriocheir sinensis

Journal Pre-proof Protein N-glycosylation in the early stage of Spiroplasma eriocheiris infect Eriocheir sinensis

Libo Hou, Yuye Yan, Tao Xiang, Yubo Ma, Wei Gu, Wen Wang, Qingguo Meng PII:

S0044-8486(19)31995-7

DOI:

https://doi.org/10.1016/j.aquaculture.2019.734793

Reference:

AQUA 734793

To appear in:

aquaculture

Received date:

3 August 2019

Revised date:

31 October 2019

Accepted date:

28 November 2019

Please cite this article as: L. Hou, Y. Yan, T. Xiang, et al., Protein N-glycosylation in the early stage of Spiroplasma eriocheiris infect Eriocheir sinensis, aquaculture (2019), https://doi.org/10.1016/j.aquaculture.2019.734793

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Protein N-glycosylation in the early stage of Spiroplasma eriocheiris infect Eriocheir sinensis

Libo Hou a, Yuye Yan a, Tao Xiang a, Yubo Ma a, Wei Gu a, b , Wen Wang a, Qingguo Meng a, b, *

a

Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences & College

oo

f

of Marine Science and Engineering, Nanjing Normal University, 1 Wenyuan Road, Nanjing

Co-Innovation Center for Marine Bio-Industry Technology of Jiangsu Province, Lianyungang,

e-

b

pr

210046, China

Jo u

rn

al

Pr

Jiangsu, China

*Corresponding authors: Qingguo Meng, Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences & College of Marine Science and Engineering, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China Tel: +86-25-85891955; Tel: +8625-85891955. E-mail address: [email protected].

1

Journal Pre-proof ABSTRACT As a novel lethal pathogen of Eriocheir sinensis tremor disease, Spiroplasma eriocheiris, has led into catastrophic economic losses in aquaculture. The hemocytes of E. sinensis is the first target cells of S. eriocheiris. Our study is the first time designed to understanding of the Nglycoproteome dynamics of E. sinensis hemocytes under S. eriocheiris infected at the early phage. In the current study, the N-glycoproteome changes of E. sinensis hemocytes after S.

oo

f

eriocheiris infection were obtained using tandem mass tags (TMT) labeling and affinity

pr

enrichment followed by high-resolution Liquid chromatography coupled tandem mass spectrometry (LC-MS/MS) analysis. Using a 1.2-fold change in expression as a physiologically

79 up-regulated glycosylated proteins and 88 down-regulated

Pr

quantified, including

e-

significant benchmark, 167 differentially expressed N-glycosylated proteins were reliably

al

glycosylated proteins subsequented to S. eriocheiris infection. Gene ontology (GO) annotation,

rn

protein domain annotation, Kyoto Encyclopedia of Genes and Genomes (KEGG) annotation,

Jo u

subcellular localization annotation and protein-protein interaction network were used to analyze those significantly differently expression proteins shown that many biological process and pathway are participate in S. eriocheiris infected host cell, such as phagocytosis, ECM-receptor interaction, lysosome, prophenoloxidase system, and so on. Six selected different expressed glycosylated proteins were studied the transcription at RNA level by qRT-PCR. Our study could serve as a basis to understand the relationship between E. sinensis and the pathogen S. eriocheiris, and also provide reference to study protein N-glycosylation in other crustaceans. Keywords： Eriocheir sinensis, Spiroplasma eriocheiris, hemocytes, N-glycoproteome

2

Journal Pre-proof

1. Introduction Chinese mitten crab, Eriocheir sinensis, is an economically and nutritionally important freshwater species for aquaculture in China due to its suitability in a variety of culture systems and high commercial value. E. sinensis aquaculture is a rapidly developing industry in China.

However, bacterial-, viral- and -parasites born disease have blossomed within booming E. sinensis cultures, causing a severely impacted to the aquaculture industry, and serious damage

oo

f

to its commercial production. Among them, Tremor disease (TD) is one of the most devastating

pr

epizootics of E. sinensis that serious effect economic benefit of the crab cultivation industry

e-

(Zhang et al., 2015). Spiroplasma, one of the smallest prokaryotes with a typical helical structure and the capacity to be motile was previously identified as a causative pathogen of the

Pr

disease, and given the name Spiroplasma eriocheiris (Weisburg et al., 1989; Wang et al., 2004).

al

Previous research shown that the hemocytes of E. sinensis is the first target cells of S.

rn

eriocheiris. When infection into the hemocytes, S. eriocheiris form inclusions body and

Jo u

replication in the cell. Subsequently, the bacterium following the blood circulation infect the muscles, nerves and connective tissues of the crab (Wang et al., 2002). In recent years, proteomic approaches have been widely used to study the molecular mechanisms of host cell response the bacteria infection (Wu et al., 2013; Xing and Laroche, 2011; Zhang et al., 2015). However, in crustaceans there are none study has been done to further understanding of the Nglycoproteome dynamics changes under pathogen infection. It is known that protein posttranslational modifications (PTMs) are closely related to cell growth, development, and resistance to various biotic and abiotic stresses. N-linked glycosylation is a common types of PTMs, and plays important roles in cell-cell interactions cell-matrix interactions, and protein 3

Journal Pre-proof folding. N-linked glycoproteins are mainly secreted or located on the extracellular side of plasma membrane (Zhang et al., 2003). N-glycosylation of macrophages undergoes rapid and significant changes following Mycobacterium tuberculosis infection, such as altered glycosylation patterns of lysosomal N-glycoproteins within infected macrophages though N‑ glycoproteome (Hare et al., 2017). Whether the protein N-glycosylation also play an important role in the S. eriocheiris infect hemocytes of E. sinensis still don’t clear.

oo

f

In this paper, for the first time, a global, quantitative glycoproteomics approach was

pr

applied to investigate the N-glycoproteome changes of E. sinensis hemocytes under the

e-

challenge of S. eriocheiris at the early phage. In crustaceans, this is also the first time use proteomics approach to study the protein PTMs change after pathogen infection. Many

Pr

glycosylated proteins, as well as potential signal pathways associated with S. eriocheiris

al

infection, were found. The new biological evidence provided by this study will help to shed

rn

light on the molecular mechanisms S. eriocheiris infection the host cell.

