Putative tumor suppressor Lats2 induces apoptosis through downregulation of Bcl-2 and Bcl-xL

Experimental Cell Research 298 (2004) 329 – 338 www.elsevier.com/locate/yexcr

Putative tumor suppressor Lats2 induces apoptosis through downregulation of Bcl-2 and Bcl-xL Hengning Ke, a,1 Jing Pei, a,1 Zhenya Ni, a Hong Xia, a Huilin Qi, a Tishonna Woods, a Ameeta Kelekar, b and Wufan Tao a,c,* a

The Stem Cell Institute, Division of Hematology, Oncology and Transplantation, University of Minnesota, Minneapolis, MN 55455, USA b Department of Laboratory Medicine and Pathology, University of Minnesota, Minneapolis, MN 55455, USA c Department of Genetics, Cell and Development Biology, University of Minnesota, Minneapolis, MN 55455, USA Received 23 September 2003, revised version received 26 February 2004 Available online 28 May 2004

Abstract Lats2, also known as Kpm, is the second mammalian member of the novel Lats tumor suppressor gene family. Recent studies have demonstrated that Lats2 negatively regulates the cell cycle by controlling G1/S and/or G2/M transition. To further understand the role of Lats2 in the control of human cancer development, we have expressed the protein in human lung cancer cells by transduction of a replication-deficient adenovirus expressing human Lats2 (Ad-Lats2). Using a variety of techniques, including Annexin V uptake, cleavage of PARP, and DNA laddering, we have demonstrated that the ectopic expression of human Lats2 induced apoptosis in two lung cancer cell lines, A549 and H1299. Caspases-3, 7, 8, and 9 were processed in the Ad-Lats2-transduced cells; however, it was active caspase-9, not caspase-8, that initiated the caspase cascade. Inhibitors specific to caspase-3 and 9 delayed the onset of Lats2-mediated apoptosis. Western blot analysis revealed that antiapoptotic proteins, BCL-2 and BCL-xL, but not the pro-apoptotic protein, BAX, were downregulated in Ad-Lats2-transduced human lung cancer cells. Overexpression of either Bcl-2 or Bcl-xL in these cells lead to the suppression of Lats2-mediated caspase cleavage and apoptosis. These results show that Lats2 induces apoptosis through downregulating anti-apoptotic proteins, BCL-2 and BCL-xL, in human lung cancer cells. D 2004 Elsevier Inc. All rights reserved. Keywords: Human Lats2; Putative tumor suppressor; Apoptosis; Bcl-2; Bcl-xL; Caspase

Introduction The lats (or warts) tumor suppressor family, encoding a putative Ser/Thr protein kinase, is conserved from flies [1,2] to humans [3– 6]. Recent studies have revealed that lats tumor suppressor genes may control tumorigenesis by negatively regulating cell proliferation and positively modulating apoptosis. Loss of function of lats in Drosophila led to cell overproliferation and tumor-like outgrowth in mosaic flies through an upregulation of cyclin A and E expression [1,2,5,7]. Lats1-deficient mice spontaneously developed soft tissue sarcomas and ovarian stromal cell tumors [8]. * Corresponding author. Department of Genetics, Cell and Development Biology, University of Minnesota Medical School, Minneapolis, MMC716, 420 Delaware Street SE, MN 55455. Fax: +1-612-624-2436. E-mail address: [email protected] (W. Tao). 1 These two authors contributed equally to this work. 0014-4827/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2004.04.031

Ectopic expression of human Lats1 in human cancer cell lines suppressed tumorigenicity of these tumor cells [9,10]. Expression of exogenous Lats1 also inhibited cell proliferation and blocked the cell cycle at G2/M by downregulating expression of cyclin A and B, and CDC2 kinase activity [9]. Consistent with these findings, the kinase activity of endogenous CDC2, which is associated with LATS1 proteins in HeLa cells, has been shown to be dramatically reduced [5]. Lats2, also known as Kpm, is the second mammalian member of the novel lats tumor suppressor gene family [3,4,11]. The Lats2 gene has been mapped onto human chromosome 13q11 –12 [4], a hot spot (67%) for LOH in nonsmall cell lung cancer [12]. Expression of exogenous mouse Lats2 gene in v-ras-transformed NIH3T3 cells suppressed their abilities to develop tumors in athymic nude mice and to form colonies in soft agar [11]. Expression of exogenous Lats2 also inhibited cell proliferation [11,13]. Exogenous mouse Lats2 inhibited G1/S transition via downregulation of cyclin E/CDK2 kinase activity in NIH3T3/

330

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

v-ras cells [11]. Exogenous human Lats2 in HeLa cells inhibited G2/M transition by phosphorylating CDC25C and decreasing CDC2 kinase activity [13]. These results suggest that Lats2 may be a putative tumor suppressor that negatively regulates cell proliferation. Apoptosis plays an important role in the maintenance of homeostasis and the inhibition of tumorigenesis. Inactivation of lats in Drosophila results in an upregulation of DIAP, leading to a decrease of apoptosis during fly development [14,15]. Human Lats1 has been shown to induce apoptosis in multiple cancer cell lines by upregulating the level of the pro-apoptotic protein BAX [9] or increasing caspase-3 activity [10]. It has also been suggested that human Lats2 expression induces apoptosis in HeLa cells [13]. However, only limited experimental evidence specific for apoptosis was provided and the signaling cascade leading to apoptosis mediated by Lats2 was not addressed. Here, we provide definite experimental evidence demonstrating that adenovirus-mediated expression of Lats2 promotes apoptosis. Furthermore, we have partially characterized the Lats2-mediated apoptotic signaling cascade. We found that apoptosis induced by Lats2 in human lung cancer cell lines, A549 and H1299, was accompanied by downregulation of the proteins BCL-2 and BCL-xL followed by the activation of the caspase-9 cascade. Finally, we showed that overexpression of exogenous anti-apoptotic Bcl-2 or Bcl-xL in the cells suppressed Lats2-mediated caspase cleavage and apoptosis.

