- Email: [email protected]
Stage specific expression of cell cycle genes during in vivo or in vitro development of ovarian follicles in sheep
Small Ruminant Research 143 (2016) 1–7
Contents lists available at ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Stage specific expression of cell cycle genes during in vivo or in vitro development of ovarian follicles in sheep V. Praveen Chakravarthi a , S.S.R. Kona a , A.V.N. Siva Kumar a , M. Bhaskara b , V.H. Rao a,∗ a b
Embryo Biotechnology Laboratory, Department of Physiology, College of Veterinary Science, Tirupati, 517502, India Department of Biotechnology and Department of Zoology, Sri Venkateswara University, Tirupati, India
a r t i c l e
i n f o
Article history: Received 17 November 2015 Received in revised form 4 August 2016 Accepted 16 August 2016 Available online 17 August 2016 Keywords: Cell cycle Preantral follicles Sheep In vitro culture Cyclins
a b s t r a c t Quantitative expression patterns of cell cycle genes (CCNB1 and CCND1) were studied at different in vivo and corresponding in vitro stages of development of ovarian follicles in sheep. In the cumulus cells from in vivo grown ovarian follicles, the expression of CCNB1 and CCND1 decreased significantly at the large antral stage relative to all the other stages of development except the decrease in CCND1 from antral to large antral stage. However, in the cumulus cells from in vitro cultured ovarian follicles, such significant decrease in the expression of CCNB1 and CCND1 was absent. The expression of CCNB1 and CCND1 in the oocytes from in vivo grown ovarian follicles increased significantly up to the large antral stage. In the oocytes from in vitro grown ovarian follicles, however, the pattern of expression of these genes was different. In vitro maturation of cumulus oocyte complexes (COCs) for 24 h stimulated the expression of CCNB1 and CCND1 in the cumulus cells derived from both in vivo and in vitro grown ovarian follicles. In similarly treated oocytes, while the CCND1 expression was unaffected, the expression of CCNB1 was suppressed. It is concluded that the cell cycle genes follow specific patterns of expression during ovarian folliculogenesis synchronous with different development events. In vitro culture deranged the expression patterns of these genes. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Quantitative expression studies of genes reveal molecular mechanisms underlying important development activities including the ovarian folliculogenesis. While there are random reports on the expression of several genes during folliculogenesis in mammals (Kuroda et al., 2004; Jones and Lane, 2013), systematic studies on the evolution of quantitative expression of developmentally important genes as the ovarian follicles develop from preantral to Graafian follicle stage are only beginning to be reported (Chakravarthi et al., 2015; Kona et al., 2016). In eukaryotes, four types of cyclins (A, B, D and E) in association with different cyclin-dependent kinases (CDKs) regulate the cell cycle (Murray, 2014; Cooper and Hausman, 2007). Cyclin B1 (CCNB1) was reportedly the principal molecule in the initiation of germinal vesicle break down (GVBD) and meiotic maturation in the pig and goat oocytes (Kuroda et al., 2004; and Anguita et al., 2008).
∗ Corresponding author. E-mail addresses: [email protected], [email protected] (V.H. Rao). http://dx.doi.org/10.1016/j.smallrumres.2016.08.011 0921-4488/© 2016 Elsevier B.V. All rights reserved.
Similarly cyclin D1 (CCND1) expression increased during the second meiotic division in the mouse oocytes (Moore et al., 1996). Expression of other cyclin genes in the oocytes or granulosa cells at a few discrete stages of development during folliculogenesis in the mouse was reported (Moore et al., 1996; Liu et al., 2006). However, there are no reports on the evolution of quantitative patterns of expression of CCNB1 or D1 as the mammalian preantral follicles developed to Graafian follicle stage. To enhance the utilization of female germplasm in animals and as a potential restorative measure of fertility in women subjected to chemotherapy, in vitro embryogenesis from the oocytes in cultured preantral follicles (PFs’) is being actively pursued (see Kamalamma et al., 2016 for a review). While live offspring could be produced from the oocytes in cultured PFs’ after in vitro fertilization and embryo transfer in the mouse (Eppig and Schroeder, 1989), such a feat remains to be achieved in other species of laboratory and domestic mammals. Further the frequency of meiotic maturation and embryo production from the oocytes in cultured PFs’ in mammals including the mouse has been modest (Arunakumari et al., 2010). It was therefore, hypothesized that deranged expression of developmentally important genes might explain the compromised development of the oocytes in the cultured ovarian follicles
2
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
(Arunakumari et al., 2010). However, paucity of information on the expression patterns of developmentally important genes in the cultured ovarian follicles in mammals is even more acute. Only recently aberrant expression of a few of the key genes involved in steroidogenesis (Lakshminarayana et al., 2014), apoptosis (Chakravarthi et al., 2015) and growth factors (Kona et al., 2016) in the cultured ovarian follicles in sheep was reported from the laboratory. In view of the significance of CCNB1 and D1 to the ovarian folliculogenesis and paucity of information on the expression patterns of these genes during the development of ovarian follicles in mammals, the present study investigated the quantitative expression of cyclin B1 (CCNB1) and D1 (CCND1) genes in the cumulus cells and oocytes separately during the in vivo development of preantral follicles to the Graafian follicle stage and compared such expression at corresponding stages of development of the cultured follicles in sheep. 2. Materials and methods This study was undertaken as per the guidelines of the institutional research and ethics committees. Unless otherwise stated, culture media, hormones, growth factors, foetal calf serum (FCS) and all the other chemicals used in this study were purchased from Sigma Chemical Co. (St. Louis, MO, USA) and plastics from Nunclon (Roskilde, Denmark). All the hormones and growth factors used were cell culture tested and endotoxin free. All the procedures employed were as reported from the laboratory earlier (Kona et al., 2016; Kamalamma et al., 2016). However, a brief but adequate description of all the methods employed in this study is described hereunder. 