Jo u

2. Materials and Methods

2.1. Experimental bacterial infection and hemocytes collection S. eriocheiris used in this study was isolated from the diseased E. sinensis using the methods described by Wang et al. (Wang et al., 2002) and cultured in R2 medium (heart infuso broth cultivation (HIBC), 25 g/L; sucrose, 8 g/L; PBS-B, 8 ml/L) at 30 ℃. E. sinensis (50±5 g) were purchased from an aquaculture farm in Baoying, Jiangsu Province, China and cultivated in an ultraviolet radiation sterilization circulating water temperature controlled aquaculture system. Healthy E. sinensis (verified by S. eriocheiris negative results using PCR of 16s rRNA sequence analyses) were maintained for 1 week before tests. The crabs in the experimental 4

Journal Pre-proof group (30 individuals) received an injection of 100 μL of S. eriocheiris (107 cells/ml). Thirty crabs in the control group received an injection of 100 μL of R2 medium. Previous studies have indicated that the S. eriocheiris started to enter the hemocyte at 24 h. At 24 h post-injection, hemolymph was drawn from the experimental group (IS-G) and the control group (IR-G), 10 crabs for each group. And mixed each group hemocytes together to prepare samples. The

f

hemolymph was drawn from crabs using a 1-mL syringe, and quickly added into anticoagulant

oo

solution at a ratio of 1:1. Sterile anticoagulant citrate dextrose solution B (ACD-B, glucose,

pr

1.47 g; citrate, 0.48 g; sodium citrate, 1.32 g; pH = 4.0; prepared in double distilled water at

e-

100 mL final volume, and filtered with 0.22 μM filter) was employed. Samples were immediately centrifuged at 4000 g, 4 ℃ for 5 min to collect the hemocytes.

Pr

2.2 Protein Extraction, Trypsin Digestion and TMT Labeling

al

Carb hemocytes was sonicated three times on ice using a high intensity ultrasonic

rn

processor (40% power with 15’’ pulse and 45’’ interval, Scientz) in lysis buffer (8 M urea, 1%

Jo u

protease inhibitor cocktail). The remaining debris was removed by centrifugation at 12,000 g at 4 ℃ for 10 min. Finally, the supernatant was collected and the protein concentration was determined with BCA kit according to the manufacturer’s instructions. For digestion, the protein solution was reduced with 5 mM dithiothreitol for 30 min at 56 ℃ and alkylated with 11 mM iodoacetamide for 15 min at room temperature in darkness. The protein sample was then diluted by adding 100 mM TEAB to urea concentration less than 2 M. Finally, trypsin was added at 1:50 trypsin-to-protein mass ratio for the first digestion overnight and 1:100 trypsin-to-protein mass ratio for a second 4 h-digestion. After trypsin digestion, peptide was desalted by Strata X C18 SPE column (Phenomenex) 5

Journal Pre-proof and vacuum-dried. Peptide was reconstituted in 0.5 M TEAB and processed according to the manufacturer’s protocol for TMT kit (Thermo, USA). Briefly, one unit of TMT reagent were thawed and reconstituted in acetonitrile. The peptide mixtures were then incubated for 2 h at room temperature and pooled, desalted and dried by vacuum centrifugation. The samples from ten crabs (experimental group and control group) were mixed together for N-glycoproteome

oo

TMT labeling efficiency for N-glycoproteome were 98%.

f

(IS-G and IR-G) analysis. Samples IS-G and IR-G were labeled by 129 and 130, respectively.

pr

2.3 Affinity Enrichment

e-

The quantity used for N-glycosylation enrichment was 0.25 mg of each fraction, firstly the desalted peptides were re-dissolved in 40 μL loading buffer (80% ACN/1% TFA) and then

Pr

pipetted into a HILIC tip. After centrifugation at 4000 g for about 15 min, the glycopeptides

al

were retained in the tip. Then, the HILIC tip was washed with 40 μL of loading buffer three

rn

times to remove the residual nonglycopeptides by centrifugation. Thirdly, the enriched

Jo u

glycopeptides were eluted with 20 μL of 10% ACN three times and dried by vacuum centrifugation. Finally, the peptides were dissolved in 50 μL of 40 mM NH4 HCO3 in H2 18 O and added 2 μL of PNGase F. Then, the samples were incubated at 37 ℃ overnight for deglycosylation. For LC-MS/MS analysis, the resulting peptides were desalted with C18 ZipTips (Millipore) according to the manufacturer’s instructions. 2.4 LC-MS/MS Analysis The tryptic peptides were fractionated into fractions by high pH reverse-phase HPLC using Thermo Betasil C18 column (5 μm particles, 10 mm ID, 250 mm length, Thermo Fisher Scientific, USA). Mobile phase A was composed by 2% ACN and 10 mM formic acid, pH=9. 6

Journal Pre-proof The gradient was comprised of an increase from 6% to 23% solvent B (10 mM formic acid in 98% acetonitrile) over 26 min, 23% to 35% in 8 min and climbing to 80% in 3 min then holding at 80% for the last 3 min, all at a constant flow rate of 400 nL/min on an EASY-nLC 1000 UPLC system. The peptides were subjected to NSI source followed by tandem mass spectrometry (MS/MS) in Q Exactive TM Plus (Thermo) coupled online to the UPLC. Mass window for

oo

f

precursor ion selection was 2.0 m/z of N-glycosylation. Intensity threshold for MS2 was 5e3.