Material and methods Production of the replication-defective recombinant adenovirus A human Lats2 cDNA fragment containing the whole coding region was derived from human lung cancer cell line, H661, by RT-PCR using a 5V oligo: AAACTGGACTAACAATGAGGCCAAA and a 3V oligo: GATCCTCGAGGCCACGTACACCGGCTGGCA. The 3V oligo was based on the murine Lats2 nucleotide sequence that retained the amino acid sequence of human LATS2 protein on translation. The human Lats2 cDNA fragment and IRESEGFP fragment from plasmid MigR1 [16] or IRES-EGFP fragment were separately cloned into an adenovirus expression vector pAxACwt [17]. The replication-defective Lats2recombinant adenovirus, Ad-Lats2, and the control virus, Ad-EGFP, were generated using the COS-TPC method [17] according to the manufacturer’s protocol (Takara Shuzo, Biomedical Group). The viruses were amplified using a low passage 293 human embryonic kidney cell line. Creation of kinase-inactive Lats2 and transfection To generate the kinase-inactive Lats2 (Lats2-kd), lysine 697 in LATS2 was substituted with methionine via a sitedirected mutagenesis system (Promega). Lats2-kd or wt

Lats2 along with IRES-EGFP were cloned into the mammalian expression vector, pcDNA3.1, respectively. Transient transfection of high passage 293 cells was performed using LipofectinAmine 2000. Transfection efficiency was estimated based on EGFP co-expression. Cell culture Low passage 293 cells (from ATCC) were cultured in DMEM with 10% of fetal bovine serum. Human lung cancer cell lines, A549 and H1299, were gifts from Drs. David Kiang and Robert Kratzke, respectively, and were cultured in RPMI1640 with 10% calf bovine serum. A549 and H1299 cells were infected by adenovirus for 60 min in a small volume (e.g., 1 ml/10 cm dish). Establishment of Bcl-2 and Bcl-xL expressing stable cell lines Plasmids pcDNA3-Bcl-2 and pcDNA3-Bcl-xL were transfected into A549 and H1299 cells, respectively, using LipofectinAmin 2000, and transfectants were selected in G418 media (600 Ag/ml). The expression of BCL-2 and BCL-xL proteins was confirmed by Western blot. Assessment of cell death Annexin V binding assay A549 cells were infected by Ad-Lats2 or Ad-EGFP at MOI (multiplicity of infection) of 20 pfu/cell. Two days after virus infection, the adherent cells were harvested for the Annexin V binding assay using an Annexin V Assay kit from PharMingen, following manufacturer’s instructions. EGFP-positive (adenovirus-infected) cells were gated for further FACS analysis. H1299 cells were infected by viruses at MOI of 30 pfu/cell and harvested for Annexin V binding assay 3 days after infection. The data from FACS was analyzed with Cellquest software (Becton Dickinson). DNA fragmentation assay A549 cells (1  106) were infected by Ad-Lats2 or AdEGFP at MOI of 20 pfu/cell. Four days after virus infection, both floating and adherent cells were harvested and lysed in 400 Al of lysis buffer (50 mM Tris, pH 8.0, 100 mM EDTA, 0.5% SDS). Following the addition of 100 Al of 5 M NaCl, the cell lysate was centrifuged at 50 K rpm (TL-100 Ultracentrifuge, Beckman) for 30 min. Then, DNA was precipitated from the supernatant, separated on a 1.5% agarose gel, and photographed. H1299 cells (1  106) were infected by viruses at MOI of 30 pfu/cell and harvested for the assay 5 days after infection. Trypan blue exclusion assay A549/Bcl-2 and H1299/Bcl-xL stable cell lines and their controls cells were infected by Ad-Lats2 at MOI of 10 pfu/ cell. The numbers of live and dead cells were counted from duplicated dishes at various time points.

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

Caspase-9 activity assay Two (for A549) or three (for H1299) days after infection, the cells were harvested and caspase-9 activity in the lysates was determined using a colorimetric activity assay kit from R&D Systems (Cat. # BF10100). The protocol from the manufacturer was followed. Caspase inhibitor assay A549 or H1299 cells were incubated with 30 AM of caspase-3 inhibitors (z-DEVD-fmk or z-DQMD-fmk) or a caspase-9 inhibitor (z-LEHD-fmk) for 1 h before being infected with Ad-Lats2 at MOI of 10 pfu/cell. The infected cells were cultured in the media containing the caspase inhibitors. The media were changed once 2 days after virus infection. A trypan blue exclusion assay was used for assessing cell death 3.5 and 4.5 days after infection, respectively. All caspase inhibitors were purchased from Oncogene Inc. Western blot analyses Ad-Lats2 or control virus-transduced A549 or H1299 cells were harvested for Western blotting at indicated times. The harvested cells were lysed in TG buffer [5] with 1 mM PMSF and 1 complete proteinase inhibitors (Roche Molecular Biochemicals). Cell lysate proteins (30 – 150 Ag) were used for the Western blot. A polyclonal anti-PARP antibody (#1-835-238) was from Roche Molecular Biochemicals. Anti-caspase-3 (#9662), cleaved caspase-3 (Asp175) (#9661), caspase-6 (#9762), caspase-7 (#9492), caspase8 (#9746), and caspase-9 (#9502) were from Cell Signaling. Anti-BAX (554104) was from PharMingen. Anti-BCL-2 (N19, #sc-4920) and anti-h-ACTIN antibodies were from Santa Cruz. Anti-BCL-xL antibodies (13.6) have been described previously [18]. The anti-LATS2 monoclonal antibody (9B4) was a generous gift from Dr. Tian Xu at Yale University.