2.1. Collection of ovaries and isolation of different stages of follicles A total of 750 ovaries collected on 126 different days during a period of 7 months were used in the present study. On each day of the study, 5–10 pairs of sheep ovaries recovered at slaughter were transported to the laboratory in sterile, warm (37 ◦ C) phosphate buffered saline (PBS). The ovaries were trimmed off adherent tissues and ligaments and washed twice in the handling medium [HEPES buffered tissue culture medium 199 (TCM 199H) supplemented with 0.23 mM of sodium pyruvate, 2 mM L-Glutamine and 50 g/ml Gentamycin sulphate]. All the subsequent procedures were carried out in a laminar air flow. Ovaries were cut into two halves along their longitudinal axis and medulla was removed by cutting along the dotted lines shown in Fig. 1 A. Subsequently the ovarian cortices were cut into thin slices with a surgical blade. Intact preantral, early antral, antral and large antral follicles were mechanically isolated from the thin ovarian cortical slices (Fig. 1B, D, F, H) by micro-dissection under a stereoscopic-zoom microscope. From each ovary 5–10 preantral, 5–10 early antral, 3–5 antral and 1–2 large antral follicles could be routinely isolated. 2.2. Selection and culture of preantral follicles Intact preantral follicles (250–400 m) having centrally placed, spherical oocytes with no apparent signs of degeneration and with intact basement membrane were selected for the culture (Fig. 1B). Bicarbonate buffered tissue culture medium 199 (TCM199B) supplemented with 50 g/ml gentamycin sulphate, 1 g/ml Thyroxin (T4 ), 2.5 g/ml follicle stimulating hormone (FSH), 10 ng/ml Insulin like Growth factor-1 (IGF-1), 1 mIU/ml of growth hormone (GH), which supported the best development in vitro of PF’s and maturation of oocytes to metaphase-II stage earlier (Arunakumari et al.,
2010) was used in this study to culture the PF’s. The selected follicles were washed thrice in the culture medium and subsequently placed individually in 20 l droplets of the culture medium in 35 mm plastic culture dishes (Nunc, 15066). To avoid evaporation of the medium, the micro droplets were overlaid with autoclaved light weight mineral oil (SigmaM 8410) pre-equilibrated with the medium over night at 39 ◦ C in 5% CO2 in air. These culture dishes were incubated at 39 ◦ C under humidified (≥95%) atmosphere of 5% CO2 in air for up to 6 days. Half the medium was replaced by an equal volume of fresh medium every 48 h. Each follicle was morphologically evaluated every 24 h during the culture period using an inverted microscope and the follicles exhibiting degenerative changes or stopped growing were removed. In vivo and in vitro grown ovarian follicles at morphologically similar development stages (Fig. 1) were carefully opened using two 26 gauge needles to release the cumulus oocyte complexes (COCs) (Fig. 1J and K). The oocytes were denuded of the cumulus cells by repeated pipetting through a marrow bore glass pipette. However, COCs from in vivo grown large antral follicles and PFs’ cultured for six days were matured in vitro for additional 24 h as described below. 2.3. In vitro maturation (IVM) of COCs obtained from in vivo grown large antral and six-day cultured follicles Procedures for the IVM were as developed in the laboratory (Rao et al., 2002). Briefly after washing three times in the maturation medium (TCM199 B supplemented with 10 g/ml FSH, 10 g/ml Luteinizing hormone, 1 g/ml estradiol-17, 50 g/ml gentamycin sulphate, 10 g/ml bovine serum albumin (BSA) (A8412,Sigma,USA) and 10% (v/v) oestrous sheep serum), the COCs were individually placed in 20 l droplets of the same medium in 35 mm plastic culture dishes, covered with pre-equilibrated light weight mineral oil, and incubated for 24 h as described above. At the end of IVM, the oocytes were denuded of the cumulus cells by repeated pipetting through a fine bore glass pipette and used for further processing. 2.4. Experimental design Quantitative expression of CCNB1 and CCND1 genes was studied at different development stages of the in vivo grown and corresponding stages of the cultured ovarian follicles (Fig. 1). The entire experiment was repeated thrice. Triplicate samples of complementary DNA (cDNA) from each replicate of the experiment (3 × 3 = 9 cDNA samples for each in vivo and in vitro stage) were subjected to reverse transcription quantitative polymerase chain reaction (RTqPCR). 2.5. RNA isolation, reverse transcription (RT) and real time PCR Cumulus cells and oocytes from 30 to 50 follicles collected on the same day but from different ovaries were pooled at each in vivo and corresponding in vitro stage of development (Fig. 1) for the isolation of total RNA (Chakravarthi et al., 2015; Kona et al., 2016). Isolation of RNA was carried out by using Medox-Easy spin column Total RNA Mini prep Kit according to the manufacturer’s instructions (Medox Biotech India Pvt. Ltd., Chennai, India) as described in detail in an earlier report from the laboratory (Kona et al., 2016). Concentration and purity of RNA was determined using Nanodrop lite (Thermoscientific S.No.1354). RNA samples having purity (Absorbance at 260/280) in the range of 1.8-2.1 only were used in the expression studies. Reverse transcription reaction was carried out for 10 min at 25 ◦ C, 120 min at 37 ◦ C and 5 min at 85 ◦ C in a thermocycler using high capacity reverse transcription kits (Applied biosystems, USA) according to the manufacturer’s instructions.
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
Fig. 1. Different in vivo and morphologically corresponding in vitro stages of development of ovarian follicles in sheep. A. Ovaries cut into two halves along their longitudinal axis and removal of medulla by cutting along the dotted lines. B. Preantral follicles at isolation 250–400 m in diameter. C. Preantral follicles exposed to culture media for 3 min. D. Early antral follicles (400–500 m in diameter). E. Preantral follicles cultured for 2 days. F. Antral follicles (500–700 m in diameter). G. Preantral follicles cultured for 4 days.
3
4
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
Table 1 Primers and probes for cyclin, gap junction and reference genes. Gene name Cell cycle genes
Symbol
Primers and probe sequences
Accession Number
Source
CyclinD1
CCND1
EU525165
Cyclin B1
CCNB1
F.primer: GTGGCCTCGAAGATGAAGGA R.primer: CGGACGGAGTTGTCAGTGTAG Probe: FAMACGCACAGCTTCTCGNFQ F.primer: TAATTGATCGGTTCATGCAGGAT R.primer: TGCAACAAACATGGCAGTGA Probe:VIC-AGCTGCAGCATCTTCTTGGGCAC—BBQ
Applied Bio systems (Assay on Demand; lot nos: AI7ZZLH) TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany)
F.primer: GCTCGAGATGTGATGAAGGAGAT
AF176419
TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany)
AM711875.1
TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany) TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany)
Reference (House Keeping) Genes HPRT1 Hypoxanthine-guanine phosphoribosyl transferase
18S ribosomal RNA
18SrRNA
Large ribosomal protein
RPLPO
R. primer: TCCAACAGGTCGGCAAAGAA Probe: 6FAM-AGCCCCCCTTGAGCACACAGA—BBQ F.primer: AACAATACAGGACTCTTTCGAGGC R. primer:CAGACTTGCCCTCCAATGGA Probe: 6 FAM-CCACTTTAAATCCTTCCGCGAGGAT-BBQ F.primer: GCTCTGGAGAAACTGTTGCC R. primer: CCAGCAGCATGTCCCTGAT Probe: 6FAM-AGGTCCTCCTTGGTGAACACGAAGC-BBQ
XM-004016916
NM 001012682
FAM: 6 Carboxy fluorescein; VIC: proprietary to Life technologies; NFQ: Non fluorescent Quencher; BBQ: Black Berry Quencher.
