Quantitative patterns of expression of gap junction genes during in vivo or in vitro development of ovarian follicles in sheep

Small Ruminant Research 143 (2016) 35–42

Contents lists available at ScienceDirect

Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres

Quantitative patterns of expression of gap junction genes during in vivo or in vitro development of ovarian follicles in sheep V. Praveen Chakravarthi a , S.S.R. Kona b , A.V.N. Siva Kumar b , M. Bhaskar a , V.H. Rao b,∗ a b

Department of Biotechnology and Department of Zoology, Sri Venkateswara University, Tirupati, India Embryo Biotechnology Laboratory, Department of Physiology, College of Veterinary Science, S.V. Veterinary University, Tirupati 517502, India

a r t i c l e

i n f o

Article history: Received 11 April 2016 Received in revised form 29 June 2016 Accepted 15 August 2016 Available online 16 August 2016 Keywords: Gap junctions Preantral follicles Sheep In vitro culture CX32 CX43

a b s t r a c t Expression of gap junction genes CX32 and Cx43 was studied in different stages of in vivo and cultured ovarian follicles in sheep. In the in vivo grown follicles, CX43 expression in the cumulus cells did not change with development but in the oocytes a significant decrease was noted in the early antral follicles. Although CX32 expression in the cumulus cells appeared to decrease continuously, it was significant only from early antral to antral follicles. However, Cx32 expression in oocytes showed an increasing pattern although the increase from early antral to antral stage was not significant. In the cultured follicles CX43 expression in cumulus cells decreased significantly from preantral to early antral follicles, then increased significantly at the antral stage and decreased again in the large antral follicles. The pattern of CX32 expression was similar except for the significant decrease observed with CX43 expression in the large antral follicles. In the oocytes CX43 expression increased significantly from preantral to early antral stage, and decreased significantly at antral and large antral stages. On the other hand CX32 expression increased significantly from early antral to antral follicle stage and then decreased significantly in the large antral follicles. Subsequent to in vitro maturation for 24 h of COCs from in vivo grown large antral follicles, CX43 expression was supressed both in the cumulus cells and oocytes but CX32 expression was compromised only in the oocytes. In the similarly treated COCs’ from in vitro grown large antral follicles, CX43 expression was stimulated both in the cumulus cells and oocytes but CX32 expression was augmented only in the cumulus cells. It is concluded that (i) the gap junction genes follow a stage specific pattern of expression during ovarian follicular development and (ii) in vitro culture adversely influenced the expression of the gap junction genes. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Insights into molecular mechanisms underlying ovarian folliculogenesis could be gained through quantitative expression studies of genes. However, systematic studies on the expression patterns of developmentally important genes as the ovarian follicles in mammals develop from preantral to Graafian follicle stage are only beginning to be reported (Lakshminarayana et al., 2014; Chakravarthi et al., 2015; Kona et al., 2016) Gap junctions between oocytes and follicular cells and among follicular cells observed from primordial follicle stage onwards (Mitchell and Burghardt, 1986; Fair et al., 1997) play a major role in the folliculogenesis by transferring amino acids, glucose

∗ Corresponding author at: Embryo Biotechnology laboratory, Deopartment of Physiology, College of Veterinary Science, S.V.Veterinary University, Tirupati, India. E-mail address: [email protected] (V.H. Rao). http://dx.doi.org/10.1016/j.smallrumres.2016.08.010 0921-4488/© 2016 Elsevier B.V. All rights reserved.

metabolites, nucleotides, messenger molecules and ions among the different compartments in the ovary (Fair, 2003). Gap junctions are formed of two oligomeric integral membrane proteins known as connexons (Goodenough et al., 1996). Each connexon comprises of six protein subunits called connexins (Unger et al., 1999) which, based on the molecular size are designated CX26, CX32, CX37, CX42, CX43 and CX47 (Simon and Goodenough, 1998). Casual reports on the expression of some of the connexins in the oocytes and/or follicular cells in different species of mammals are available (Best et al., 2015; Winterhager and Kidder, 2015). CX43 was reportedly the major constituent of gap junctions among the cumulus cells in growing and mature follicles in the mouse (Koike et al., 1993). Failure to express CX43 resulted in the failure of meiotic maturation of the oocytes in the mouse (Ackert et al., 2001). Similarly Vozzi et al. (2001) suggested that the expression of CX43 might be important for the meiotic maturation of bovine oocytes. Gittens and Kidder (2005) on the other hand, reported that CX43 was not required for the meiotic maturation of