Results Lats2 recombinant adenovirus construction and dosage dependent expression To express the human Lats2 gene in human cancer cell lines, a cDNA fragment coding for the entire human Lats2 ORF was derived from a human lung cancer cell line H661 by RT-PCR and confirmed by DNA sequencing. Sequencing data showed that the Lats2 cDNA we obtained differs from the reported human Kpm (Lats2) sequence [3] by five nucleotides, but the translation product differs only by a single residue. The three nucleotide changes, at positions 1832 (C-A), 1922 (G-A), and 2177 (C-A), are due to either a polymorphism in the human Lats2 gene or errors from RT-

331

PCR. A change at position 3629 (T-G) is the result from the designed PCR oligonucleotides. These four nucleotide changes do not affect the amino acid sequence of the human LATS2 protein. However, replacement of T with C at nucleotide 2506 results in an amino acid change at residue 710 from valine to alanine. We conclude that our human Lats2 sequence is correct, because nucleotide 2506 in the human genomic sequence of Lats2 is also a C (GenBank #NT 009799), and the murine LATS2 protein harbors an alanine at the same position [4]. This human Lats2 cDNA fragment was used to generate a replication-deficient Lats2 recombinant adenovirus, AdLats2 (Fig. 1A and Materials and methods). The Lats2 and EGFP are co-expressed as a bicistron, separated by IRES. Co-expression of EGFP and Lats2 enabled us to easily monitor the Ad-Lats2-transduced cell in further analyses. In addition, a control virus, Ad-EGFP, was similarly generated (Fig. 1A and Materials and methods). Dosage-dependent expression of the LATS2 protein in human lung cancer cell lines, A549 and H1299, was confirmed by an anti-LATS2 antibody (Fig. 1B). Endogenous LATS2 proteins in A549 and H1299 cells are detectable if more total protein (> 100 Ag) of the cell lysate is used for Western blot (data not shown). Expression of exogenous human Lats2 in both A549 and H1299 cells caused a large number of the cells to detach from the culture dish and gradually die, suggesting that expression of exogenous human Lats2 may induce apoptosis. Ectopic expression of human Lats2 induces apoptosis DNA fragmentation is a hallmark of apoptosis. To examine whether expression of Lats2 induced DNA laddering, genomic DNA was extracted from Ad-Lats2-transduced cells and control cells. Genomic DNA extracted from Ad-Lats2transduced A549 and H1299, but not from control cells, was heavily fragmented and formed a DNA ladder following agarose gel electrophoresis (Fig. 2A). Subsequently, we determined whether PARP, a 116 kDa nuclear chromatinassociated enzyme, was cleaved in Ad-Lats2-transduced A549 and H1299 cells. Cleavage of the 116 kDa PARP into 85 and 25 kDa fragments by caspase protease activity is one of molecular markers of apoptosis. As shown in Fig. 2B, expression of exogenous human Lats2 in A549 and H1299 cells induced cleavage of PARP. Ad-Lats2-transduced cells were also examined for Annexin V uptake, an early indicator of apoptosis. Two days after virus infection, adherent cells were harvested and stained with Annexin V and 7AAD. The assay revealed that in 48 h about 46% of Ad-Lats2-transduced A549 cells were Annexin V-positive and 7AADnegative, demonstrating that these cells were at an early stage of apoptosis. At the same time, only approximately 1% of the control virus (Ad-EGFP)-infected cells were in early apoptosis (Fig. 2C, top panel). Similar results were obtained from H1299 cells 3 days after virus infection (Fig. 2C, lower panel). These results demonstrate that expression of Lats2 induces apoptosis in human lung cancer cells.

332

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

Fig. 1. Human Lats2 recombinant adenovirus construction and dosage-dependent expression. (A) The schematic drawing represents a replication-defective Lats2 recombinant adenovirus, Ad-Lats2, and the control virus, Ad-EGFP. (B) Dosage-dependent expression of human LATS2 protein in human lung cancer cell lines. A549 and H1299 were infected by Ad-Lats2 at indicated MOI and harvested 2 days after virus infection for Western blot using a monoclonal antiLATS2 antibody (9B4). Arrows indicate the degraded LATS2 proteins. h-ACTIN was used as the loading control. ITR: inverted terminal repeat; Pcmv: early promoter from CMV virus, IRES: internal ribosome enter site.

Caspases-3, 7, and 9 are processed during Lats2-induced apoptosis Cleavage of PARP is a clear indicator of the activation of the caspase cascade [19]. To confirm the involvement of caspases in Lats2-mediated apoptosis, we examined the activation status of caspases in Ad-Lats2-transduced cells by Western blot. Caspases exist as inactive forms, procaspases or zymogens, in non-apoptotic cells. After a cell is stimulated by an apoptotic signal, procaspases are cleaved at specific sites resulting in their activation. Caspases-3 and 7, two effector caspases that are responsible for the cleavage of PARP, as well as caspase-9, an initiator caspase, are cleaved in Ad-Lats2-transduced A549 and H1299 cells (Fig. 3A). Caspase-7 and 9 are cleaved in 293 cells as well when transfected with human Lats2 but are not cleaved when transfected with kinase-inactive Lats2 (Lats2-kd) (Fig. 3B). The cleavage of PARP and caspases 3, 7, and 9 in Ad-Lats2transduced cells demonstrated that expression of exogenous Lats2 results in activation of the caspase cascade. To further confirm that expression of exogenous Lats2 results in the activation of the caspase cascade, we performed caspase-9 activity assays. Our results show that the activity of caspase-9 is dramatically increased in Lats2-

transduced A549 and H1299 cells compared with control virus-transduced cells (Fig. 3C). We have also determined whether the inhibition of caspase activity blocks or inhibits Lats2-induced apoptosis. As shown in Fig. 3D, treatment of A549 cells with caspase-3 inhibitors, z-DEVD-fmk and z-DQMD-fmk, greatly reduced Lats2-induced apoptosis. z-DEVD-fmk, which is also known to inhibit additional caspases such as caspase-7 and 8 [20], was more effective than the highly specific caspase-3-specific inhibitor, z-DQMD-fmk [21]. The caspase-9 inhibitor, z-LEHD-fmk [22], also reduced apoptosis induced by Lats2 in A549 cells significantly (Fig. 3D). Treatment of H1299 cells with the same caspase inhibitors gave similar results (data not shown). These data demonstrate that the activation of caspases is required for Lats2-mediated apoptosis and suggest that multiple caspases are involved in Lats2-mediated apoptosis in lung cancer cells. Bcl-2 and Bcl-xL are downregulated in Ad-Lats2-transduced cells The pro-apoptotic Bcl-2 family protein, BAX, and antiapoptotic proteins, BCL-2 and BCL-xL, play important roles in the regulation of apoptosis [23]. Upregulation of