pr

Charge state screening parameters was 2+, 3+, 4+ and 5+. The electrospray voltage applied was

e-

2.0 kV. The m/z scan range was 350 to 1800 for full scan, and intact peptides were detected in the Orbitrap at a resolution of 70,000. Peptides were then selected for MS/MS using NCE

Pr

setting as 28 and the fragments were detected in the Orbitrap at a resolution of 17,500. A data-

al

dependent procedure that alternated between one MS scan followed by 20 MS/MS scans with

rn

15.0s dynamic exclusion. Automatic gain control (AGC) was set at 5E4. Fixed first mass was

Jo u

set as 100 m/z. 2.5 Database Search

For TMT quantification, the ratios of the TMT reporter ion intensities in MS/MS spectra (m/z 126–131) from raw data sets were used to calculate fold changes among samples. The resulting MS/MS data were processed using Maxquant search engine (v.1.5.2.8). Tandem mass spectra were searched against transcriptome of E. sinensis hemocytes database concatenated with reverse decoy database. Trypsin/P was specified as cleavage enzyme allowing up to 4 missing cleavages. The mass tolerance for precursor ions was set as 20 ppm in First search and 5 ppm in Main search, and the mass tolerance for fragment ions was set as 0.02 Da. 7

Journal Pre-proof Carbamidomethyl on Cys was specified as fixed modification glycosylation on Asp were specified as variable modifications. False discovery rate (FDR) thresholds for protein, peptide and modification site were specified at 1%. Minimum peptide length was set at 7. All the other parameters in MaxQuant were set to default values. The site localization probability was set as > 0.5. Two-sample, two-sided T-tests were used to compare expression of proteins. In general, a significance level of 0.05 was used for statistical testing, and the P value or significance level

oo

f

any time a statistical test was performed.

pr

2.6 Bioinformatics analysis

e-

2.6.1 Protein functional annotation

Gene Ontology (GO) annotation proteome was derived from the UniProt-GOA Database

Pr

(http://www.ebi.ac.uk/GOA/). The Kyoto Encyclopedia of Genes and Genomes (KEGG) was

al

used to annotate pathways. InterPro database and InterProScan were used to annotate protein

rn

domains. The CORUM database was used to annotate the protein complex.

Jo u

2.6.2 Functional Enrichment

Fisher's exact test was used to test for enrichment or depletion (two tailed test) of specific annotation terms among members of resultant protein clusters. Derived p-value was further adjusted to address multiple hypotheses testing by the method proposed by Benjamini and Hochberg, p-value < 0.05 was considered significant. 2.6.3 Motif Analysis Soft motif-x was used to analysis the model of sequences constituted with amino acids in specific positions of modify-21-mers (10 amino acids upstream and downstream of the site) in all protein sequences. And all the database protein sequences were used as background database 8

Journal Pre-proof parameter, other parameters with default. 2.6.4 Protein-protein interaction network All identified N-glycosylated protein name identifiers were searched against the STRING database version 9.1 for protein-protein interactions. STRING defines a metric called “confidence score” to define interaction confidence; we fetched all interactions that had a confidence score ≥ 0.7 (high confidence). Interaction network form STRING was visualized in

pr

was utilized to analyze densely connected regions.

oo

f

Cytoscape. A graph theoretical clustering algorithm, molecular complex detection (MCODE)

e-

2.6.5 Enrichment-based Clustering

For the differentially expressed N-glycosylated proteins, the proteins divided into four

Pr

categories Q1 (0< Ratio ≤ 0.77), Q2 (0.77 < Ratio ≤ 0.83), Q3 (1.2 < Ratio ≤ 1.3) and Q4

al

(Ratio >1.3) base on different change. Further hierarchical clustering based on different protein

rn

functional classification (such as: GO, Domain, Pathway, Complex) were carried out. All the

Jo u

categories obtained after enrichment along with their p values, and then filtered for those categories which were at least enriched in one of the clusters with p value <0.05. This filtered p value matrix was transformed by the function x = −log10 (p value). Finally, these x values were z-transformed for each functional category. These z scores were then clustered by oneway hierarchical clustering (Euclidean distance, average linkage clustering) in Genesis. Cluster membership were visualized by a heat map using the “heatmap.2” function from the “gplots” R-package. 2.7 Experimental validation using quantitative real-time PCR Fifty crabs received an injection of 100 μL of S. eriocheiris (107 cells/ml). At 0, 1, 3, 5, 7 9

Journal Pre-proof

and 9 d after injection, the hemolymph was drawn to prepare the total RNA. Total RNA was extracted from the thoracic ganglion by using TRIzol reagent (Invitrogen, USA) according to the instruction of the manufacturer. Six DEGs were selected to study the expression using quantitative real-time PCR (qRT-PCR) including Integrin-PS3 (Int-PS3), mannose-6phosphate receptor (M6P), laccase-1 (Lac), proclotting enzyme (ProE), serine protease inhibitor 42 (SPI42) and serine protease snake (SPs). In the qRT-PCR analysis, glyceraldehyde-

oo

f

3-phosphate dehydrogenase (GAPDH) was amplified as a reference gene. Primers used in the

pr

qRT-PCR analysis are listed in Table 1. qRT-PCR was carried out using the ABI Quant studio

e-

6 Flex system with SYBR® Premix Ex Taq™ (TaKaRa, Japan) according to the manufacturer's instructions. The PCR reaction was performed with a 20 μL volume (2 μM of each specific

Pr

primer, 2 μL of cDNA, 10 μl of 2 × SYBR and 6 μl of sterile distilled H 2 O Premix Ex Taq).