In a comparison of twelve commonly used reference genes RPLPO, HPRT1 and 18SrRNA were the three most stably expressed genes in the sheep ovarian follicles under the current experimental conditions (unpublished observations in the laboratory). Therefore, the geometric mean of these three genes (Mamo et al., 2008) was used as the normalizer in the analysis of the expression of cell cycle genes. Primer and probe details for CCNB1 and CCND1genes and the reference genes are given in Table 1. Real-time RT-qPCR was performed on Applied Biosystems 7500 machine. Each 25 l reaction mix contained 12.5 l of Taq Man Universal PCR Master mix (2x), 1.25 l of 20X gene expression assay mixture, 10 ng of cDNA sample in nuclease free water. Thermal cycling conditions were Erase UNG (Uracil N- glycosylase) Activation 2 min @ 50 ◦ C, Ampli Taq Gold DNA polymerase activation 10 min @ 95 ◦ C followed by 40 cycles of 15 s @ 95 ◦ C and 1 min @ 60 ◦ C. Extreme Ct (threshold cycle number) values and ‘no detection’ in some of the samples were discarded prior to the calculation of RQ (relative quantification – RQ) values resulting in unequal number of observations in different groups. For the calculation of the expression levels (RQ values) of different target genes, first the Ct values of target and reference genes were converted to quantity inputs by using the formula 2minimumCt−sampleCt . Expression of the target genes was the ratio of target quantity input to that of geometric mean of quantity inputs of reference genes. 2.6. Statistical analysis Stage of development and source (in vivo or in vitro) were the independent variables and the expression of the genes was the dependent variable. The data from the three replicates was pooled after the Bartlett’s test confirmed the homogeneity of variances. Log10 RQ values were analysed by Two-way ANOVA (General Linear Model – GLM) with unequal number of observations followed by Tukey HSD multiple comparison tests (SPSS version 20, IBM corporation Ltd, USA). P values ≤0.05 were considered significant.
3. Results 3.1. Expression of cell cycle genes in the cumulus cells and the oocytes during in vivo development of ovarian follicles Cyclin B1 (CCNB1) expression in the cumulus cells from in vivo grown follicles remained significantly high and did not change as the preantral follicles developed into antral follicles which then decreased significantly at the large antral follicle stage (Fig. 2A and Table 2). In the oocytes CCNB1 expression increased significantly during the development of PFs’ into early antral follicles, then did not change at the antral follicle stage and increased significantly again at the large antral follicle stage (Fig. 2B and Table 2). Cyclin D1 (CCND1) expression in the cumulus cells remained the same as the preantral follicles developed into to early antral follicles followed by a significant decrease at the antral follicle stage and remained the same as the large antral follicles developed (Fig. 2C and Table 3). Cyclin D1 expression in the oocytes increased significantly as the preantral follicles grew into antral follicles but did not change as the large antral follicle stage was achieved (Fig. 2D and Table 3).
3.2. Expression of cell cycle genes in the cumulus cells and the oocytes during in vitro development of ovarian follicles Cyclin B1 (CCNB1) expression in the cumulus cells showed a significant decrease from PFs’ (PFs’exposed to cultures medium) to early antral follicles (two day cultured PFs’) (Fig. 2A and Table 2) followed by significant increase in the antral follicles (four day cultured follicles) and a significant decrease in the large antral follicles (six day cultured PFs’) (Fig. 2A and Table 2). CCNB1 expression in the oocytes increased significantly as the PFs’ developed in culture into antral follicles followed by significant decrease as the large antral follicle stage was reached (Fig. 2B and Table 2). The expression of CCNB1 in the cumulus cells from COCs’ in in vivo grown large antral follicles that were subjected to 24 h of
H. Large antral follicle (700 m and above in diameter). I. Preantral follicles cultured for 6 days. J. Cumulus oocyte complex from large antral follicles. K. Cumulus oocyte complex from 6 day cultured follicles. L. Oocyte obtained from cumulus oocyte complex of large antral follicles matured in in vitro for 24 h. M. Oocyte obtained from cumulus oocyte complex from 6 day cultured follicle matured in in vitro for 24 h.
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
5
Fig. 2. Expression pattern of cyclin B1 (2A and 2B) and Cyclin D1 (2C and 2D) in the cumulus cells and the oocytes isolated from in vivo and in vitro grown ovarian follicles in sheep. In all the graphs, X-axis denotes different stages of ovarian follicles – preantral, early antral, antral, large antral and COCs from large antral follicles matured in in vitro for 24 h. Y-axis denotes Log10 Relative quantification of gene expression. Values with same alphabetic superscripts with in in vivo or in vitro stages and same numeric superscripts between corresponding in vivo and in vitro stages for each gene are not significantly different (p ≤ 0.05). Table 2 CCNB1 expression in cumulus cells and oocytes isolated from sheep ovarian follicles developed in vivo or in vitro. in vivo stages cumulus cells:
in vitro stages
Preantral follicles (PFs’) Early antral follicles Antral follicles Large antral follicles Cumulus cells from COCs after 24 h of IVM
2.0 ± 0.05a1 2.04 ± 0.03a2 2.09 ± 0.04a4 0.45 ± 0.03b5 1.95 ± 0.05a7
Preantral follicles Early antral follicles Antral follicles Large antral follicles Oocytes from COCs after 24 h of IVM
1.15 ± 0.04a1 1.92 ± 0.03b2 1.76 ± 0.06b3 2.57 ± 0.06c4 1.95 ± 0.14b6
PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM oocytes: PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM
1.59 ± 0.06a1 0.95 ± 0.05b3 2.05 ± 0.05c4 1.10 ± 0.04b6 1.09 ± 0.22b8 1.11 ± 0.01a1 1.50 ± 0.04bd2 2.24 ± 0.15c3 1.73 ± 0.11bd5 1.34 ± 0.04ad7
All values are Log Relative Quantification Values with same alphabetic superscripts in a column with in in vivo or in vitro stages and same numeric superscripts between corresponding in vivo and in vitro stages are not significantly different (p ≤ 0.05). Table 3 CCND1 expression in cumulus cells and oocytes isolated from sheep ovarian follicles developed in vivo or in vitro. in vivo stages cumulus cells: Preantral follicles (PFs’) Early antral follicles Antral follicles Large antral follicles Cumulus cells from COCs after 24 h of IVM oocytes: Preantral follicles Early antral follicles Antral follicles Large antral follicles Oocytes from COCs after 24 h of
in vitro stages 1.24 ± 0.05a1 1.48 ± 0.02a2 0.87 ± 0.03b4 0.80 ± 0.15b5 1.48 ± 0.09a6
PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM
1.17 ± 0.04a1 0.34 ± 0.04b3 0.66 ± 0.03b4 0.85 ± 0.17ab5 1.12 ± 0.217a7
0.27 ± 0.97a1 1.3 ± 0.05b2 2.16 ± 0.08c3 1.88 ± 0.19c5 0.78 ± 0.12a7
PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM
0.0 ± 0.04a1 1.18 ± 0.24b2 1.38 ± 0.133b4 0.49 ± 0.08c6 2.00 ± 0.09d8
All values are Log Relative Quantification. Values with same alphabetic superscripts in a column with in in vivo or in vitro stages and same numeric superscripts between corresponding in vivo and in vitro stages are not significantly different (p ≤ 0.05).