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

333

Fig. 2. Expression of exogenous human Lats2 induces apoptosis. (A) Genomic DNA fragmentation in Lats2-transduced human lung cancer cells. Genomic DNA was extracted from Ad-Lats2 or control virus-transduced cells 4 days (for A549) or 5 days (for H1299) after virus infection, and separated on a 1.5% agarose gel as described in Materials and methods. (B) Lats2-induced cleavage of PARP nuclear protein. Ad-Lats2 or control virus-transduced A549 and H1299 were respectively harvested for Western blot with anti-PARP antibodies 2 or 3 days after virus infection. Full-length PARP (116 kDa) and its cleavage product (85 kDa) were indicated by molecular weight. Arrow indicates a specific band recognized by anti-PARP antibodies. Its identity is not clear (see Discussion). The MOI used in this experiment was 20 pfu/cell for A549 and 30 pfu/cell for H1299. (C) Flow cytometric analysis of Annexin V uptake in adherent Ad-Lats2 or control virus-transduced A549 or H1299 cells, 2 days (for A549) or 3 days (for H1299) after virus infection.

Bcl-2 and/or Bcl-xL is a frequent occurrence in various human tumors where they protect tumor cells from apoptosis induced by different cytotoxic stimuli. Targeted downregulation of Bcl-2 and/or Bcl-xL by antisense oligos induced apoptosis without additional apoptotic stimuli in variety of human tumor cells [24 –30]. To determine the mechanism(s) by which expression of exogenous Lats2 induces apoptosis, we performed Western blot analyses to examine whether expression of Lats2 affected expression of BAX, BCL-2, and BCL-xL proteins. Results in Fig. 4A show no significant difference in the BAX protein level between Ad-Lats2 and control virus-transduced cells. However, the levels of two anti-apoptotic proteins, BCL2 and BCL-xL, are significantly downregulated in AdLats2-transduced H1299 cells (Fig. 4A, right panel). Similarly, the protein level of BCL-xL was also significantly decreased in Lats2-transduced A549 cells while the level of endogenous BCL-2 protein is too low to be detected (Fig. 4A, left panel). The expression of Bcl-2 is also downregulated in 293 cells transfected with human Lats2 but not with Lats2-kd (Fig. 4B). These findings, together with previous published data that downregulation of antiapoptotic signals in human cancer cells is sufficient to induce apoptosis without additional apoptotic stimuli [24 – 30], suggest that Lats2-induced apoptosis in human lung cancer cell lines may result from Lats2-mediated downregulation of Bcl-2 and Bcl-xL (for more detailed analysis, please see Discussion).

Expression of exogenous Bcl-2 or Bcl-xL blocked Lats2-mediated apoptosis To test the possibility that Lats2-transduced cells enter apoptosis due to Lats2-mediated downregulation of antiapoptotic signals in cells, we examined whether expression of exogenous anti-apoptotic Bcl-2 family proteins will block Lats2-mediated apoptosis. We established A549/Bcl-2 stable cell lines, in which Bcl-2 is expressed under the control of a CMV promoter. Similarly, H1299/Bcl-xL stable cell lines were also established. Expression of exogenous Bcl-2 and Bcl-xL in these stable cell lines was confirmed by Western blot (Fig. 5A). Results showed that overexpression of Bcl-2 in A549 cells or Bcl-xL in H1299 cells blocked Lats2induced apoptosis (Figs. 5C and D). Furthermore, Lats2mediated cleavage of caspases-3, 7, and 9 in A549/Bcl-2 stable cell lines was also completely blocked (Fig. 5B). Similar results were obtained for H1299/Bcl-xL stable cell lines (Fig. 6B and data not shown). Lats2 induces apoptosis through activating the caspase-9 cascade Two major pathways of apoptosis, the death receptor pathway and stress pathway, have been identified to date [23]. The stress pathway takes the mitochondrial route and initiates the caspase cascade by activating caspase-9, whereas the death receptor pathway can follow either a mitochon-

334

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

Fig. 3. Human Lats2 induces apoptosis by activating a caspase cascade. (A) Expression of Lats2 results in the cleavage of procaspase-3, 7, and 9. A549 cells were infected with Ad-Lats2 and control virus Ad-EGFP (MOI of 20 pfu/cell) and harvested 2.5 days after infection for Western blot analyses. Similar experiments were performed using H1299 cells with a higher MOI (30 pfu/cell) and the cells were harvested at 3.5 days after infection. Arrow indicates a specific band recognized by anti-caspase-7 antibody and its identity is not clear (see Discussion). (B) Kinase-inactive Lats2 (Lats2-kd) does not mediate the cleaving procaspases. 293 cells were transiently transfected with either Lats2, Lats2-kd, or vector alone as indicated resulting in approximately 50% cell transfection. Thirty-six hours after transfection, the cells were harvested for Western blot with anti-caspase-7 and caspase-9 antibodies separately. (C) Caspase-9 activity assay. A549 and H1299 cells were infected with Ad-Lats2 or control virus Ad-EGFP (MOI of 15 pfu/cell) and were harvested 2 days (for A549) or 3 days (for H1299) after virus infection. Two hundreds Ag of cell lysate protein were used for caspase-9 activity assay. The results are the average of two the independent experiments. (D) Caspase inhibitors delay Lats2-mediated apoptosis. The A549 cells were treated with either z-DEVD-fmk (30 AM), z-DQMDfmk (30 AM), or z-LEHD-fmk (30 AM) for 1 h before virus infection (MOI of 10 pfu/cell). Following infection, Ad-Lats2-infected cells were cultured in media containing caspase inhibitors, and the percentage of dead cells were determined at the indicated time points by a trypan blue exclusion assay. A549 cells treated with DMSO (solvent) alone were also included as a control. The experiments were each repeated three times.