36

V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 35–42

the oocytes in the mouse but its expression in the cumulus cells was necessary for oogenesis. Kempisty et al. (2013) reported that in vitro maturation increased the expression of CX43 in porcine oocytes. Wang et al. (2009) concluded that CX43 is a major contributor to gap junctions in human cumulus cells and its expression level may influence the pregnancy outcome after intra cytoplasmic sperm injection (ICSI). Winterhager and Kidder, (2015) in their review suggested that loss or lower expression of CX43 in the ovarian granulosa cells of women reduced growth of ovarian follicles and the expression of CX43 is correlated with the oocyte and embryo quality. Expression of CX32 during ovarian folliculogenesis in mammals is relatively less investigated. CX32 expression increased in the Graafian follicles during the peri-ovulatory period in the mouse (Valdimarsson et al., 1993), pig (Itahana et al., 1996) and sheep (Borowczyk et al., 2006) suggesting its involvement in meiotic maturation of the oocytes. However, Johnson et al. (1999) could detect CX32 expression only in the cumulus cells of small atretic follicles and therefore suggested that it might be an indicator of atresia. Thus CX43 and CX32 appear to play key roles in ovarian folliculogenesis in mammals. However, the quantitative expression patterns of these two important connexins during the development of ovarian follicles in mammals were not reported. Embryogenesis from the oocytes in cultured preantral follicles (PFs’) is a dynamic area of research as a potential tool to (i) enhance the utilization of female germplasm in animals (Kamalamma et al., 2016) and (ii) restore fertility in women subjected to chemotherapy (Amorim et al., 2009; Xia et al., 2015). However, the frequency of meiotic maturation and embryo production from the oocytes in cultured PFs’ in mammals has been modest (Arunakumari et al., 2010; Magalhaes et al., 2011). It was hypothesized that several developmentally important genes might be prone to altered expression in the cultured ovarian follicles leading to poor development of the oocytes (Arunakumari et al., 2010). Although a few recent reports (Lakshminarayana et al., 2014; Chakravarthi et al., 2015; Kona et al., 2016) afford support to this hypothesis, paucity of information on the expression patterns of developmentally important genes in the cultured ovarian follicles in mammals is still acute. In view of the above, the present study examined the quantitative expression patterns of connexin 43 (CX43) and 32 (CX32) genes in the cumulus cells and oocytes separately during the in vivo or in vitro development of the preantral follicles to the large antral follicle stage in sheep. 2. Materials and methods All the materials and methods employed in this study were previously reported from the laboratory (Kona et al., 2016; Kamalamma et al., 2016). However, a brief but necessary description is provided hereunder. Unless otherwise stated, culture media, hormones, growth factors, foetal calf serum (FCS) and all the other chemicals used in this study were purchased from Sigma Chemical Co. (St. Louis, MO, USA) and plastics from Nunclon (Roskilde, Denmark). All the hormones and growth factors used were cell culture tested and endotoxin free. 2.1. Collection of ovaries and isolation of different stages of follicles A total of 750 ovaries collected on 126 different days during a period of 7 months were used in the present study. On each day of the study, 5–10 pairs of ovaries recovered at slaughter of mixed breeds of sheep were transported to the laboratory in sterile, warm (37 ◦ C) phosphate buffered saline (PBS). The ovaries were trimmed

off adherent tissues and ligaments and washed twice in the handling medium [HEPES buffered tissue culture medium 199 (TCM 199H) supplemented with 0.23 mM of sodium pyruvate, 2 mM lGlutamine and 50 ␮g/ml Gentamycin sulphate]. All the subsequent procedures were carried out in a laminar air flow. The ovaries were cut into two halves and the medulla was scooped out. After the removal of medulla, the ovarian cortices were placed in 35 mm plastic culture dishes (153066, Nalge Nunc, Denmark) containing handling medium and cut into small pieces of ∼1 mm3 using a sterile scalpel blade. Intact preantral (PFs’), early antral, antral and large antral follicles were mechanically isolated (Fig. 1 B, D, F, H) by micro dissection of the pooled ∼1 mm3 cortical pieces under a stereo-zoom microscope (SMZ 2T, Nikon corporation, Japan) using two 26 gauge needles fitted to 1 ml syringe barrels and a surgical blade. To avoid damage to the basement membrane a small amount of stromal tissue was left intact. From each ovary 5–10 preantral, 5–10 early antral, 3–5 antral and 1–2 large antral follicles could be routinely isolated. The classification of the follicles was based on the diameter and morphology as shown in Fig. 1 (Chakravarthi et al., 2015; Kona et al., 2016; Fair et al., 1997; Fair, 2003). 2.2. Selection and culture of preantral follicles Intact preantral follicles (250–400 ␮m) having centrally placed, spherical oocytes with no apparent signs of degeneration, with intact basement membrane were selected for the culture (Fig. 1B). A small sample of the isolated PFs’ are routinely checked for the viability by trypan blue dye exclusion test (Fig. 1A; Hemamalini et al., 2003). Bicarbonate buffered tissue culture medium 199 (TCM199B) supplemented with 50 ␮g/ml gentamycin sulphate, 1 ␮g/ml Thyroxin (T4 ), 2.5 ␮g/ml follicle stimulating hormone (FSH), 10 ng/ml Insulin like Growth factor-1 (IGF-1), 1 mIU/ml of growth hormone (GH), which supported the best development in vitro of PF’s and maturation of oocytes to metaphase-II stage earlier (Arunakumari et al., 2010) was used in this study to culture the PF’s. The selected follicles were washed thrice in the culture medium and subsequently placed individually in 20 ␮l droplets of the same medium in 35 mm plastic culture dishes (Nunc, 15066). To avoid evaporation of the medium, the micro droplets were overlaid with autoclaved light weight mineral oil (Sigma M 8410) pre-equilibrated with the medium over night at 39 ◦ C in 5% CO2 in air. These culture dishes were incubated at 39 ◦ C under humidified atmosphere in 5% CO2 in air for up to 6 days. Half the medium was replaced by an equal volume of fresh medium every 48 h. Each follicle was morphologically evaluated every 24 h during the culture period using an inverted microscope and the follicles exhibiting degenerative changes or stopped growing were removed. In vivo grown preantral, early antral, antral and large antral follicles and corresponding in vitro grown (Fig. 1) stages of follicles viz., PFs’ exposed to culture medium for two min, two, four or six day cultured follicles, were carefully opened using two 26 gauge needles attached to 1 ml syringe barrels, to release the cumulus oocytes complexes (COC) (Fig. 1J and K). The oocytes were denuded of the cumulus cells by repeated pipetting through a narrow bore glass pipette and used for the RNA isolation. However, randomly selected COCs’ from 6 day cultured follicles and in vivo grown large antral follicles collected on the same day were matured in vitro for additional 24 h as described below. 2.3. In vitro maturation (IVM) of COCs obtained from in vivo grown large antral and six-day cultured follicles Procedures for the IVM were as developed in the laboratory (Rao et al., 2002). Briefly after washing three times in the maturation medium (TCM199B supplemented with 10 ␮g/ml FSH,