6
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
in vitro maturation increased significantly (Fig. 2A and Table 2) but in the similarly treated COCs’ from in vitro grown large antral follicles (six day cultured follicles) the expression (Fig. 2A and Table 2) did not change. The expression of CCNB1 in the oocytes in COCs’ from both in vivo and in vitro developed large antral follicles matured in vitro for 24 h decreased significantly (Fig. 2 B and Table 2). Cyclin D1 (CCND1) expression in the cumulus cells decreased significantly as PFs’ developed in vitro into early antral follicles followed by a non-significant increase at all subsequent in vitro development stages’ (Fig. 2C and Table 3). CCND1 expression in the oocytes from in vitro grown follicles increased significantly as the PFs’ developed into early antral follicles which, did not change at the antral follicle stage of development (Fig. 2D and Table 3) and then decreased significantly in the large antral follicles (Fig. 2C and Table 3). The expression of CCND1 in the cumulus cells in COCs’ from both in vivo and in vitro grown large antral follicles showed a significant increase (Fig. 2C and Table 3) after 24 h of in vitro maturation. In the oocytes from in vivo developed large antral follicles after 24 h of in vitro maturation, the expression of CCND1 showed a significant decrease (Fig. 2D and Table 3) but in the oocytes in similarly treated COCs from in vitro grown large antral follicles the expression increased significantly (Fig. 2D and Table 3). 3.3. Comparison of the expression of cell cycle genes during in vivo and in vitro development of the ovarian follicles While the quantitative expression of CCNB1 was not significantly different between the cumulus cells isolated from the PFs’ and PFs exposed to the culture medium for 2 min and in vivo vs. in vitro grown antral follicles, it was significantly higher in the in vivo than in vitro developed early antral follicles (Table 2). On the contrary the expression was significantly lower in the cumulus cells from in vivo grown large antral follicles than the in vitro developed ones (Table 2). The expression of CCNB1 between the corresponding development stages of the oocytes isolated from the in vivo grown and cultured ovarian follicles was similar except at the large antral follicle stage where it was significantly higher in the in vivo oocytes (Table 2). CCNB1 expression was significantly higher in both cumulus cells and oocytes in COCs’ derived from in vivo grown than in vitro grown large antral follicles matured in vitro for 24 h (Table 2). Quantitative expression of CCND1 in the cumulus cells isolated from corresponding in vivo and in vitro development stages of the ovarian follicles was similar except in the in vitro developed early antral follicle where it was significantly lower (Table 3). The expression of CCND1 in the oocytes from the in vivo grown follicles was higher at all the stages of development studied (Table 3) although it was not significant at preantral and early antral stages. CCND1 expression was significantly higher in the cumulus cells in COCs’ derived from in vivo than in vitro developed large antral follicles after in vitro maturation for 24 h (Table 3). However in the oocytes derived from in vivo grown large antral follicles matured in vitro for 24 h the expression of CCND1 was significantly lower (Table 3). 4. Discussion Although there are random reports on the expression of cyclins B1 (CCNB1) and D1 (CCND1) in mammalian oocytes and embryos (Josefsberg et al., 2001, 2003; Kuroda et al., 2004; Kohoutek et al., 2004), the present study for the first time systematically investigated the quantitative expression patterns of CCNB1 and CCND1 in the cumulus cells and oocytes at different development stages of in vivo grown and cultured ovarian follicles in mammals (sheep).
In the present study CCNB1 and CCND1 were expressed in cumulus cells as well as oocytes at all the development stages of in vivo and in vitro grown ovarian follicles (Tables 2 and 3). Expression of CCNB1 and CCND1 was reported in the ovaries, oocytes from COCs, immature oocytes, mature oocytes, ovulated and unfertilized eggs and fertilized eggs in different species of mammals (Josefsberg et al., 2001, 2003; Kuroda et al., 2004; Kohoutek et al., 2004). Since Cyclin B1 and D1 are essential for meiotic maturation and early embryonic transition in mammalian oocytes (Taieb et al., 1997; Kuroda et al., 2004), it is conceivable that they are expressed throughout the development of ovarian follicles both in the oocytes as well as the cumulus cells. Cyclin B1 expression did not change in the cumulus cells during in vivo development of preantral follicles to the antral stage indicating that a continuous and constant expression of this cyclin gene supports the multiplication and expansion of the cumulus cells (Cooper and Hausman, 2007). Similarly a decrease in the CCNB1 expression in the cumulus cells at the large antral stage may be related to the fact that the increase in follicle size at this stage being predominantly due to increase in antrum formation and accumulation of follicular fluid (Hirshfield, 1985, 1990), the expression of the cell cycle gene could be temporarily diminished. Similarly stage specific changes observed in the CCNB1 expression in the in vivo grown oocytes are possibly related to germinal vesicle breakdown and meiotic maturation (Robert et al., 2002; Kuroda et al., 2004). CCND1 expression in the cumulus cells from in vivo grown ovarian follicles did not change as the preantral follicles developed into early antral follicles but decreased significantly in the antral and large antral follicles indicating that during antrum formation and accumulation of follicular fluid CCND1 transcripts were not accumulated and/or degraded. A steady increase in the expression of CCND1 in in vivo oocytes from preantral to antral follicles which, remained high at the large antral follicle stage suggests that CCND1 is involved in the oocyte growth and maturation (Musgrove et al., 1993; Kohoutek et al., 2004) as the preantral follicles developed into pre-ovulatory follicles. In vitro culture apparently down regulated the expression of CCNB1and CCND1 both in the cumulus cells and oocytes at some but not all development stages in the present study. Since CCNB1 and CCND1 are key factors in the multiplication and expansion of cumulus cells (Cooper and Hausman, 2007) and in the regulation of germinal vesicle breakdown and meiotic maturation (Josefsberg et al., 2001; Robert et al., 2002) in the mammalian oocytes and since the oocytes in cultured follicles do not attain MII stage as frequently as the in vivo ones do (Arunakumari et al., 2010; Magalhaes et al., 2011), lowered expression of CCNB1and CCND1 in the cumulus cells and oocytes at different development stages of in vitro grown ovarian follicles (Tables 2 and 3) in the present study signposts to a possible cause for the compromised development potential of the mammalian oocytes in the cultured ovarian follicles. Further in vitro culture induced different levels and patterns of expression of CCNB1 in the cumulus cells and oocytes and supported similar levels but different patterns of expression of CCND1 in the cumulus cells and oocytes. Thus the in vitro culture conditions were able to mimic the in vivo situation with reference to cyclin genes expression but to a limited extent. It is reasonable to assume that not only the quantitative levels of expression of cyclin genes but stage specific alterations in the expression of these genes determine the efficiency of the development of ovarian follicles to the ovulatory stage. Nuclear factor Kappa B (NF-kB), insulin, insulin like growth factor I (IGF-I), foetal calf serum (FCS), basic fibroblast growth factor (bFGF) were reported to induce CCNB1 and CCND1 expression in the cultured human cell lines (Musgrove et al., 1993; Hinz et al., 1999). While the present culture medium contained IGFI, the other growth factors/hormones known to stimulate cyclin expression are missing. Obviously modifications to the culture