al

The PCR program was the following procedure: initial denaturation at 95 ℃ for 2 min; followed

rn

by 40 cycles of amplification (95 ℃ for 10 s, 55 ℃ for 30 s, and 72 ℃ for 30 s). The relative

Jo u

expression levels of different genes in thoracic ganglion were calculated according to the 2−ΔΔC T method. Statistical analysis was performed using SPSS software (Ver11.0). Data represent the mean ± standard error (S.E.). Statistical significance was determined by one-way ANOVA, and posthoc Duncan multiple range tests. Significance was set at P < 0.05. 3. Results 3.1 N-glycosylation proteins Identification Through TMT labeling followed by affinity enrichment and LC-MS/MS analysis-based quantitative proteomics, in total, 390 glycosylated sites corresponding to 212 glycosylated proteins were identified and 357 glycosylated sites corresponding to 197 glycosylated proteins 10

Journal Pre-proof were quantified. Using a 1.2-fold decrease or increase in PTM proteins expression as a benchmark for physiologically significant change. In total, 167 differentially expressed Nglycosylated proteins (232 glycosylated sites) were reliably quantified, including 79 upregulated glycosylated proteins (109 glycosylated sites) and 88 down-regulated glycosylated proteins (123 glycosylated sites) related to S. eriocheiris infection (Table S1). The all identified PTM proteins were used to GO annotation, protein domain annotation, KEGG annotation and

oo

f

subcellular localization annotation (Table S2). In order to identify enrichment of N-

pr

glycosylation motifs, motif-X algorithm was used to analyze the data. Significantly enriched

e-

N-glycosylation motifs included NxT and NxS (Fig. S1A and Table S3). Heat map of the amino acid compositions around the glycosylation sites were analyzed. The results shown that both

Pr

serine and threonine have an increase incidence compared to other amino acids at

al

approximately +/- 10 amino acids from the glycosylation site (Fig. S1B).

Jo u

glycosylated proteins

rn

3.2 GO Annotation Analysis and Subcellular Location Analysis of differentially expressed N-

To better understand the data of this paper, all the identified differentially expressed Nglycosylated proteins were investigated based on biological process, cellular component and molecular function (Fig. 1, Table S4) in GO functional classification. The results of classification base on biological process shown majority of differentially expressed Nglycosylated proteins belong to metabolic process (39 %), cellular process (16 %) and singleorganism process (16%). From the cellular component perspective, nearly half of the protein belongs to membrane (48%). From the molecular function perspective based on GO annotation showed that the N-glycosylated proteins mainly distributed in binding (39%) and catalytic 11

Journal Pre-proof activity (42%). Subcellular location analysis was also used to investigate the differentially expressed Nglycosylated proteins. The differentially expressed N-glycosylated proteins were belonged to the extracellular (48%), cytoplasm (18%) and plasma membrane (15%). Only 6% proteins were classified as nucleus (Fig. S2 and Table S5). 3.3 Enrichment-based Clustering

oo

f

To better analyze the results, the differentially expressed N-glycosylated proteins were

pr

divided into four categories base on the different change multiples of these proteins. The Go

e-

enrichment analysis base on the biological process, cellular component and molecular function of differentially expressed N-glycosylated proteins shown that many metabolites process play

Pr

an important role in the S. eriocheiris infected the host cell (Fig. 2). There were many processes

al

were enrichment such as protein modification process, cellular protein modification process

rn

and phosphorylation were significantly enriched in the biological process perspective of N-

Jo u

glycosylated proteins. From the molecular function perspective of N-glycosylated proteins, there also have many processes were enrichment, phosphatase activity, oxidoreductase activity, protein binding and so on. And there were also many extracellular components were enrichment such as extracellular region, intracellular, intracellular part, extracellular space, extracellular region part and so on. Protein domain analysis for differentially expressed N-glycosylated proteins shown that there many domains were enrichment, such as associated with C-type lectin domain (C-type lectin-like/link domain, C-type lectin fold and C-type lectin-like), integrindependent domain (Integrin beta Subunit, VWA domain, integrin beta subunit, tail, integrin alpha-2 and integrin domain), immunoglobulin-related domain (immunoglobulin subtype 2, 12

Journal Pre-proof immunoglobulin 1-set, immunoglobulin subtype and immunoglobulin-like domain), and so on. KEGG pathway analysis enrichment-based clustering shown several important pathways were significantly enriched, phagosome, ECM-receptor interaction and lysosome in differentially expressed N-glycosylated proteins. And those pathway may play a crucial role in the S. eriocheiris infected the host cell. 3.4 Protein-protein interaction network

oo

f

Compare with individual proteins, protein complexes carry out have great advantages in

pr

study the functions and processes in cells. How a protein interacts with other proteins in protein

e-

complexes can be very important to understanding the role of individual proteins in the celluar biology. To investigate the associations of the differentially expressed N-glycosylated proteins,

Pr

the online database STRING 9.0 were used to establish the protein interaction networks basis

al

of both physical and functional interactions. This interaction network was based on inferred

rn

from the STRING-DB. For differentially expressed N-glycosylated proteins (Fig. 3 and Table

Jo u

S6), the largest group of interacting proteins includes those associated prophenoloxidase system (proPO system) (black oval), for example, serine proteinase inhibitor 2 (comp36999_c0), serine protease 1 (comp36993_c0), serpin 3 (comp37515_c0), transglutaminase (comp36534_c1), pacifastin-related serine protease inhibitor

(comp38729_c0)

and clotting

factor B

(comp35511_c0). This results shown that the N-glycosylated modification play a crucial role in regulated the proPO system when S. eriocheiris infected. Second, some receptors are grouped together (dark blue oval). Vascular endothelial growth factor receptor 3 (comp38034_c0), cytokine receptor (comp14128_c0), vascular endothelial growth factor A (comp36156_c0), fasciclin-2 (comp30424_c0), protein toll (comp37030_c0) are all play a role in the process of 13