drial or a non-mitochondrial pathway, but caspase-8 is always activated before mitochondrial events [23,31]. Under these conditions, initiator caspase-9 is activated through caspase-8-mediated cleavage of the Bcl-2 family protein, BID, which translocates to the mitochondria and promotes the release of cytochrome c [32,33]. To investigate whether caspase-8 is involved as an initiator in Lats2-induced apoptosis in lung cancer cells, its processing was examined by Western blot. As shown in Fig. 6A, caspase-8 was cleaved in Ad-Lats2-transduced A549 and H1299 cells. Furthermore, we found that cleavage of both initiators, caspase-8 and 9, could be detected 36 h after Ad-Lats2 infection and became much more prominent 12 h later (Fig. 6A). Initiator caspase-8 is activated at DISC in the death receptor pathway [23,31], but it also can be activated in a caspase-9-dependent manner in the stress pathway [34].

Overexpression of Bcl-xL can inhibit death receptor activated apoptosis in the mitochondria-dependent pathway, but the processing of caspase-8 at the DISC cannot be blocked by Bcl-xL [35]. Due to limited sensitivity, Western blot analyses did not allow us to determine which of the initiator caspases was activated first during Lats2-induced apoptosis. We showed that exogenous Bcl-2 or Bcl-xL blocked Lats2induced apoptosis and processing of caspases-3, 7, and 9 (Fig. 5B). If cleavage of caspase-8 was independent of the activation of the caspase-9 cascade, processing of caspase8 should not be blocked by Bcl-2 or Bcl-xL in Ad-Lats2transduced cells. However, we observed that processing of caspase-8 was also blocked when Lats2-mediated caspase-9 cleavage was inhibited in A549/Bcl-2 and H1299/Bcl-xL stable cell lines (Fig. 6B). These results demonstrate that Lats2 induces apoptosis in human lung cancer cells through

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

Fig. 4. Lats2 downregulates the level of anti-apoptotic proteins of the Bcl-2 family. The levels of BCL-2 and BCL-xL were downregulated in A549 and H1299 cells transduced by Ad-Lats2 (A), as well as in 293 cells transfected with Lats2, but not with Lats2-kd (B). A549 cells were infected with AdLats2 or control virus at MOI of 20 pfu/cell and harvested 2.5 days after infection for Western blot analysis. Similar experiments were performed with H1299 cells using a higher MOI (30 pfu/cell) and the cells were harvested at 3.5 days after infection. Transient transfection of 293 cells was described in Fig. 3B. The amount of cell lysate protein used for each Western blot was 10 Ag for BAX and 30 Ag for BCL-2 and BCL-xL. hACTIN was used as the loading control.

activation of initiator caspase-9 and activation of caspase8 is the secondary effect of activation of the caspase cascade.

Discussion We have been investigating the mechanisms by which Lats2 functions as a putative tumor suppressor. In this study, we demonstrate specific apoptotic phenotypes, include genomic DNA-laddering (Fig. 2A), PARP cleavage (Fig. 2B), and Annexin V up-taking (Fig. 2C), in human lung cancer cells (A549 and H1299) following adenovirus-mediated exogenous Lats2 expression. Furthermore, we have demonstrated that expression of exogenous Lats2 downregulates both anti-apoptotic proteins, BCL-2 and BCL-xL (Fig. 4), and results in the specific activation of the caspase-9 cascade (Figs. 3 and 6). Consistent with the observation that expression of Lats2-kd does not induce apoptosis [13], we further demonstrated that expression of exogenous Lats2-kd causes neither downregulation of Bcl-2 (Fig. 4B) nor procaspase cleavage (Fig. 3B). These results suggest that LATS2 kinase activity is required for the induction of apoptosis. In Fig. 2C, the anti-PARP antibody detected an additional band between full-length and cleaved PARP in both control virus and Lats2 transduced A549 cells, as well as in Lats2-transduced H1299 cell (lane 4 in Fig. 2B). This is

335

likely to be a nonspecific band resulting from a crossreaction with the anti-PARP antibodies because it was present in control A549 cells as well. However, we cannot rule out the possibility that this band is an intermediate cleavage product of PARP in H1299 cells. A similar phenomenon was also observed in Western blots with anti-caspase-7 antibodies (Figs. 3A and B). Bcl-2 and Bcl-xL are inhibitors of apoptosis that are frequently overexpressed in various human tumors. Targeted downregulation of Bcl-2 by antisense oligonucleotides induced apoptosis in freshly isolated acute myelogenous leukemia cells [25] and in established lymphoma, lung, and prostate cancer cell lines [24,28,29]. Downregulation of Bcl-xL also resulted in apoptosis in lung cancer cells such as A549 and H125 [30], in which Bcl-xL is more prevalent. Targeted downregulation of Bcl-xL did not have an effect in cells in which both Bcl-2 and Bcl-xL were upregulated. However, simultaneous downregulation of both Bcl-2 and Bcl-xL by bispecific oligonucleotides induced apoptosis. This has been demonstrated in a variety of tumor cell lines, including lung cancer, breast cancer, colon cancer, and glioma [26,27,30]. All these previous findings demonstrate that downregulation of anti-apoptotic signals is sufficient to induce apoptosis without additional apoptotic stimuli in a variety of human cancer cells. We have now shown that expression of exogenous Lats2 downregulates the expression of both Bcl-2 and Bcl-xL (Fig. 4) and expression of exogenous Bcl-2 or Bcl-xL blocks Lats2-mediated caspase cleavage (Fig. 5B) and apoptosis (Figs. 5C and D). These findings strongly indicate that Lats2 acts upstream of Bcl-2 in the survival signal transduction pathway. Based on our findings as well as previously published data as described above, we propose that expression of exogenous human Lats2 induces apoptosis in human lung cancer cells through downregulating Bcl-2 and Bcl-xL. Our Real Time RT-PCR analyses revealed that expression of exogenous Lats2 in A549 and H1299 cells did not have obvious effects on the levels of Bcl-2 and Bcl-xL mRNA (data not shown). The antiapoptotic function of BCL-2 can be regulated by its phosphorylation status [36]. Phosphorylation is also implicated in mechanisms in which cleavage of BCL-2 occurs [37]. LATS2 is a putative Ser/Thr protein kinase [3,4,11]. Thus, it could be possible that Lats2 downregulates levels of BCL2 and BCL-xL proteins by directly or indirectly affecting the phosphorylation status of these proteins. Lats1 tumor suppressor has been shown to promote apoptosis by upregulating the level of BAX protein [9]. While the level of BAX protein in Lats2-transduced cells was not affected, we have shown that the levels of BCL-2 and BCL-xL proteins were downregulated in apoptotic human lung cancer cells that were induced by Ad-Lats2 (Fig. 4). Therefore, the mechanisms by which Lats1 and Lats2 regulate apoptosis in mammalian cells are different, although both are pro-apoptotic. Although both initiator caspase-8 and 9 were cleaved in Ad-Lats2-transduced A549 and H1299 cells (Fig. 6A),