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
medium/conditions are required to recuperate the expression of cyclin genes on par with in vivo situation. It may be argued that the aberrant expression of cell cycle genes observed in the cultured follicles may be not the cause but the result of the poor development of PFs’ in culture. Since the present RQ values of cell cycle genes are the averages of three sets of samples obtained by pooling of cumulus cells and oocytes from 30 to 50 follicles which were all apparently normal and did not show any signs of degeneration at any development stage studied, it is believed that the subtle changes in gene expression precede gross development abnormalities rather than the other way round. Such an inference is supported by earlier reports on the role of cell cycle genes (Josefsberg et al., 2001, 2003; Kohoutek et al., 2004; Kuroda et al., 2004) in different species of mammals. Future studies on temporal changes in the expression of cell cycle in individual ovarian follicles shall provide the final proof in this connection. It is reasonable to summarise that the expression of cell cycle (present study), apoptosis (Chakravarthi et al., 2015), steroidogenesis (Lakshminarayana et al., 2014) and growth factor (Kona et al., 2016) regulating genes is defective in the cultured ovarian follicles in sheep. Thus the hypothesis that the aberrant expression of developmentally important genes might be an important cause for the compromised development potential of the oocytes in cultured ovarian follicles is defensible. Next endeavour would be to correct the aberrations in the expression of these and other developmentally important genes to improve the in vitro development of ovarian follicles in mammals. Nuclear factor Kappa B (NF-kB), insulin, insulin like growth factor I (IGF-I), foetal calf serum (FCS), basic fibroblast growth factor (bFGF) were reported to induce CCNB1 and CCND1 expression in the cultured human cell lines (Musgrove et al., 1993; Hinz et al., 1999). While the present culture medium contained IGF-I, the other growth factors/hormones known to stimulate cyclin expression are missing. 5. Conclusion It is concluded that the cell cycle genes follow specific patterns of expression during ovarian folliculogenesis synchronous with specific development events and in vitro culture deranged the expression of these genes in the ovarian follicles in sheep. Acknowledgments This work was supported by a research grant from the Council of Scientific and Industrial Research (CSIR) (Grant No. 37 (1483)/11/EMR-II), Government of India to V.H. Rao. V. Praveen Chakravarthi was supported by the University Grants Commission (No. 20-6/2009(I) EU-IV) and Sivasagar Reddy Kona by the Council of Scientific and Industrial Research. Ms. Vagdevi provided the technical assistance. Authors declare no conflict of interest. References Anguita, B., Paramio, M.T., Jimenez-Macedo, A.R., Morato, R., Mogas, T., Izquierdo, D., 2008. Total RNA and protein content, Cyclin B1 expression and developmental competence of prepubertal goat oocytes. Anim. Reprod. Sci. 103, 290–303.
7
Arunakumari, G., Shanmugasundaram, N., Rao, V.H., 2010. Development of morulae from the oocytes of cultured sheep preantral follicles. Theriogenology 74, 884–894. Chakravarthi, V.P., Kona, S.S.R., Siva Kumar, A.V.N., Bhaskar, M., Rao, V.H., 2015. Quantitative patterns of expression of anti and pro apoptotic genes in the in vivo grown and cultured ovarian follicles in sheep. Theriogenology 839, 590–595. Cooper, G.M., Hausman, R.E., 2007. The cell −A molecular approach. In: The Cell Cycle, fourth ed. American Society of Microbiologists Press, Washington, pp. 649–688. Eppig, J.J., Schroeder, A.C., 1989. Capacity of mouse oocytes from preantral follicles to undergo embryogenesis and development to live young after growth maturation, and fertilization in vitro. Biol. Reprod. 41, 268–276. Hinz, M., Krappmann, D., Richten, A., Heder, A., Scheidereit, C., Strauss, M., 1999. NF-kB function in growth control: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol. Cell. Biol. 19, 2690–2698. Hirshfield, A.N., 1985. Comparison of granulosa cell proliferation in small follicles of hypophysectomized, prepubertal, and mature rats. Biol. Reprod. 32, 979–987. Hirshfield, A.N., 1990. Development of follicles in the mammalian ovary. Int. Rev. Cytol. 124, 43–101. Jones, K.T., Lane, S.I., 2013. Molecular causes of aneuploidy in mammalian eggs. Development 140, 3719–3730. Josefsberg, L.B.Y., Kaufman, O., Galiani, D., Kovo, M., Dekel, N., 2001. Inactivation of M-phase promoting factor at exit from first embryonic mitosis in the rat is independent of cyclin B1 degradation. Biol. Reprod. 64, 871–878. Josefsberg, L.B.Y., Galiani, D., Lazar, S., Kaufman, O., Seger, R., Dekel, N., 2003. Maturation-promoting factor governs mitogen-activated protein kinase activation and interphase suppression during meiosis of rat oocytes. Biol. Reprod. 68, 1282–1290. Kamalamma, P., Kona, S.S.R., Chakravarthi, V.P., Kumar, A.S., Punyakumari, B., Rao, V.H., 2016. Effect of leptin on in vitro development of ovine preantral ovarian follicles. Theriogenology 85, 224–229. Kohoutek, J., Dvorak, P., Hamp, A., 2004. Temporal distribution of CDK4, CDK6, D-type cyclins, and p27 in developing mouse oocytes. Biol. Reprod. 70, 139–145. Kona, S.S.R., Chakravarthi, V.P., Siva Kumar, A.V.N., Srividya, D., Padmaja, K., Rao, V.H., 2016. Quantitative expression patterns of GDF9 and BMP15 genes in sheep ovarian follicles grown in vivo or cultured in vitro. Theriogenology 85, 315–322. Kuroda, T., Naito, K., Sugiura, K., Yamashita, M., Takakura, I., Tojo, H., 2004. Analysis of the roles of cyclin B1 and cyclin B2 in porcine oocyte maturation by inhibiting synthesis with antisense RNA injection. Biol. Reprod. 70, 154–159. Lakshminarayana, B.N.V., Chakravarthi, V.P., Brahmaiah, K.V., Rao, V.H., 2014. Quantification of P450 aromatase gene expression in cultured and in vivo grown ovarian follicles in sheep. Small Rumin. Res. 117, 66–72. Liu, K., Rajareddy, S., Liu, L., Jagarlamudi, K., Boman, K., Selstam, G., Reddy, P., 2006. Control of mammalian oocyte growth and early follicular development by the oocyte PI3 kinase pathway: new roles for an old timer. Dev. Biol. 299, 1–11. Magalhaes, D.M., Duarte, A.B., Araujo, V.R., 2011. In vitro production of a caprine embryo from a preantral follicle cultured in media supplemented with growth hormone. Theriogenology 75, 182–188. Mamo, S., Gal, A.B., Polgar, Z., Dinnyes, A., 2008. Expression profiles of the pluripotency marker gene POU5F1 and validation of reference genes in rabbit oocytes and pre implantation stage embryos. BMC Mol. Biol. 9, 67. Moore, G.D., Ayabe, T., Kopf, G.S., Schultz, R.M., 1996. Temporal patterns of gene expression of G1-S cyclins and CDKs during the first and second mitotic cell cycles in mouse embryos. Mol. Reprod. Dev. 45, 264–275. Murray, A.W., 2014. Recycling the cell cycle: cyclins revisited. Cell 116, 221–234. Musgrove, E.A., Hmilton, J.A., Lee, C.S., Sweene, K.J., Watts, C.K., Sutherland, R.L., 1993. Growth factor, steroid and steroid antagonist regulation of cyclin gene expression associated with changes in T-47D human breast cancer cell cycle progression. Mol. Cell. Biol. 13, 3577–3587. Rao, B.S., Naidu, K.S., Amarnath, D., Vagdevi, R., Rao, A.S., Bramaiah, K.V., Rao, V.H., 2002. In vitro maturation of sheep oocytes in different media during breeding and non-breeding seasons. Small Rumin. Res. 43, 31–36. Robert, C., McGraw, S., Massicotte, L., Pravetoni, M., Gandolfi, F., Sirard, M.A., 2002. Quantification of housekeeping transcript levels during the development of bovine preimplantation embryos. Biol. Reprod. 67, 1465–1472. Taieb, F., Thibier, C., Jessus, C., 1997. On cyclins, oocytes, and eggs. Mol. Reprod. Dev. 48, 397–411.