V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 35–42

37

10 ␮g/ml Luteinizing hormone, 1 ␮g/ml estradiol-17␤, 50 ␮g/ml gentamycin sulphate, 10 ␮g/ml bovine serum albumin (BSA) (A8412,Sigma,USA) and 10% (v/v) oestrous sheep serum) the COCs were individually placed in 20 ␮l droplets of the same medium in 35 mm plastic culture dishes, covered with pre-equilibrated light weight mineral oil, and incubated for 24 h as described above. At the end of IVM, the oocytes were denuded of the cumulus cells by repeated pipetting through a fine bore glass pipette and used for further processing. 2.4. Experimental design Quantitative expression of CX43 and CX32 genes was studied at different development stages of the in vivo grown and corresponding stages of the cultured ovarian follicles (Fig. 1). The entire experiment was repeated thrice. Triplicate samples of complementary DNA (cDNA) from each replicate of the experiment (3 × 3 = 9 cDNA samples for each in vivo and in vitro stage) were subjected to reverse transcription quantitative polymerase chain reaction (RTqPCR). 2.5. RNA isolation, reverse transcription (RT) and real time PCR

Fig. 1. A. Preantral follicles subjected to trypan blue dye exclusion assay. Inset: a preantral follicles exhibiting trypan blue exclusion (100×). B-M: different in vivo (B, D, F, H, J, L) and corresponding in vitro (C, E, G, I, K, M) stages of ovarian follicles used in the present studies. (B) Preantral follicles at isolation 250–400 ␮m in diameter. (C) Preantral follicles exposed to culture media for two minutes. (D) Early antral follicles (400–500 ␮m in diameter). (E) Preantral follicles cultured for two days F. Antral follicles (500–700 ␮m in diameter). (G) Preantral follicles cultured for four days. (H) Large antral follicle (700 ␮m and above in diameter). (I) Preantral follicles cultured for six days. (J) Cumulus oocyte complex (COC) from large antral follicles.

Cumulus cells and oocytes from 30 to 50 follicles collected on the same day but from different ovaries were pooled at each in vivo and corresponding in vitro stage of development (Fig. 1) for the isolation of total RNA (Chakravarthi et al., 2015; Kona et al., 2016). Cells surrounding the oocyte were classified as cumulus cells and those surrounding the antrum as granulosa cells (Khamsi and Roberge, 2001). Isolation of RNA was carried out as described earlier (Kona et al., 2016) using Medox-Easy spin column Total RNA Mini prep Kits according to the manufacturer’s instructions (Medox Biotech India Pvt. Ltd., Chennai, India). Oocytes and cumulus cells were taken into RNase free microfuge (0613-03, Medox Biotech, India) and centrifuged for about 5 min at 1200 rpm. The supernatant was carefully removed by aspiration. The pellet was loosened by flicking the tube and 350 ␮l of G1 solution was added to it. The lysate was passed 5 times through 20G needle fitted to a syringe and equal volume of 70% ethanol was added to the lysate and mixed well. The ethanol mixture was transferred to MX 10 column placed in a collection tube and centrifuged at 8000 rpm for 1 min. The flow through was discarded. Then 500 ␮l of G2 solution was added to the column and centrifuged at 8000 rpm for 1 min, the flow through was discarded and 500 ␮l of G3 was added to the column. It was centrifuged at 8000 rpm for 1 min and MX 10 column was transferred to clean RNase free 1.5 ml microfuge. Finally 30–50 ␮l of RNase free water was added to the central portion of the MX 10 column and incubated at 50 ◦ C for 2 min and then centrifuged at 8000 rpm for 1 min. The RNA sample was stored at −70 ◦ C till analysed. Concentration and purity of RNA was determined using Nanodrop lite (Thermoscientific S.No.1354). RNA samples having purity (Absorbance at 260/280) in the range of 1.8-2.1 only were used in the expression studies. Reverse transcription reaction was car◦ ried out for 10 min at 25 ◦ C, 120 min at 37 C and 5 min at 85 ◦ C in a thermocycler using high capacity reverse transcription kits (part number: 4368814, Applied Biosystems, USA) according to the manufacturer’s instructions. In a comparison of twelve commonly used reference genes RPLPO, HPRT1 and 18SrRNA were the three most stably expressed

(K) COC from six day cultured follicles. (L) Oocyte obtained from COCs of large antral follicles matured in in vitro for 24 h. (M) oocyte obtained from COCs from 6 day cultured follicle matured in in vitro for 24 h. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

38

V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 35–42

Table 1 Primers and probes for gap junction and reference genes. Gene name

Symbol

Primers and probe sequences

Accession Number

Source

Gap Junction Genes Connexin 43

CX43

F: ACATGCACTTGAAGCAGATTGAAATT R: AAGCCCCCTCGCATCTTC Probe: FAM-CTTGCCGTGCTCTTCA-NFQ

AY074716

Applied Bio systems (Assay on Demand; lot nos: AI7ZZLH)