336

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

Fig. 5. Expression of exogenous Bcl-2 and Bcl-xL blocks Lats2-mediated apoptosis. (A) Expression of exogenous Bcl-2 and Bcl-xL in A549 and H1299 cells. Top panel: Western blot of A549 and its derivative cell lines showing Bcl-2 expression. Bottom panel: Western blot of H1299 and its derivative cell lines showing Bcl-xL expression. Although endogenous BCL-xL protein is easily detectable in H1299 and H1299/pCDNA3 cell lines, its expression is much weaker compared with the two Bcl-xL expressing stable cell lines. h-Actin was used as the loading control. (B) Expression of exogenous Bcl-2 blocked the cleavage of procaspases-3, 7, and 9. Bcl-2 expressing stable cell lines and control cell lines (A549 and A549/pCDNA3) were infected by Ad-Lats2 (MOI of 15 pfu/cell). Two days after infection, 150 Ag of cell lysate protein was processed for Western blot with anti-caspase-3, anti-caspase-7, and caspase-9 antibodies, respectively. (C and D) Trypan blue dye exclusion assays show that expression of exogenous Bcl-2 or Bcl-xL blocks Lats2-mediated apoptosis. A549/Bcl-2 stable cell lines and controls were infected with Ad-Lats2 (MOI of 10 pfu/cell) and viable and dead cells were counted at indicated time points. The values indicated on the y axis are the mean F SD of the percentage of viable cells from three independent experiments that were each performed in duplicate (C). Similar experiments were performed using H1299/Bcl-xL stable cell lines and corresponding controls (D).

blockage of caspase-9 cleavage by BCL-2 or BCL-xL in Ad-Lats2-transduced cells led to an inability of processing of caspase-8 in the same cells (Fig. 6B). These results indicate that caspase-8 acts downstream of caspase-9 in Lats2-induced apoptosis in human lung cancer cell lines and the activation of caspase-8 may play a role in the feedback loop of caspase activation as suggested by Slee et al [34]. Caspase-6 is the direct activator of caspase-8 and its cleavage is required for the activation of caspase-8 in Jurkat cells [38]. However, we have failed to detect any cleavage

product of procaspase-6 in Western blot analyses in AdLats2-transduced A549 and H1299 cells (data not shown), suggesting that activation of caspase-6 is not required to cleave caspase-8 in Lats2-induced apoptosis in human lung cancer cell lines. The caspase that cleaves caspase-8 following the activation of caspase-9 in lung cancer cells remains to be identified. The tumor suppressor p53 plays an important role in the regulation of apoptosis [39,40]. The role of p53 in lats tumor suppressor-mediated apoptosis is, however, contro-

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338

337

Fig. 6. Initiator caspase-9, not caspase-8, mediates Lats2-induced apoptosis. (A) Both initiator caspases-8 and 9 were processed in Ad-Lats2-transduced cells. A549 and H1299 cells were infected with Ad-Lats2 or control virus Ad-EGFP (MOI of 15 pfu/cell). They were harvested for examination of caspase cleavage by Western blot at the indicated times after virus infection. (B) Cleavages of both caspase-8 and 9 are blocked in Bcl-2 and Bcl-xL expressing stable cell lines. The experiments were performed as described in Fig. 5B with the exception that lysates were blotted with anti-caspase-8 and anti-caspase-9 antibodies, respectively.

versial. Based on studies showing that human Lats1-mediated apoptosis was only observed in cells expressing wildtype p53 (A549, HCT116 and MCF-7) but not in p53deficient cells and on studies indicating that the level of the p53 protein was increased in Lats1-transduced HCT116 cells, Yang et al. [10] proposed that Lats1-mediated apoptosis might be p53-dependent. However, expression of Lats1 in MCF-7 cells did not have an effect on p53 protein levels [9]. The p53 is wild type in A549 cells [41] and null in H1299 cells [42]. Expression of exogenous human Lats2 induced apoptosis in both these cell lines (Fig. 2) but did not cause a change in p53 protein levels in A549 cells (data not shown). Therefore, our studies indicate that at least Lats2mediated apoptosis is p53-independent. In conclusion, our data indicate that human Lats2, in addition to its negative regulation of cell proliferation, may control human tumor cell survival by negatively modulating anti-apoptotic signals.

Acknowledgments We are grateful to Dr. Catherine Verfaillie for her support and helpful advice for this research. We thank Dr. Tian Xu at Yale University for the anti-LATS2 antibody, and Dr. Robert Kratzke and David Kiang for the human lung cancer cell lines, H1299 and A549. Sandy Johnson and John D. Andersen are acknowledged for editing. We also thank

Gregory Veltri and Janet Peller with their assistance for FACS and data analyses. This work is supported by a Research Scholar Grant from the American Cancer Society (RSG-02-065-01-MGO) and a Career Development Award from American Lung Association (CI-003-N) to W. Tao.