Journal Pre-proof cell signal transduction. 3.5 The results of qRT-PCR To further validate the results of different expression proteins from N-glycoproteom, 6 proteins were selected to quantify their transcription by qRT-PCR analysis. The efficiency of various primers used in qRT-PCR were tested, and the amplified fragments were sequenced for

f

target verification. The qRT-PCR analyses were performed in the three biological replicates of

oo

each sample. As shown in Fig. 4, 6 selected gene have different transcription trends upon the

pr

S. eriocheiris infection. Such as the expression level of Int-PS3 was none significantly changed

e-

at the early stage of the S. eriocheiris infection, but down-regulated at the later stage. The mRNA transcription level of Lac was significantly down-regulated at the third of S. eriocheiris

Pr

infection, and then recovered to the normal level.

al

4. Discussion

rn

The hemocytes as the most important immune cell of crustacean plays necessary role in

Jo u

clearance foreign pathogens. Previous research shown that the hemocytes of E. sinensis is the first target cells of S. eriocheiris. When this bacterium invades into the hemocytes, it forms inclusions body and replication in the cell. So, it’s important to know the respond of E. sinensis hemocytes against S. eriocheiris infected. E. sinensis hemocytes respond to S. eriocheiris infection through the transcription and translation of response related genes, which is a complex mechanism that involves various cross-talk pathways. In addition, protein PTMs like N-linked glycosylation can regulate protein functions to respond to different biotic stress and abiotic stress (Hare et al., 2017; Lv et al., 2014; Yang et al., 2015). In the current study, through a Nglycoproteome approaches, a comprehensive analysis of E. sinensis hemocytes under S. 14

Journal Pre-proof eriocheiris infection at the early phage was investigated for the first time. In total, 79 upregulated glycosylated proteins and 88 down-regulated glycosylated proteins subsequent to S. eriocheiris infection. GO annotation, protein domain annotation, KEGG annotation, subcellular localization annotation and protein-protein interaction network analysis those significantly differently expression proteins shown that phagocytosis, ECM-receptor interaction, lysosome, prophenoloxidase system are participate in S. eriocheiris infected host cell.

oo

f

Phagocytosis is an important component of the innate immune response in invertebrates

pr

and vertebrates, and allows a host cell to successively bind, internalize and finally destroying

e-

invading pathogens (Greenberg et al., 2002; Maderna et al., 2003). Integrin-dependent phagocytosis is a process that need several integrins mediating and an important part of the host

Pr

innate immune system. When the presence of one well-known competitors for integrin ligands

al

RGD (Asp-Gly-Arg) containing peptides, the phagocytosis of Escherichia coli by Drosophila

rn

melanogaster hemocytes would significantly reduce (Foukas et al., 1998). Similarly, when

Jo u

knockout β integrin (BINT2) of mosquito Anopheles gambia, the phagocytosis of E. coli would reduce 70% (Moita et al., 2006). Pathogens interacted with host-cell receptors, particularly with integrin, not only adhered but also triggered actin cytoskeleton rearrangements and then lead to cellular invasion. At present the best-known case of the bacteria hijacking of integrin function for invasion was Yersinia species. These bacteria, Yersinia enterocolitica and Yersinia pseudotuberculosis, express a surface protein called invasin binding to α5β1 integrins was sufficient to trigger bacterial entry into host cells (Tran Van Nhieu and Isberg, 1993; Wong and Isberg, 2005). Similarly, the Staphylococcus aureus also interacted with integrin and then linked to the activation of Src- and FAK-dependent signaling pathways to help this bacterium enter 15

Journal Pre-proof into host cell (Agerer et al., 2005; Agerer et al., 2003). In this study, several integrins were significantly changed in N-glycosylation modification level by quantitative proteomics. Compare with the control group, there are kind of integrin and their sites were significantly changed at N-Glycosylation modification level, such as integrin β-1 (N144/N178), integrin β pat-3 (N6), integrin α-PS3 (N64/77/344/499/777), integrin β-PS (N608), integrin α-V (N492/613/762/868), integrin α-PS4 (N80/226/652). The mRNA level of Int-PS3 was

oo

f

significantly down-regulated at the later stage of the S. eriocheiris infection. Those results

pr

shown that the hemocytes, as the most important immune cell, may recognized the bacterium

e-

by the cell surface integrins when the S. eriocheiris invasion. The S. eriocheiris recognized by integrins would induced the N-glycosylation level change of integrins. In turn triggered the

Pr

integrin-dependent phagocytosis to destroy the invading pathogens. On the other hand, similar

al

with the other bacteria, Y. enterocolitica, Y. pseudotuberculosis and S. aureus, S. eriocheiris

rn

may interacted with integrins, and then lead to cellular invasion.

Jo u

As an acidic organelle, lysosomes play a crucial role in the degradation of phagocytic vacuoles, macromolecules and autophagic substrates (Luzio et al., 2007; Saftig et al., 2009). Lysosome-phagosome fusion is the indispensable process that phagocytic vacuoles acquire degradative and microbicidal properties. Lysosome-associated membrane proteins (LAMPs) are known as major lysosomal membrane glycoproteins with many N-glycosylation sites. And N-glycosylation modification of LAMPs is essential for maintenance it’s stabilization (Eskelinen et al., 2003; Eskelinen et al., 2005). LAMPs are also believed to play an important role in the maintenance of the structural integrity of the lysosomal membrane, lysosomephagosome fusion, phagosome maturation and microbial killing (Huynh et al., 2007). In our 16