Connexin 32

CX32

AY074717

HPRT1

F.primer: GCTCGAGATGTGATGAAGGAGAT R. primer: TCCAACAGGTCGGCAAAGAA Probe: 6FAM-AGCCCCCCTTGAGCACACAGA—BBQ

AF176419

18S ribosomal RNA

18SrRNA

F.primer: AACAATACAGGACTCTTTCGAGGC R. primer:CAGACTTGCCCTCCAATGGA Probe: 6 FAM-CCACTTTAAATCCTTCCGCGAGGAT-BBQ

AM711875.1

Large ribosomal protein

RPLPO

F.primer: GCTCTGGAGAAACTGTTGCC R. primer: CCAGCAGCATGTCCCTGAT Probe: 6FAM-AGGTCCTCCTTGGTGAACACGAAGC-BBQ

NM 001012682

TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany)

Reference (House Keeping) Genes Hypoxanthine-guanine phosphoribosyl transferase

Reference Genes F:CTCCAGCCTGGCTGCAA R: GGGTGGACACCAAGATGAGC Probe:VIC-AGAGACCACAGACGCACGTGGGA—BBQ

FAM: 6 Carboxy fluorescein; VIC: proprietary fluoresecent reporter dye of Life technologies; NFQ: Non fluorescent Quencher; BBQ: Black Berry Quencher.

genes in the sheep ovarian follicles under the current experimental conditions (unpublished observations in the laboratory). Therefore the geometric mean of these three genes (Mamo et al., 2007) was used as the normalizer in the analysis of the expression of gap junction genes. Primer and probe details of the target (CX43 and CX32) and reference genes (RPLPO, HPRT1 and 18SrRNA) genes are given in Table 1. Real-time RT-qPCR was performed on ABI 7500 machine. Each 25 ␮l reaction mix contained 12.5 ␮l of Taq Man Universal PCR Master mix (2×), 1.25 ␮l of 20× gene expression assay mixture, 10 ng of cDNA sample in nuclease free water. Thermal cycling conditions were Erase Uracil N- glycosylase (UNG) Activation 2 min @ 50 ◦ C, Ampli Taq Gold DNA polymerase activation 10 min @ 95 ◦ C followed ◦ by 40 cycles of 15 s @ 95 C and 1 min @ 60 ◦ C. Prior to the calculation of expression levels (RQ- relative quantification) extreme Cq (quantitation cycle ‘Cq’: defined as the cycle number in which fluorescence can be detected and is basic result of qPCR) including ‘no detection’ in some of the samples were discarded (Chakravarthi et al., 2015) resulting in unequal number of observations in different groups. Cq values of target (CX32 and CX43) and reference genes (RPLPO, 18SrRNA, HPRT1) were converted into quantity inputs using the formula 2minimumCq−sampleCq . The geometric mean of quantity inputs of the three reference genes was used as the normalizer (Vandesompele et al., 2002; Mamo et al., 2007). Expression levels of the target genes (RQ) were calculated as: (quantity input of the target gene divided by geometric mean of quantity input of the three reference genes (https://www.kapabiosystems.com; Vandesompele et al., 2002).

2.6. Statistical analysis Stage of development and source (in vivo or in vitro) were the independent variables and the expression of the genes was the dependent variable. The data from the three replicates was pooled after the Bartlett’s test confirmed the homogeneity of variances. Log RQ values were analysed by Two-way ANOVA (General Linear Model – GLM) with unequal number of observations followed by Tukey HSD multiple comparison tests (SPSS version 20 from IBM corporation ltd, USA). P values ≤ 0.05 were considered significant.

3. Results 3.1. Evolution of CX43 expression in the cumulus cells and oocytes during in vivo development of the ovarian follicles The expression of CX43 in the cumulus cells remained the same at all the stages of in vivo development (Fig. 2A and Table 2) studied. On the contrary, CX43 expression in the oocytes showed a significant decrease as the PFs’ developed into early antral follicles and appeared to increase subsequently (Fig. 2B) although the increase as large antral follicles developed from antral follicles was not significant (Table 2). 3.2. Evolution of CX43 expression in the cumulus cells and oocytes during in vitro development of the ovarian follicles The expression of CX43 in the cumulus cells decreased significantly as the PFs’ developed in to early antral follicles in culture (Fig. 2A and Table 2) followed by a significant increase as the early antral follicles progressed to the antral follicle stage. Subsequently the CX43 expression decreased significantly as the large antral follicle stage was reached (Fig. 2A and Table 2). The expression of CX43 in the oocytes increased significantly as the PFs’ developed in culture into early antral follicles (Fig. 2B and Table 2) followed by a significant decrease at the antral and large antral follicle stages (Fig. 2B and Table 2). 3.3. Comparison of CX43 expression in the cumulus cells and oocytes isolated from in vivo and in vitro grown ovarian follicles at corresponding stages of development The expression of CX43 in the cumulus cells isolated from in vivo grown PFs’ and antral follicles was significantly lower than in the corresponding in vitro stages (Table 2). But the expression of CX43 in the cumulus cells did not differ significantly between in vivo and in vitro grown early antral and large antral follicles (Table 2). The expression of CX43 in the oocytes isolated from the in vivo grown ovarian follicles was significantly higher in the preantral, antral and large antral follicles but significantly lower at the early antral stage compared to corresponding in vitro stages (Table 2). The expression of CX43 in the cumulus cells in COCs’ from in vivo grown large antral follicles subjected to 24 h of in vitro mat-

V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 35–42

39

Fig. 2. Expression pattern of CX32 (A and B) and CX43 (C and D) in the oocytes and cumulus cells isolated from in vivo and in vitro grown ovarian follicles in sheep.