Contents lists available at ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Stage specific expression of cell cycle genes during in vivo or in vitro development of ovarian follicles in sheep V. Praveen Chakravarthi a , S.S.R. Kona a , A.V.N. Siva Kumar a , M. Bhaskara b , V.H. Rao a,∗ a b
Embryo Biotechnology Laboratory, Department of Physiology, College of Veterinary Science, Tirupati, 517502, India Department of Biotechnology and Department of Zoology, Sri Venkateswara University, Tirupati, India
a r t i c l e
i n f o
Article history: Received 17 November 2015 Received in revised form 4 August 2016 Accepted 16 August 2016 Available online 17 August 2016 Keywords: Cell cycle Preantral follicles Sheep In vitro culture Cyclins
a b s t r a c t Quantitative expression patterns of cell cycle genes (CCNB1 and CCND1) were studied at different in vivo and corresponding in vitro stages of development of ovarian follicles in sheep. In the cumulus cells from in vivo grown ovarian follicles, the expression of CCNB1 and CCND1 decreased significantly at the large antral stage relative to all the other stages of development except the decrease in CCND1 from antral to large antral stage. However, in the cumulus cells from in vitro cultured ovarian follicles, such significant decrease in the expression of CCNB1 and CCND1 was absent. The expression of CCNB1 and CCND1 in the oocytes from in vivo grown ovarian follicles increased significantly up to the large antral stage. In the oocytes from in vitro grown ovarian follicles, however, the pattern of expression of these genes was different. In vitro maturation of cumulus oocyte complexes (COCs) for 24 h stimulated the expression of CCNB1 and CCND1 in the cumulus cells derived from both in vivo and in vitro grown ovarian follicles. In similarly treated oocytes, while the CCND1 expression was unaffected, the expression of CCNB1 was suppressed. It is concluded that the cell cycle genes follow specific patterns of expression during ovarian folliculogenesis synchronous with different development events. In vitro culture deranged the expression patterns of these genes. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Quantitative expression studies of genes reveal molecular mechanisms underlying important development activities including the ovarian folliculogenesis. While there are random reports on the expression of several genes during folliculogenesis in mammals (Kuroda et al., 2004; Jones and Lane, 2013), systematic studies on the evolution of quantitative expression of developmentally important genes as the ovarian follicles develop from preantral to Graafian follicle stage are only beginning to be reported (Chakravarthi et al., 2015; Kona et al., 2016). In eukaryotes, four types of cyclins (A, B, D and E) in association with different cyclin-dependent kinases (CDKs) regulate the cell cycle (Murray, 2014; Cooper and Hausman, 2007). Cyclin B1 (CCNB1) was reportedly the principal molecule in the initiation of germinal vesicle break down (GVBD) and meiotic maturation in the pig and goat oocytes (Kuroda et al., 2004; and Anguita et al., 2008).
∗ Corresponding author. E-mail addresses: [email protected], [email protected] (V.H. Rao). http://dx.doi.org/10.1016/j.smallrumres.2016.08.011 0921-4488/© 2016 Elsevier B.V. All rights reserved.