Journal Pre-proof study, three N-glycosylation sites of LAMP1 (N147/253/254) and two N-glycosylation sites of LAMP3 or CD63 (N155/167) were significantly changed when the S. eriocheiris infected host cell. Abnormal N-glycosylation level induced by S. eriocheiris had negative effects on maintenance the protein function. Niemann-pick C1 (NPC1) is membrane protein associated with late endosomes/lysosomes, and those gene mutants will induce hyper-accumulation of multiple lysosomal cargos (Rong et al., 2011; Nakano et al., 2001). In the current study, S.

oo

f

eriocheiris infection would significantly up-regulate the N-glycosylation modification of NPC1

pr

(N59). Cathepsin D (lysosomal aspartic protease) is an important soluble lysosomal acid

e-

hydrolase, modified with mannose 6-phosphate (M6P) residues at asparagine residues, in turn recognize by M6P receptor in Golgi and trafficking to lysosomes system (Kornfeld and Sly,

Pr

2001; Dittmer et al., 1999; Kornfeld, 1990; Fortenberry et al., 1995). In this paper, at the early

al

stage of S. eriocheiris infection host cell, the N-glycosylation modification level of M6P

rn

receptor (N943) and cathepsin D (N119) were significantly down-regulated compare with the

Jo u

control group. The mRNA level of M6P was significantly changed after third day of the S. eriocheiris infection. Meanwhile, E. sinensis cathepsin D was verify to play a critical role in the hemocyte eliminate the S. eriocheiris (Ning et al., 2018). Though these results, it could be speculated that when the S. eriocheiris enter into host cell via phagocytosis, this bacterium induced N-glycosylation level had significantly change of several important membrane proteins of lysosome and phagosome, such as LAMP1, LAMP3 (or CD63) and NPC1, and then negative influence stability and fusion between phagosome and lysosome. At the same time, the S. eriocheiris down-regulated the activity of cathepsin D and the other activated acid hydrolases through influence the N-glycosylation of M6P. Consequently, S. eriocheiris could escape the 17

Journal Pre-proof phagocytosis of host cells respond this bacterium invading and replication in the hemocyte of E. sinensis. The prophenoloxidase-activating system (proPO system) serves an important role as a nonself-recognition system to participate in the innate immunity, which only found in the invertebrates. Many studies have shown that this system played an important role in crustacean against different pathogens. Such as, when Vibrio parahaemolyticus, Micrococcus lysodeikticus

oo

f

and white spot syndrome virus (WSSV) infected the Litopenaeus vannamei, the host cell proPO

pr

system would be activate to resistance the pathogens invade (Shi et al., 2017). In this paper,

e-

when the S. eriocheiris infected the host cell, many proteins and enzymes of proPO system were significant changed in N-glycosylation modification levels. For example, S. eriocheiris

Pr

infected would induce five kinds of serine proteases (proclotting enzyme, plasma kallikrein,

al

melanization protease1, serine protease 42 and serine protease snake) and one kinds of PO

rn

enzyme (laccase-1) N-glycosylation levels were significantly up-regulated compared with the

Jo u

control group. At the same time, there were two kinds of serine proteases inhibitor (alpha-1antitrypsin-like protein and serine protease inhibitor 42) glycosylation levels significant downregulated. The proPO system was only found in the invertebrates, and there was few studies about the influence of protein posttranslational modification on this system. The Nglycosylation is one of the most common PTMs, it play important roles in regulation the protein activity and stability. So when the S. eriocheiris invaded the hemocyte of E. sinensis, the host cell activated host cell proPO system to resistance the bacterium infection by regulated some important proteins N-glycosylation, such as serine protease, serine proteases inhibitor and PO enzyme. The blood coagulation system also was an important part of the crustacean innate 18

Journal Pre-proof immune. Crustacean coagulation was believed to rely on the formation of a clottable protein. The previous studies also suggested that the release of AMPs (crustin and lysozyme) depended on the activation of the coagulation system (Fagutao et al., 2012). In this study, N-glycosylation level of host cell clotting factor was up-regulated significantly duo to the S. eriocheiris infection. In conclusion, the role of protein post-translational N-glycosylation in the S. eriocheiris invade the hemocyte of E. sinensis was studied at the first time. This is also first time to study

oo

f

the protein post-translational in crustacean using proteomics. In total, 79 up-regulated

pr

glycosylated proteins and 88 down-regulated glycosylated proteins were reliably quantified in

e-

S. eriocheiris infection. Using these differentially expressed proteins, the infection route of S. eriocheiris and the immune response of E. sinensis were speculated (Fig. 5). When S.

Pr

eriocheiris infection, hemocytes as the most important immune cell recognize the pathogen by

al

the cell surface integrins. And then induces the integrin-dependent phagocytosis triggered to

rn

destroy the invading pathogens. On the contrary, S. eriocheiris may hijacking integrins as

Jo u

receptor help itself cellular invasion and negative influence fusion phagosome and lysosome to help the pathogen escape the immune of host cells and provide a suitable environment for the pathogen productions in the hemocyte. At the same time, the host cell proPO system and coagulation system were activated to resist S. eriocheiris infection. The results of this paper demonstrated that protein N-glycosylation play a crucial role in the S. eriocheiris invade the hemocyte of E. sinensis. These results could serve as a basis for future studies to understanding the relationship between E. sinensis and the pathogen S. eriocheiris, and provide basis to study protein N-glycosylation in other crustaceans.

19

Journal Pre-proof

ACKNOWLEDGMENTS The current work was supported by grants from the National Key Research and Development Program of China (Grant No. 2018YFD0900600), the National Natural Sciences Foundation of China (NSFC No. 31870168), the Modern Fisheries Industry Technology System Project of Jiangsu Province (Grant No.JFRS-01) and the project funded by the Priority Academic Program

oo

f

Development of Jiangsu Higher Education Institutions (PAPD).

pr

REFERENCES

e-

Agerer, F., Lux, S., Michel, A., 2005. Cellular invasion by Staphylococcus aureus reveals a functional link between focal adhesion kinase and cortactin in integrin-mediated internalization.