References [1] T. Xu, W. Wang, S. Zhang, R.A. Stewart, W. Yu, Identifying tumor suppressors in genetic mosaics: the Drosophila lats gene encodes a putative protein kinase, Development 121 (1995) 1053 – 1063. [2] R.W. Justice, O. Zilian, D.F. Woods, M. Noll, P.J. Bryant, The Drosophila tumor suppressor gene warts encodes a homolog of human myotonic dystrophy kinase and is required for the control of cell shape and proliferation, Genes Dev. 9 (1995) 534 – 546. [3] T. Hori, A. Takaori-Kondo, Y. Kamikubo, T. Uchiyama, Molecular cloning of a novel human protein kinase, kpm, that is homologous to warts/lats, a Drosophila tumor suppressor, Oncogene 19 (2000) 3101 – 3109. [4] N. Yabuta, T. Fujii, N.G. Copeland, D.J. Gilbert, N.A. Jenkins, H. Nishiguchi, Y. Endo, S. Toji, H. Tanaka, Y. Nishimune, H. Nojima, Structure, expression, and chromosome mapping of LATS2, a mammalian homologue of the Drosophila tumor suppressor gene lats/ warts, Genomics 63 (2000) 263 – 270. [5] W. Tao, S. Zhang, G.S. Turenchalk, R.A. Stewart, M.A. St. John, W. Chen, T. Xu, Human homologue of the Drosophila melanogaster lats tumour suppressor modulates CDC2 activity, Nat. Genet. 21 (1999) 177 – 181. [6] Y. Nishiyama, T. Hirota, T. Morisaki, T. Hara, T. Marumoto, S. Iida, K. Makino, H. Yamamoto, T. Hiraoka, N. Kitamura, H. Saya, A human homolog of Drosophila warts tumor suppressor, h-warts, lo-

338

[7]

[8]

[9]

[10]

[11] [12]

[13]

[14]

[15]

[16]

[17]

[18]

[19] [20]

[21]

[22]

[23] [24]

H. Ke et al. / Experimental Cell Research 298 (2004) 329–338 calized to mitotic apparatus and specifically phosphorylated during mitosis, FEBS Lett. 459 (1999) 159 – 165. N. Tapon, K.F. Harvey, D.W. Bell, D.C. Wahrer, T.A. Schiripo, D.A. Haber, I.K. Hariharan, Salvador Promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines, Cell 110 (2002) 467 – 478. M.A. St. John, W. Tao, X. Fei, R. Fukumoto, M.L. Carcangiu, D.G. Brownstein, A.F. Parlow, J. McGrath, T. Xu, Mice deficient of Lats1 develop soft-tissue sarcomas, ovarian tumours and pituitary dysfunction, Nat. Genet. 21 (1999) 182 – 186. H. Xia, H. Qi, Y. Li, J. Pei, J. Barton, M. Blackstad, T. Xu, W. Tao, LATS1 tumor suppressor regulates G2/M transition and apoptosis, Oncogene 21 (2002) 1233 – 1241. X. Yang, D.M. Li, W. Chen, T. Xu, Human homologue of Drosophila lats, LATS1, negatively regulate growth by inducing G(2)/M arrest or apoptosis, Oncogene 20 (2001) 6516 – 6523. Y. Li, J. Pei, H. Xia, H. Wang, W. Tao, Lats2, a putative tumor suppressor, inhibits G1/S transition, Oncogene 22 (2003) 4398 – 4405. L. Girard, S. Zochbauer-Muller, A.K. Virmani, A.F. Gazdar, J.D. Minna, Genome-wide allelotyping of lung cancer identifies new regions of allelic loss, differences between small cell lung cancer and non-small cell lung cancer, and loci clustering, Cancer Res. 60 (2000) 4894 – 4906. Y. Kamikubo, A. Takaori-Kondo, T. Uchiyama, T. Hori, Inhibition of cell growth by conditional expression of kpm, a human homologue of Drosophila warts/lats tumor suppressor, J. Biol. Chem. 278 (2003) 17609 – 17614. K.F. Harvey, C.M. Pfleger, I.K. Hariharan, The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis, Cell 114 (2003) 457 – 467. S. Wu, J. Huang, J. Dong, D. Pan, Hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts, Cell 114 (2003) 445 – 456. W.S. Pear, J.P. Miller, L. Xu, J.C. Pui, B. Soffer, R.C. Quackenbush, A.M. Pendergast, R. Bronson, J.C. Aster, M.L. Scott, D. Baltimore, Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow, Blood 92 (1998) 3780 – 3792. S. Miyake, M. Makimura, Y. Kanegae, S. Harada, Y. Sato, K. Takamori, C. Tokuda, I. Saito, Efficient generation of recombinant adenoviruses using adenovirus DNA-terminal protein complex and a cosmid bearing the full-length virus genome, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 1320 – 1324. A.J. Minn, C.S. Kettlun, H. Liang, A. Kelekar, M.G. Vander Heiden, B.S. Chang, S.W. Fesik, M. Fill, C.B. Thompson, Bcl-xL regulates apoptosis by heterodimerization-dependent and -independent mechanisms, EMBO J. 18 (1999) 632 – 643. C. Kohler, S. Orrenius, B. Zhivotovsky, Evaluation of caspase activity in apoptotic cells, J. Immunol. Methods 265 (2002) 97 – 110. M. Garcia-Calvo, E.P. Peterson, B. Leiting, R. Ruel, D.W. Nicholson, N.A. Thornberry, Inhibition of human caspases by peptide-based and macromolecular inhibitors, J. Biol. Chem. 273 (1998) 32608 – 32613. H. Hirata, A. Takahashi, S. Kobayashi, S. Yonehara, H. Sawai, T. Okazaki, K. Yamamoto, M. Sasada, Caspases are activated in a branched protease cascade and control distinct downstream processes in Fas-induced apoptosis, J. Exp. Med. 187 (1998) 587 – 600. N.A. Thornberry, T.A. Rano, E.P. Peterson, D.M. Rasper, T. Timkey, M. Garcia-Calvo, V.M. Houtzager, P.A. Nordstrom, S. Roy, J.P. Vaillancourt, K.T. Chapman, D.W. Nicholson, A combinatorial approach defines specificities of members of the caspase family and granzyme B. Functional relationships established for key mediators of apoptosis, J. Biol. Chem. 272 (1997) 17907 – 17911. S. Cory, J.M. Adams, The Bcl2 family: regulators of the cellular lifeor-death switch, Nat. Rev., Cancer 2 (2002) 647 – 656. G.J. Berchem, M. Bosseler, L.Y. Sugars, H.J. Voeller, S. Zeitlin, E.P. Gelmann, Androgens induce resistance to bcl-2-mediated apoptosis in LNCaP prostate cancer cells, Cancer Res. 55 (1995) 735 – 738.