Similarly cyclin D1 (CCND1) expression increased during the second meiotic division in the mouse oocytes (Moore et al., 1996). Expression of other cyclin genes in the oocytes or granulosa cells at a few discrete stages of development during folliculogenesis in the mouse was reported (Moore et al., 1996; Liu et al., 2006). However, there are no reports on the evolution of quantitative patterns of expression of CCNB1 or D1 as the mammalian preantral follicles developed to Graafian follicle stage. To enhance the utilization of female germplasm in animals and as a potential restorative measure of fertility in women subjected to chemotherapy, in vitro embryogenesis from the oocytes in cultured preantral follicles (PFs’) is being actively pursued (see Kamalamma et al., 2016 for a review). While live offspring could be produced from the oocytes in cultured PFs’ after in vitro fertilization and embryo transfer in the mouse (Eppig and Schroeder, 1989), such a feat remains to be achieved in other species of laboratory and domestic mammals. Further the frequency of meiotic maturation and embryo production from the oocytes in cultured PFs’ in mammals including the mouse has been modest (Arunakumari et al., 2010). It was therefore, hypothesized that deranged expression of developmentally important genes might explain the compromised development of the oocytes in the cultured ovarian follicles
2
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
(Arunakumari et al., 2010). However, paucity of information on the expression patterns of developmentally important genes in the cultured ovarian follicles in mammals is even more acute. Only recently aberrant expression of a few of the key genes involved in steroidogenesis (Lakshminarayana et al., 2014), apoptosis (Chakravarthi et al., 2015) and growth factors (Kona et al., 2016) in the cultured ovarian follicles in sheep was reported from the laboratory. In view of the significance of CCNB1 and D1 to the ovarian folliculogenesis and paucity of information on the expression patterns of these genes during the development of ovarian follicles in mammals, the present study investigated the quantitative expression of cyclin B1 (CCNB1) and D1 (CCND1) genes in the cumulus cells and oocytes separately during the in vivo development of preantral follicles to the Graafian follicle stage and compared such expression at corresponding stages of development of the cultured follicles in sheep. 2. Materials and methods This study was undertaken as per the guidelines of the institutional research and ethics committees. Unless otherwise stated, culture media, hormones, growth factors, foetal calf serum (FCS) and all the other chemicals used in this study were purchased from Sigma Chemical Co. (St. Louis, MO, USA) and plastics from Nunclon (Roskilde, Denmark). All the hormones and growth factors used were cell culture tested and endotoxin free. All the procedures employed were as reported from the laboratory earlier (Kona et al., 2016; Kamalamma et al., 2016). However, a brief but adequate description of all the methods employed in this study is described hereunder. 2.1. Collection of ovaries and isolation of different stages of follicles A total of 750 ovaries collected on 126 different days during a period of 7 months were used in the present study. On each day of the study, 5–10 pairs of sheep ovaries recovered at slaughter were transported to the laboratory in sterile, warm (37 ◦ C) phosphate buffered saline (PBS). The ovaries were trimmed off adherent tissues and ligaments and washed twice in the handling medium [HEPES buffered tissue culture medium 199 (TCM 199H) supplemented with 0.23 mM of sodium pyruvate, 2 mM L-Glutamine and 50 g/ml Gentamycin sulphate]. All the subsequent procedures were carried out in a laminar air flow. Ovaries were cut into two halves along their longitudinal axis and medulla was removed by cutting along the dotted lines shown in Fig. 1 A. Subsequently the ovarian cortices were cut into thin slices with a surgical blade. Intact preantral, early antral, antral and large antral follicles were mechanically isolated from the thin ovarian cortical slices (Fig. 1B, D, F, H) by micro-dissection under a stereoscopic-zoom microscope. From each ovary 5–10 preantral, 5–10 early antral, 3–5 antral and 1–2 large antral follicles could be routinely isolated. 2.2. Selection and culture of preantral follicles Intact preantral follicles (250–400 m) having centrally placed, spherical oocytes with no apparent signs of degeneration and with intact basement membrane were selected for the culture (Fig. 1B). Bicarbonate buffered tissue culture medium 199 (TCM199B) supplemented with 50 g/ml gentamycin sulphate, 1 g/ml Thyroxin (T4 ), 2.5 g/ml follicle stimulating hormone (FSH), 10 ng/ml Insulin like Growth factor-1 (IGF-1), 1 mIU/ml of growth hormone (GH), which supported the best development in vitro of PF’s and maturation of oocytes to metaphase-II stage earlier (Arunakumari et al.,
2010) was used in this study to culture the PF’s. The selected follicles were washed thrice in the culture medium and subsequently placed individually in 20 l droplets of the culture medium in 35 mm plastic culture dishes (Nunc, 15066). To avoid evaporation of the medium, the micro droplets were overlaid with autoclaved light weight mineral oil (SigmaM 8410) pre-equilibrated with the medium over night at 39 ◦ C in 5% CO2 in air. These culture dishes were incubated at 39 ◦ C under humidified (≥95%) atmosphere of 5% CO2 in air for up to 6 days. Half the medium was replaced by an equal volume of fresh medium every 48 h. Each follicle was morphologically evaluated every 24 h during the culture period using an inverted microscope and the follicles exhibiting degenerative changes or stopped growing were removed. In vivo and in vitro grown ovarian follicles at morphologically similar development stages (Fig. 1) were carefully opened using two 26 gauge needles to release the cumulus oocyte complexes (COCs) (Fig. 1J and K). The oocytes were denuded of the cumulus cells by repeated pipetting through a marrow bore glass pipette. However, COCs from in vivo grown large antral follicles and PFs’ cultured for six days were matured in vitro for additional 24 h as described below. 2.3. In vitro maturation (IVM) of COCs obtained from in vivo grown large antral and six-day cultured follicles Procedures for the IVM were as developed in the laboratory (Rao et al., 2002). Briefly after washing three times in the maturation medium (TCM199 B supplemented with 10 g/ml FSH, 10 g/ml Luteinizing hormone, 1 g/ml estradiol-17, 50 g/ml gentamycin sulphate, 10 g/ml bovine serum albumin (BSA) (A8412,Sigma,USA) and 10% (v/v) oestrous sheep serum), the COCs were individually placed in 20 l droplets of the same medium in 35 mm plastic culture dishes, covered with pre-equilibrated light weight mineral oil, and incubated for 24 h as described above. At the end of IVM, the oocytes were denuded of the cumulus cells by repeated pipetting through a fine bore glass pipette and used for further processing. 2.4. Experimental design Quantitative expression of CCNB1 and CCND1 genes was studied at different development stages of the in vivo grown and corresponding stages of the cultured ovarian follicles (Fig. 1). The entire experiment was repeated thrice. Triplicate samples of complementary DNA (cDNA) from each replicate of the experiment (3 × 3 = 9 cDNA samples for each in vivo and in vitro stage) were subjected to reverse transcription quantitative polymerase chain reaction (RTqPCR). 2.5. RNA isolation, reverse transcription (RT) and real time PCR Cumulus cells and oocytes from 30 to 50 follicles collected on the same day but from different ovaries were pooled at each in vivo and corresponding in vitro stage of development (Fig. 1) for the isolation of total RNA (Chakravarthi et al., 2015; Kona et al., 2016). Isolation of RNA was carried out by using Medox-Easy spin column Total RNA Mini prep Kit according to the manufacturer’s instructions (Medox Biotech India Pvt. Ltd., Chennai, India) as described in detail in an earlier report from the laboratory (Kona et al., 2016). Concentration and purity of RNA was determined using Nanodrop lite (Thermoscientific S.No.1354). RNA samples having purity (Absorbance at 260/280) in the range of 1.8-2.1 only were used in the expression studies. Reverse transcription reaction was carried out for 10 min at 25 ◦ C, 120 min at 37 ◦ C and 5 min at 85 ◦ C in a thermocycler using high capacity reverse transcription kits (Applied biosystems, USA) according to the manufacturer’s instructions.
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
Fig. 1. Different in vivo and morphologically corresponding in vitro stages of development of ovarian follicles in sheep. A. Ovaries cut into two halves along their longitudinal axis and removal of medulla by cutting along the dotted lines. B. Preantral follicles at isolation 250–400 m in diameter. C. Preantral follicles exposed to culture media for 3 min. D. Early antral follicles (400–500 m in diameter). E. Preantral follicles cultured for 2 days. F. Antral follicles (500–700 m in diameter). G. Preantral follicles cultured for 4 days.