Pr

Journal of Cell Science. 118, 2189-2200.

al

Agerer, F., Michel, A., Ohlsen, K., 2003. Integrin-mediated invasion of Staphylococcus aureus

rn

into human cells requires Src family protein-tyrosine kinases. The Journal of Biological

Jo u

Chemistry. 278, 42524-42531.

Xu, D.D., Liu, W.F., Huang, T.Z., et al., Cellular immune responses against viral pathogens in shrimp. Developmental & Comparative Immunology 47 (2014) 287-297. Dittmer, F., Ulbrich, E.J., Hafner, A., 1999. Alternative mechanisms for trafficking of lysosomal enzymes in mannose 6-phosphate receptor-deficient mice are cell type-specific. Journal of Cell Science. 112, 1591-1597. Eskelinen, E.L., Cuervo, A.M., Taylor, M.R., 2005. Unifying nomenclature for the isoforms of the lysosomal membrane protein LAMP-2. Traffic. 6, 1058-1061. Eskelinen, E.L., Tanaka, Y., Saftig, P., 2003. At the acidic edge: emerging functions for 20

Journal Pre-proof lysosomal membrane proteins. Trends in Cell Biology. 13, 137-145. Fagutao, F.E., Maningas, M.B.B., Kondo, H., Aoki, T., Hirono, I., 2012. Transglutaminase regulates immune-related genes in shrimp. Fish & Shellfish Immunology. 32, 711-715. Fortenberry, S.C., Schorey, J.S., Chirgwin, J.M., 1995. Role of glycosylation in the expression of human procathepsin D. Journal of Cell Science. 108, 2001-2006. Foukas, L.C., Katsoulas, H.L., Paraskevopoulou, N., 1998. Phagocytosis of Escherichia coli by

oo

f

insect hemocytes requires both activation of the Ras/mitogen-activated protein kinase signal

pr

transduction pathway for attachment and beta3 integrin for internalization. The Journal of

e-

Biological Chemistry. 273, 14813-14818.

Greenberg, S., Grinstein, S., 2002. Phagocytosis and innate immunity. Current Opinion in

Pr

Immunology. 14, 136-145.

al

Hare, N., Lee, L.Y., Loke, L.Y., 2017. Mycobacterium tuberculosis infection manipulates the

rn

glycosylation machinery and the N ‑ glycoproteome of human macrophages and their

Jo u

microparticles. Journal of Proteome Research. 16, 247-263. Huynh, K.K., Eskelinen, E.L., Scott, C.C., 2007. LAMP proteins are required for fusion of lysosomes with phagosomes. The EMBO Journal. 26, 313-324. Kornfeld, S., 1990. Lysosomal enzyme targeting. Biochemical Society Transactions. 18, 367374. Kornfeld, S., Sly, W.S., 2001. I-cell disease and pseudo-Hurler polydystrophy: disorders of lysosomal enzyme phosphorylation and localization, in: C.R. Scriver, A.L. Beaudet, W.S. Sly, D. The metabolic and molecular bases of inherited disease, McGraw-Hill. New York. pp. 34213452. 21

Journal Pre-proof Luzio, J.P., Pryor, P.R., Bright, N.A., 2007. Lysosomes: fusion and function. Nature Reviews Molecular Cell Biology. 8, 622-632. Lv, W.D., Subburaj, S., Cao, M., 2014. Proteome and phosphoproteome characterization reveals new response and defense mechanisms of Brachypodium distachyon leaves under salt stress. Molecular & Cellular Proteomics. 13, 632-652. Maderna, P., Godson, C., 2003. Phagocytosis of apoptotic cells and the resolution of

oo

f

inflammation. Biochimica et Biophysica Acta. 1639, 141-151.

pr

Moita, L.F., Vriend, G., Mahairaki, V., 2006. Integrins of Anopheles gambiae and a putative

Molecular Biology. 36, 282-290.

e-

role of a new beta integrin, BINT2, in phagocytosis of E. coli. Insect Biochemistry and

Pr

Nakano, Y., Fujitani, K., Kurihara, J., 2001. Mutations in the novel membrane protein spinster

al

interfere with programmed cell death and cause neural degeneration in Drosophila

rn

melanogaster. Molecular and Cellular Biology. 21, 3775-3788.

Jo u

Nhieu, G.T.V., Isberg, R.R., 1993. Bacterial internalization mediated by beta1 chain integrins is determined by ligand affinity and receptor density. The EMBO Journal. 12, 1887-1895. Ning, M., Yuan, M., Liu, M., 2018. Characterization of cathepsin D from Eriocheir sinensis involved in Spiroplasma eriocheiris infection. Developmental & Comparative Immunology. 86, 1-8. Rong, Y., McPhee, C.K., Deng, S., 2011. Spinster is required for autophagic lysosome reformation and mtor reactivation following starvation. Proceedings of the National Academy of Sciences of the United States of America. 108, 7826-7831. Saftig, P., Klumperman, J., 2009. Lysosome biogenesis and lysosomal membrane proteins: 22

Journal Pre-proof trafficking meets function. Nature Reviews Molecular Cell Biology. 10, 623-635. Shi, L., Chan, S., Li, C., Zhang, S., 2017, Identification and characterization of a laccase from Litopenaeus vannamei involved in anti-bacterial host defense. Fish & Shellfish Immunology. 66, 1-10. Wang, W., Chen, J.X., Du, K.H., 2004. Morphology of spiroplasmas in the Chinese mitten crab Eriocheir sinensis associated with tremor disease. Research in Microbiology. 155, 630-635.

oo

f

Wang, W., Zhu, N.N., Gu, Z.H., 2002. Study on the transmission of tremor disease (TD) in the

pr

Chinese mitten crab, Eriocheir sinensis (Crustacea: Decapoda). Journal of Invertebrate

e-

Pathology. 81, 202-204.