Table 2 Cx43 and Cx32 expression in sheep ovarian follicles grown in vivo or cultured in vitro. Source

Cx43

Cx32

in vivo

in vitro

in vivo

in vitro

Cumulus cells Preantral follicles Early antral follicles Antral follicles Large antral follicles * Cumulus cells from COCs

Log RQ ± SEM 00.69 ± 00.081p 00.75 ± 00.081r 00.64 ± 00.051s 00.742 ± 00.141u 00.59 ± 00.051v

01.88 ± 00.121,3q 00.42 ± 00.082r 02.02 ± 00.051t 00.71 ± 00.072u 01.66 ± 00.033w

01.13 ± 00.091a 00.93 ± 00.061c 00.42 ± 00.082e 00.21 ± 00.032g 01.11 ± 00.071i

00.63 ± 00.041b 00.17 ± 00.052d 01.06 ± 00.123f 01.16 ± 00.193h 00.50 ± 00.161j

Oocytes Preantral follicles Early antral follicles Antral follicles Large antral follicles a Oocytes from COCs

01.49 ± 00.091p 00.54 ± 00.042r 01.59 ± 00.171t 01.83 ± 00.111v 00.119 ± 00.133x

00.00 ± 00.041q 02.38 ± 00.052s 00.86 ± 00.343u 00.31 ± 00.174w 01.49 ± 00.125y

00.59 ± 00.031a 00.99 ± 00.032c 01.05 ± 00.042e 01.62 ± 00.113g 01.03 ± 00.152i

00.00 ± 00.061b 00.31 ± 00.071d 01.45 ± 0.062f 00.84 ± 00.153h 01.13 ± 00.052,3i

Early antral, antral, and large antral follicles were isolated from the ovaries (in vivo) or obtained after culture of preantral follicles for 2, 4, and 6 days, respectively. Values with same numeric superscripts with in in vivo or in vitro stages and same alphabetic superscripts between corresponding in vivo and in vitro stages for each gene are not significantly different (P ≤ 0.05). a Cumulus oocyte complexes (COCs) from in vivo grown large antral follicles and from 6 day cultured large antral follicles were matured in vitro for additional 24 h.

uration did not change (Fig. 2A and Table 2) but in the similarly treated COCs’ from in vitro grown large antral follicles the expression increased significantly (Fig. 2A and Table 2). In the oocytes from in vivo developed large antral follicles after 24 h of in vitro maturation, the expression of CX43 showed a significant decrease (Fig. 2B and Table 2) but in the oocytes in similarly treated COCs from in vitro grown large antral follicles the expression increased significantly (Fig. 2B and Table 2). CX43 expression in both cumulus cells and oocytes in COCs’ matured in vitro for 24 h after isolation from in vivo grown large antral follicles was significantly lower than those from in vitro developed ones (Table 2).

3.4. Evolution of CX32 expression in the cumulus cells and the oocytes during in vivo development of the ovarian follicles The expression of CX32 in the cumulus cells appeared to decrease continuously as the PFs’ progressed from preantral to the large antral follicle stage of development (Fig. 2C). However, the decrease observed in the expression of CX32 as the development progressed from preantral to early antral and antral to large antral follicle stages was not significant (Table 2). In contrast the expression of CX32 in the oocytes appeared to increase continuously as the PFs’ developed in to large antral follicles (Fig. 2D), although the increase in the expression observed

40

V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 35–42

as the early antral follicles developed into antral follicles was not significant (Table 2). 3.5. Evolution of CX32 expression in the cumulus cells and the oocytes during in vitro development of the ovarian follicles The expression of CX32 in the cumulus cells showed a significant decrease as PFs’ (PFs’ exposed to culture medium) in culture developed in to early antral follicle (two day cultured PFs’) (Fig. 2C and Table 2) followed by a significant increase at the antral follicle (four day cultured PFs’) stage (Fig. 2C). No further change in the expression was noted at the large antral follicle stage (six day cultured PFs’) (Table 2). The expression of CX32 in the oocytes appeared to increase as the PFs’ developed in to antral follicles (Fig. 2D) although the increase from PFs’ to early antral follicle was not significant (Table 2). This was followed by a significant decrease in expression of CX32 after the progression of antral follicles into large antral follicles (Fig. 2D and Table 2). 3.6. Comparison of CX32expression in the cumulus cells and oocytes isolated from in vivo and in vitro grown ovarian follicles at corresponding stages of development Quantitative expression of CX32 in the cumulus cells isolated from in vivo grown ovarian follicles was significantly higher in the preantral and early antral follicles than the corresponding in vitro stages (Table 2). However, at the antral and large antral stages, cumulus cells from in vivo grown follicles exhibited a significantly lower level of expression of CX32 than the corresponding in vitro stages (Table 2). Similarly the expression of CX32 in the oocytes isolated from the in vivo grown follicles at preantral, early antral and large antral stages was significantly higher than the corresponding in vitro stages (Table 2). However, at the antral follicle stage, oocytes from in vivo grown follicles expressed CX32 to a significantly lower level than the in vitro grown ones (Table 2). The expression of CX32 in the cumulus cells in COCs’ from in vivo grown large antral follicles subjected to 24 h of in vitro maturation increased significantly (Fig. 2C and Table 2). But in the cumulus cells in similarly treated COCs’ from in vitro grown large antral follicles (six day cultured follicles) the expression decreased significantly (Fig. 2C and Table 2). CX32 expression was significantly higher in the cumulus cells in COCs’ derived from in vivo than in vitro developed large antral follicles matured in vitro for 24 h (Table 2). While the CX32 expression in the oocytes from COCs in in vivo developed large antral follicles after 24 h of in vitro maturation, showed a significant decrease (Fig. 2D and Table 2), in the oocytes from similarly treated COCs’ in in vitro grown large antral follicles, it increased significantly (Fig. 2D and Table 2). However, the levels of expression were similar in the oocytes in the COCs’ from in vivo and in vitro grown large antral follicles after in vitro maturation for 24 h (Table 2). 4. Discussion Although there are reports on the expression of CX43 and CX32 in one stage or the other of ovarian follicles in mammals (Best et al., 2015; Winterhager and Kidder, 2015) the present study for the first time describes the expression patterns of gap junction genes (CX43 and CX32) in the cumulus cells and oocytes from different development stages of in vivo as well as in vitro grown ovarian follicles in sheep. In the present study the expression of CX43 and CX32 was observed in the cumulus cells as well as the oocytes at all development stages of in vivo and in vitro grown ovarian follicles as was