[25] L. Campos, O. Sabido, J.P. Rouault, D. Guyotat, Effects of BCL-2 antisense oligodeoxynucleotides on in vitro proliferation and survival of normal marrow progenitors and leukemic cells, Blood 84 (1994) 595 – 600. [26] O. Gautschi, S. Tschopp, R.A. Olie, S.H. Leech, A.P. Simoes-Wust, A. Ziegler, B. Baumann, B. Odermatt, J. Hall, R.A. Stahel, U. Zangemeister-Wittke, Activity of a novel bcl-2/bcl-xL-bispecific antisense oligonucleotide against tumors of diverse histologic origins, J. Natl. Cancer Inst. 93 (2001) 463 – 471. [27] Z. Jiang, X. Zheng, K.M. Rich, Down-regulation of Bcl-2 and Bcl-xL expression with bispecific antisense treatment in glioblastoma cell lines induce cell death, J. Neurochem. 84 (2003) 273 – 281. [28] S. Kitada, T. Miyashita, S. Tanaka, J.C. Reed, Investigations of antisense oligonucleotides targeted against bcl-2 RNAs, Antisense Res. Dev. 3 (1993) 157 – 169. [29] A. Ziegler, G.H. Luedke, D. Fabbro, K.H. Altmann, R.A. Stahel, U. Zangemeister-Wittke, Induction of apoptosis in small-cell lung cancer cells by an antisense oligodeoxynucleotide targeting the Bcl-2 coding sequence, J. Natl. Cancer Inst. 89 (1997) 1027 – 1036. [30] U. Zangemeister-Wittke, S.H. Leech, R.A. Olie, A.P. Simoes-Wust, O. Gautschi, G.H. Luedke, F. Natt, R. Haner, P. Martin, J. Hall, C.M. Nalin, R.A. Stahel, A novel bispecific antisense oligonucleotide inhibiting both bcl-2 and bcl-xL expression efficiently induces apoptosis in tumor cells, Clin. Cancer Res. 6 (2000) 2547 – 2555. [31] W.C. Earnshaw, L.M. Martins, S.H. Kaufmann, Mammalian caspases: structure, activation, substrates, and functions during apoptosis, Annu. Rev. Biochem. 68 (1999) 383 – 424. [32] H. Li, H. Zhu, C.J. Xu, J. Yuan, Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis, Cell 94 (1998) 491 – 501. [33] X. Luo, I. Budihardjo, H. Zou, C. Slaughter, X. Wang, Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors, Cell 94 (1998) 481 – 490. [34] E.A. Slee, M.T. Harte, R.M. Kluck, B.B. Wolf, C.A. Casiano, D.D. Newmeyer, H.G. Wang, J.C. Reed, D.W. Nicholson, E.S. Alnemri, D.R. Green, S.J. Martin, Ordering the cytochrome c-initiated caspase cascade: hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-dependent manner, J. Cell Biol. 144 (1999) 281 – 292. [35] A.H. Stegh, B.C. Barnhart, J. Volkland, A. Algeciras-Schimnich, N. Ke, J.C. Reed, M.E. Peter, Inactivation of caspase-8 on mitochondria of Bcl-xL-expressing MCF7-Fas cells: role for the bifunctional apoptosis regulator protein, J. Biol. Chem. 277 (2002) 4351 – 4360. [36] M.V. Blagosklonny, Unwinding the loop of Bcl-2 phosphorylation, Leukemia 15 (2001) 869 – 874. [37] Y.H. Ling, L. Liebes, B. Ng, M. Buckley, P.J. Elliott, J. Adams, J.D. Jiang, F.M. Muggia, R. Perez-Soler, PS-341, a novel proteasome inhibitor, induces Bcl-2 phosphorylation and cleavage in association with G2-M phase arrest and apoptosis, Mol. Cancer Ther. 1 (2002) 841 – 849. [38] V. Cowling, J. Downward, Caspase-6 is the direct activator of caspase-8 in the cytochrome c-induced apoptosis pathway: absolute requirement for removal of caspase-6 prodomain, Cell Death Differ. 9 (2002) 1046 – 1056. [39] Y. Shen, E. White, p53-dependent apoptosis pathways, Adv. Cancer Res. 82 (2001) 55 – 84. [40] J.J. Manfredi, p53 and apoptosis: it’s not just in the nucleus anymore, Mol. Cell 11 (2003) 552 – 554. [41] T.A. Lehman, W.P. Bennett, R.A. Metcalf, J.A. Welsh, J. Ecker, R.V. Modali, S. Ullrich, J.W. Romano, E. Appella, J.R. Testa, et al, p53 mutations, ras mutations, and p53-heat shock 70 protein complexes in human lung carcinoma cell lines, Cancer Res. 51 (1991) 4090 – 4096. [42] S.M. Bodner, J.D. Minna, S.M. Jensen, D. D’Amico, D. Carbone, T. Mitsudomi, J. Fedorko, D.L. Buchhagen, M.M. Nau, A.F. Gazdar, et al, Expression of mutant p53 proteins in lung cancer correlates with the class of p53 gene mutation, Oncogene 7 (1992) 743 – 749.