Weisburg, W.G., Tully, J.G., Rose, D.L., 1989. A Phylogenetic analysis of the Mycoplasmas:

Pr

basis for their classification. Journal of Bacteriology. 171, 6455-6467.

al

Wong, K.W., Isberg, R.R., 2005. Emerging views on integrin signaling via Rac1 during invasin-

rn

promoted bacterial uptake. Current Opinion in Microbiology. 8, 4-9.

Jo u

Wu, L.J., Han, Z.P., Wang, S.X., 2013. Comparative proteomic analysis of the plant-virus interaction in resistant and susceptible genotypes of maize infected with sugarcane mosaic virus. Journal of Proteomics. 89, 124-140 Xing, T., Laroche, A., 2011. Revealing plant defense signaling: getting more sophisticated with phosphoproteomics. Plant Signal Behavior. 6, 1469-1474. Xu, D.D., Liu, W.F., Huang, T.Z., et al., 2014, Cellular immune responses against viral pathogens in shrimp. Developmental & Comparative Immunology. 47, 287–297. Yang, X., Liu, F., Yan, Y., 2015. Proteomic analysis of N-glycosylation of human seminal plasma. Proteomics. 15, 1255-1258. 23

Journal Pre-proof Zhang, H., Li, X.J. Martin, D.B., 2003. Identification and quantification of N-linked glycoproteins using hydrazide chemistry, stable isotope labeling and mass spectrometry. Nature Biotechnology. 21, 660–666. Zhang, H., Sun, J., Ye, J., 2015. Quantitative label-free phosphoproteomics reveals differentially regulated protein phosphorylation involved in west nile virus-induced host

f

inflammatory response. Journal of Proteome Research.14, 5157-5168.

oo

Zhang, Y., Bao, H.X. Zhang., 2015. Production and application of polyclonal and monoclonal

Jo u

rn

al

Pr

e-

pr

antibodies against Spiroplasma eriocheiris. Scientific Reports. 5, 17871.

24

Journal Pre-proof FIGURE LEGENDS

Fig. 1 Gene ontology functional classification of the identified differentially expressed Nglycosylation proteins based on biological processes; molecular function; subcellular location.

Fig. 2 The differentially expressed N-glycosylated proteins were divided into four categories

oo

f

base on the different change multiples. Further hierarchical clustering based on different protein

pr

functional classification (such as: GO, Domain, KEGG Pathway) were carried out.

Pr

e-

Fig. 3 Protein-protein interaction network of differentially expressed N-glycosylated proteins.

Fig. 4 The expression profiles of 6 selected proteins gene determined by qRT-PCR. The full

al

name of the Int-PS3, M6P, Lac, ProE, SPI42 and Sps are Intergrin-PS3, mannose-6-phosphate

Jo u

rn

receptor, Laccase-1, Proclotting enzyme, Serine protease inhibitor 42 and Serine protease snake.

Fig. 5 A schematic model of S. eriocheiris infected the E. sinensis hemocytes and the immune reaction of the host cell against S. eriocheiris infected. For abbreviations and explanation see the text, the dashed represent the hypothesis.

Table 1 Primer sequences used in this study.

25

Journal Pre-proof

SUPPORTING INFORMATION: Table S1 The differentially expressed N-glycosylated proteins Table S2 All the identified N-glycosylated proteins Table S3 The enriched N-glycosylation motifs Table S4 The GO Annotation Analysis for differentially expressed N-glycosylated proteins Table S5 Subcellular for differentially expressed N-glycosylated proteins

oo

f

Table S6 Protein-protein interaction network for differentially expressed N-glycosylated

pr

proteins

e-

Fig. S1 The enrichment of N-glycosylation motifs base on the motif-X algorithm (A); Heat map of the amino acid compositions around the N-glycosylation sites showing the frequency

Pr

of different types of amino acids surrounding this residue. Red indicates enrichment and green

al

indicates depletion (B).

Jo u

rn

Fig. S2 Subcellular Location Analysis of differentially expressed N-glycosylated proteins.

26

Journal Pre-proof Table 1 Primers sequences used in this study.

rn

al

Pr

e-

pr

oo

f

Sequence (5′—3′) TGGGGATTGACAGTGGAGATG AATACTTTTGGAGGACGGAGGC GCGTACTGTCTTCCCACCTAA TGTCCTCTGCTAAACCTCCTG TTTGTGGATGTGATGCGGGTG GATGGATTCCTTCAGTGGGCTCT AATACTTGCCCGTCGTTAGGT GGCTTCCGCAGATAGTGATAG CGAAGTAGGCGAGGGACAACA GGCGAACTGAGATTCACGACC TTGGCGGCAGGAGGTTAGGGT TGTTGGAAGGCGAGCTGGACG CTGCCCAAAACATCATCCCATC CTCTCATCCCCAGTGAAATCGC

Jo u

Name Int-PS3-F Int-PS3-R M6P-F M6P-R Lac-F Lac-R ProE-F ProE-R SPI42-F SPI42-R SPs-F Sps-R GAPDH-F GAPDH-R

27

Journal Pre-proof Highlights > For the first time, the N-glycoproteome of crustacean was investigated using proteomics approach under the challenge of pathogen. > In total, 167 differential N-glycosylated proteins of E. sinensis hemocytes were related with S. eriocheiris infection.

Jo u

rn

al

Pr

e-

pr

oo

system are participate in S. eriocheiris infected host cell.

f

> Analysis shown phagocytosis, ECM-receptor interaction, lysosome, prophenoloxidase

28

Journal Pre-proof Conflict of Interest

Jo u

rn

al

Pr

e-

pr

oo

f

The authors declare that no conflict of interest exists.

29

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7