discretely witnessed in the oocytes and granulosa cells of COCs, theca cells, secondary follicles, antral follicles, preimplantation embryos and ovaries in different species of mammals as mentioned earlier. Since CX43 and CX32 are essential for the progression of PFs into large antral follicles and for the meiotic maturation of the oocytes (Gittens and Kidder, 2005; Borowczyk et al., 2006), it is conceivable that they are expressed throughout the development of ovarian follicles both in the cumulus cells as well as the oocytes. Expression of CX43 in mammalian oocytes is reported for the first time in the present study. CX43 was found to be one of the key factors regulating the process of primordial follicle recruitment, development of antral follicles and meiotic maturation of the oocytes as evidenced by the gene expression and knockout studies in the mouse (Juneja et al., 1999; Ackert et al., 2001). In the present study the expression of CX43 in the cumulus cells at different development stages of in vivo grown follicles was rather constant but varied widely in the in vitro grown ones. Earlier Okuma et al. (1996) also reported that CX43 expression in the rat was constant throughout follicular development but decreased after LH surge. In contrast several earlier reports (Johnson et al., 1999; Wright et al., 2001) stated that in the granulosa cells CX43 expression increased gradually from primordial to antral follicle stage and decreased during oestrus due to LH surge. These differences in CX43 expression could be ascribed to (i) the species (ii) the protein vs. transcript profiles and/or (iii) morphologically similar in vivo and in vitro stages of follicles in the present study being dissimilar in physiology/development. Although the present culture system up-regulated the expression of CX43 in cumulus cells, it failed to do so in the oocytes (Table 2). Several explanations, which are all conjectural, may be offered: (i) Gonadotrophins (Santiquet et al., 2013), EGF (Bolamba et al., 2002), Angiotensin II and IGF-1 (Jia et al., 2007) stimulate the expression of CX43. While the present culture medium contained FSH and IGF-I, it lacked the other two known stimulators of CX43; (ii) oocytes may be passive partners in establishing the gap junctions (Valadi et al., 2007) and therefore do not need to express significant quantities of CX43; (iii) since CX32 expression was down regulated in the present study and since CX32 is apparently important for the development of the ovarian follicles (Sutovsky et al., 1993; Wright et al., 2001), the gap junctions between the oocytes and cumulus cell in the cultured follicles were probably inadequate to transfer the CX43 stimulators across the cumulus cells; (iv) it is conceivable that the CX43 found in the oocytes might not be locally synthesized but transferred from the cumulus cells (Valadi et al., 2007) and finally (v) it is also possible that the cumulus cells may have receptors and other intermediate signalling molecules for the hormones and growth factors used in the present study which stimulate CX43 expression, whereas in the oocytes they may be absent. After IVM the expression of CX43 in in vivo cumulus cells revived probably due to various growth factors, especially estradiol (Di et al., 2001) present in IVM medium. Continuous decrease in the CX32 expression in the cumulus cells from in vivo grown follicles observed in the present study alludes to (i) the growing and healthy follicles progressing towards ovulation continuously utilize CX32 for establishing inter cellular communication among cumulus cells and between cumulus cells and the oocytes and/or (ii) continuously transfer the transcript into the oocytes as noted by a continuous increase of the transcript in the oocytes. While the significance of the accumulation of CX32 transcript in the oocytes as the follicles developed from preantral to large antral follicle stage is yet unknown, it is possible that such accumulation plays a significant role in the completion of Meiosis II and/or the early embryonic transition (Valadi et al., 2007) by providing efficient pathways for the mobilization of glucose and/or other signalling molecules (Dunlap et al., 1987; Saez et al., 1989). In the cumulus cells and oocytes from in vivo grown follicles the pat-

V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 35–42

tern of expression of CX32 was different and the level of expression was significantly higher compared to in vitro grown ones indicating the adverse influence of culture. It may be contended that the aberrant expression of the gap junction genes might be the result of, but not the cause for the poor development of PFs’ in culture. However, logically changes in gene expression precede but not follow gross abnormalities in tissues. Further the present RQ values of gap junction genes are the averages of three sets of samples obtained by pooling of cumulus cells and oocytes from 30 to 50 follicles which were all apparently normal and did not show any signs of degeneration at any development stage studied. Future studies on temporal changes in the expression of gap junction genes in individual ovarian follicles shall provide the final proof in this connection. Disturbances in the expression of steroidogenesis (Lakshminarayana et al., 2014) and growth factor (Kona et al., 2016) regulating genes in the cultured ovarian follicles in sheep, maintain the proposition that the poor developmental potential of the oocytes in the cultured ovarian follicles (Arunakumari et al., 2010) in mammals might be due to aberrant expression of developmentally important genes. Accordingly efforts must now be concentrated on achieving gene expression profiles in cultured follicles similar to those in in vivo grown ones. In this connection it would be interesting to investigate the influence of growth factors and hormones such as Activin A (Carabatsos et al., 2000), EGF (Bolamba et al., 2002) Angiotensin II and IGF1 (Jia et al., 2007), all-trans retinoic acid (ATRA) (Best et al., 2015) and Gonadotropins (Santiquet et al., 2013) are known to improve the expression of developmentally important genes. It is concluded that (i) the gap junction genes follow a stage specific pattern of expression during ovarian follicular development in sheep and (ii) in vitro culture altered these stage specific patterns of expression. Declaration of interest Authors declare no conflict of interest. Acknowledgments This work was supported by a research grant from the Council of Scientific and Industrial Research (CSIR) (Grant No. 37 (1483)/11/EMR-II), Government of India to V.H. Rao. V. Praveen Chakravarthi is supported by the University Grants Commission (No. 20-6/2009(I) EU-IV) and Siva Sagar Reddy Kona by the CSIR. Ms. R.Vagdevi provided the technical assistance. References Ackert, C.L., Gittens, J.E.I., Brien, M.J.O., Eppig, J.J., Kidder, G.M., 2001. Intercellular communication via connexin43 gap junctions is required for ovarian folliculogenesis in the mouse. Dev. Biol. 233, 258–270. Amorim, C.A., Van Langendonckt, A., David, A., Dolmans, M.M., Donnez, J., 2009. Survival of human pre-antral follicles after cryopreservation of ovarian tissue, follicular isolation and in vitro culture in a calcium alginate matrix. Hum. Reprod. 24, 92–99. Arunakumari, G., Shanmugasundaram, N., Rao, V.H., 2010. Development of morulae from the oocytes of cultured sheep preantral follicles. Theriogenology 74, 884–894. Best, M.W., Wu, J., Pauli, S.A., Kane, M.A., Pierzchalski, K., Session, D.R., Sidell, N., 2015. A role for retinoids in human oocyte fertilization: regulation of connexin 43 by retinoic acid in cumulus granulosa cells. Mol. Hum. Reprod. 21, 527–534. Bolamba, D., Floyd, A.A., McGlone, J.J., Lee, V.H., 2002. Epidermal growth factor enhances expression of connexin 43 protein in cultured porcine preantral follicle. Biol. Reprod. 67, 154–160. Borowczyk, E., Johnson, M.L., Bilski, J.J., Borowicz, P.P., Redmer, D.A., Reynolds, L.P., Grazul-Bilska, A.T., 2006. Expression of gap junctional connexins 26, 32, and 43 mRNA in ovarian preovulatory follicles and corpora lutea in sheep. Can. J. Physiol. Pharmacol. 84, 1011–1020. Carabatsos, M.J., Sellitto, C., Goodenough, D.A., Albertini, D.F., 2000. Oocyte—granulosa cell heterologous gap junctions are required for the

41

coordination of nuclear and cytoplasmic meiotic competence. Dev. Biol. 226, 167–179. Chakravarthi, V.P., Kona, S.S.R., Siva Kumar, A.V.N., Bhaskar, M., Rao, V.H., 2015. Quantitative patterns of expression of anti and pro apoptotic genes in the in vivo grown and cultured ovarian follicles in sheep. Theriogenology 83, 590–595. Di, W.L., Lachelin, G.C., McGarrigle, H.H.G., Thomas, N.S.B., Becker, D.L., 2001. Oestriol and oestradiol increase cell to cell communication and connexin43 protein expression in human myometrium. Mol. Hum. Reprod. 7, 671–679. Dunlap, K., Takeda, K., Brehm, P., 1987. Activation of a calcium-dependent photoprotein by chemical signalling through gap junctions. Nature 325, 60–62. Fair, T., Hulshof, S.C.J., Hyttel, P., Greve, T., Boland, M., 1997. Oocyte ultrastructure in bovine primordial to early tertiary follicles. Anat. Embryol. 195, 327–336. Fair, T., 2003. Follicular oocyte growth and acquisition of developmental competence. Anim. Reprod. Sci. 78, 203–216. Gittens, J.E., Kidder, G.M., 2005. Differential contributions of connexin37 and connexin43 to oogenesis revealed in chimeric reaggregated mouse ovaries. J. Cell Sci. 118, 5071–5078. Goodenough, D.A., Goliger, J.A., Paul, D.L., 1996. Connexins, connexons, and intercellular communication. Annu. Rev. Biochem. 65, 475–502. Hemamalini, N.C., Rao, B.S., Tamilmani, G., Amarnath, D., Vagdevi, R., Naidu, K.S., Reddy, K.K., Rao, V.H., 2003. Influence of transforming growth factor-␣, insulin like growth factor-II, epidermal growth factor or follicle stimulating hormone on in vitro development of preantral follicles in sheep. Small Rumin. Res. 50, 11–22. Itahana, K., Morikazu, Y., Takeya, T., 1996. Differential expression of four connexin genes, Cx-26, Cx-30.3, Cx-32, and Cx-43, in the porcine ovarian follicle. Endocrinology 137, 5036–5044. Jia, G., Mitra, A.K., Cheng, G., 2007. Angiotensin II and IGF-1 regulate connexin43 expression via ERK and p38 signaling pathways in vascular smooth muscle cells of coronary artery bypass conduits. J. Surg. Res. 142, 137–142. Johnson, L., Redmer, D.A., Reynolds, L.P., Grazul-Bilska, A.T., 1999. Expression of gap junctional proteins connexin 43, 32, and 26 throughout follicular development and atresia in cows. Endocrine 10, 43–51. Juneja, S.C., Barr, K.J., Enders, G.C., Kidder, G.M., 1999. Defects in the germ line and gonads of mice lacking connexin43. Biol. Reprod. 60, 1263–1270. Kamalamma, P., Kona, S.S.R., Chakravarthi, V.P., Kumar, A.S., Punyakumari, B., Rao, V.H., 2016. Effect of leptin on in vitro development of ovine preantral ovarian follicles. Theriogenology 85, 224–229. Kempisty, B., Ziółkowska, A., Piotrowska, H., Antosik, P., Bukowska, D., Zawierucha, P., Zabel, M., 2013. Expression and cellular distribution of cyclin-dependent kinase 4 (Cdk4) and connexin 43 (Cx43) in porcine oocytes before and after in vitro maturation. Acta Vet. Hung. 62 (1), 84–95. Khamsi, F., Roberge, S., 2001. Granulosa cells of the cumulus oophorus are different from mural granulosa cells in their response to gonadotrophins and IGF-I. J. Endocrinol. 170 (3), 565–573. Koike, K., Watanabe, H., Hiroi, M., Tonosaki, A., 1993. Gap junction of stratum granulosum cells of mouse follicles: immunohistochemistry and electron microscopy. J. Electron. Microsc. 42, 94–106. Kona, S.S.R., Chakravarthi, V.P., Siva Kumar, A.V.N., Srividya, D., Padmaja, K., Rao, V.H., 2016. Quantitative expression patterns of GDF9 and BMP15 genes in sheep ovarian follicles grown in vivo or cultured in vitro. Theriogenology 85, 315–322. Lakshminarayana, B.N.V., Chakravarthi, V.P., Brahmaiah, K.V., Rao, V.H., 2014. Quantification of P450 aromatase gene expression in cultured and in vivo grown ovarian follicles in sheep. Small Rumin. Res. 117, 66–72. Magalhaes, D.M., Duarte, A.B., Araujo, V.R., 2011. In vitro production of a caprine embryo from a preantral follicle cultured in media supplemented with growth hormone. Theriogenology 75, 182–188. Mamo, S., Gal, A.B., Bodo, S., Dinnyes, A., 2007. Quantitative evaluation and selection of reference genes in mouse oocytes and embryos cultured in vivo and in vitro. BMC Dev. Biol. 7, 14. Mitchell, P.A., Burghardt, R.C., 1986. The ontogeny of nexuses (gap junctions) in the ovary of the fetal mouse. Anat. Rec. 214, 283–288. Okuma, A., Kuraoka, A., Iida, H., Inai, T., Wasano, K., Shibata, Y., 1996. Co-localization of connexin 43 and connexin 45 but absence of connexin 40 in granulosa cell gap junctions of rat ovary. J. Reprod. Fertil. 107, 255–264. Rao, B.S., Naidu, K.S., Amarnath, D., Vagdevi, R., Rao, A.S., Bramaiah, K.V., Rao, V.H., 2002. In vitro maturation of sheep oocytes in different media during breeding and non-breeding seasons. Small Rumin. Res. 43, 31–36. Saez, J.C., Connor, J.A., Spray, D.C., Bennett, M.V., 1989. Hepatocyte gap junctions are permeable to the second messenger, inositol 1,4,5-trisphosphate, and to calcium ions. Proc. Natl. Acad. Sci. U. S. A. 86, 2708–2712. Santiquet, N., Robert, C., Richard, F.J., 2013. The dynamics of connexin expression, degradation and localisation are regulated by gonadotropins during the early stages of in vitro maturation of swine oocytes. PLoS One, e68456. Simon, A.M., Goodenough, D.A., 1998. Diverse functions of vertebrate gap junctions. Trends Cell Biol. 8, 477–483. Sutovsky, P., Flechon, J.E., Flechon, B., Motlik, J., Peynot, N., Chesne, P., Heyman, Y., 1993. Dynamic changes of gap junctions and cytoskeleton during in vitro culture of cattle oocyte cumulus complexes. Biol. Reprod. 49, 1277–1287. Unger, V.M., Kumar, N.M., Gilula, N.B., Yeager, M., 1999. Three-dimensional structure of a recombinant gap junction membrane channel. Science 283, 1176–1180.

42

V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 35–42

Valadi, H., Ekström, K., Bossios, A., Sjöstrand, M., Lee, J.J., Lotvall, J.O., 2007. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 9, 654–659. Valdimarsson, G., De Sousa, P.A., Kidder, G.M., 1993. Coexpression of gap junction proteins in the cumulus-oocyte complex. Mol. Reprod. Dev. 36, 7–15. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, 1–12. Vozzi, C., Formenton, A., Chanson, A., Senn, A., Sahli, R., Shaw, P., Nicod, P., Germond, M., Haefliger, J.A., 2001. Involvement of connexin 43 in meiotic maturation of bovine oocytes. Reproduction 122, 619–628.

Wang, H.X., Tong, D., El-Gehani, F., Tekpetey, F.R., Kidder, G.M., 2009. Connexin expression and gap junctional coupling in human cumulus cells: contribution to embryo quality. J. Cell. Mol. Med. 13 (5), 972–984. Winterhager, E., Kidder, G.M., 2015. Gap junction connexins in female reproductive organs: implications for women’s reproductive health. Hum. Reprod. 21 (3), 340–352. Wright, C.S., Becker, D.L., Lin, J.S., Warner, A.E., Hardy, K., 2001. Stage-specific and differential expression of gap junctions in the mouse ovary: connexin-specific roles in follicular regulation. Reproduction 121, 77–88. Xia, X., Wang, T., Yin, T., Yan, L., Yan, J., Lu, C., Qiao, J., 2015. Mesenchymal stem cells facilitate in vitro development of human preantral follicle. Reprod. Sci., http://dx.doi.org/10.1177/1933719115578922.