3
4
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
Table 1 Primers and probes for cyclin, gap junction and reference genes. Gene name Cell cycle genes
Symbol
Primers and probe sequences
Accession Number
Source
CyclinD1
CCND1
EU525165
Cyclin B1
CCNB1
F.primer: GTGGCCTCGAAGATGAAGGA R.primer: CGGACGGAGTTGTCAGTGTAG Probe: FAMACGCACAGCTTCTCGNFQ F.primer: TAATTGATCGGTTCATGCAGGAT R.primer: TGCAACAAACATGGCAGTGA Probe:VIC-AGCTGCAGCATCTTCTTGGGCAC—BBQ
Applied Bio systems (Assay on Demand; lot nos: AI7ZZLH) TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany)
F.primer: GCTCGAGATGTGATGAAGGAGAT
AF176419
TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany)
AM711875.1
TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany) TIB MOLBIOL (Synthase labor GmbH, Berlin, Germany)
Reference (House Keeping) Genes HPRT1 Hypoxanthine-guanine phosphoribosyl transferase
18S ribosomal RNA
18SrRNA
Large ribosomal protein
RPLPO
R. primer: TCCAACAGGTCGGCAAAGAA Probe: 6FAM-AGCCCCCCTTGAGCACACAGA—BBQ F.primer: AACAATACAGGACTCTTTCGAGGC R. primer:CAGACTTGCCCTCCAATGGA Probe: 6 FAM-CCACTTTAAATCCTTCCGCGAGGAT-BBQ F.primer: GCTCTGGAGAAACTGTTGCC R. primer: CCAGCAGCATGTCCCTGAT Probe: 6FAM-AGGTCCTCCTTGGTGAACACGAAGC-BBQ
XM-004016916
NM 001012682
FAM: 6 Carboxy fluorescein; VIC: proprietary to Life technologies; NFQ: Non fluorescent Quencher; BBQ: Black Berry Quencher.
In a comparison of twelve commonly used reference genes RPLPO, HPRT1 and 18SrRNA were the three most stably expressed genes in the sheep ovarian follicles under the current experimental conditions (unpublished observations in the laboratory). Therefore, the geometric mean of these three genes (Mamo et al., 2008) was used as the normalizer in the analysis of the expression of cell cycle genes. Primer and probe details for CCNB1 and CCND1genes and the reference genes are given in Table 1. Real-time RT-qPCR was performed on Applied Biosystems 7500 machine. Each 25 l reaction mix contained 12.5 l of Taq Man Universal PCR Master mix (2x), 1.25 l of 20X gene expression assay mixture, 10 ng of cDNA sample in nuclease free water. Thermal cycling conditions were Erase UNG (Uracil N- glycosylase) Activation 2 min @ 50 ◦ C, Ampli Taq Gold DNA polymerase activation 10 min @ 95 ◦ C followed by 40 cycles of 15 s @ 95 ◦ C and 1 min @ 60 ◦ C. Extreme Ct (threshold cycle number) values and ‘no detection’ in some of the samples were discarded prior to the calculation of RQ (relative quantification – RQ) values resulting in unequal number of observations in different groups. For the calculation of the expression levels (RQ values) of different target genes, first the Ct values of target and reference genes were converted to quantity inputs by using the formula 2minimumCt−sampleCt . Expression of the target genes was the ratio of target quantity input to that of geometric mean of quantity inputs of reference genes. 2.6. Statistical analysis Stage of development and source (in vivo or in vitro) were the independent variables and the expression of the genes was the dependent variable. The data from the three replicates was pooled after the Bartlett’s test confirmed the homogeneity of variances. Log10 RQ values were analysed by Two-way ANOVA (General Linear Model – GLM) with unequal number of observations followed by Tukey HSD multiple comparison tests (SPSS version 20, IBM corporation Ltd, USA). P values ≤0.05 were considered significant.
3. Results 3.1. Expression of cell cycle genes in the cumulus cells and the oocytes during in vivo development of ovarian follicles Cyclin B1 (CCNB1) expression in the cumulus cells from in vivo grown follicles remained significantly high and did not change as the preantral follicles developed into antral follicles which then decreased significantly at the large antral follicle stage (Fig. 2A and Table 2). In the oocytes CCNB1 expression increased significantly during the development of PFs’ into early antral follicles, then did not change at the antral follicle stage and increased significantly again at the large antral follicle stage (Fig. 2B and Table 2). Cyclin D1 (CCND1) expression in the cumulus cells remained the same as the preantral follicles developed into to early antral follicles followed by a significant decrease at the antral follicle stage and remained the same as the large antral follicles developed (Fig. 2C and Table 3). Cyclin D1 expression in the oocytes increased significantly as the preantral follicles grew into antral follicles but did not change as the large antral follicle stage was achieved (Fig. 2D and Table 3).
3.2. Expression of cell cycle genes in the cumulus cells and the oocytes during in vitro development of ovarian follicles Cyclin B1 (CCNB1) expression in the cumulus cells showed a significant decrease from PFs’ (PFs’exposed to cultures medium) to early antral follicles (two day cultured PFs’) (Fig. 2A and Table 2) followed by significant increase in the antral follicles (four day cultured follicles) and a significant decrease in the large antral follicles (six day cultured PFs’) (Fig. 2A and Table 2). CCNB1 expression in the oocytes increased significantly as the PFs’ developed in culture into antral follicles followed by significant decrease as the large antral follicle stage was reached (Fig. 2B and Table 2). The expression of CCNB1 in the cumulus cells from COCs’ in in vivo grown large antral follicles that were subjected to 24 h of
H. Large antral follicle (700 m and above in diameter). I. Preantral follicles cultured for 6 days. J. Cumulus oocyte complex from large antral follicles. K. Cumulus oocyte complex from 6 day cultured follicles. L. Oocyte obtained from cumulus oocyte complex of large antral follicles matured in in vitro for 24 h. M. Oocyte obtained from cumulus oocyte complex from 6 day cultured follicle matured in in vitro for 24 h.
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
5
Fig. 2. Expression pattern of cyclin B1 (2A and 2B) and Cyclin D1 (2C and 2D) in the cumulus cells and the oocytes isolated from in vivo and in vitro grown ovarian follicles in sheep. In all the graphs, X-axis denotes different stages of ovarian follicles – preantral, early antral, antral, large antral and COCs from large antral follicles matured in in vitro for 24 h. Y-axis denotes Log10 Relative quantification of gene expression. Values with same alphabetic superscripts with in in vivo or in vitro stages and same numeric superscripts between corresponding in vivo and in vitro stages for each gene are not significantly different (p ≤ 0.05). Table 2 CCNB1 expression in cumulus cells and oocytes isolated from sheep ovarian follicles developed in vivo or in vitro. in vivo stages cumulus cells:
in vitro stages
Preantral follicles (PFs’) Early antral follicles Antral follicles Large antral follicles Cumulus cells from COCs after 24 h of IVM
2.0 ± 0.05a1 2.04 ± 0.03a2 2.09 ± 0.04a4 0.45 ± 0.03b5 1.95 ± 0.05a7
Preantral follicles Early antral follicles Antral follicles Large antral follicles Oocytes from COCs after 24 h of IVM
1.15 ± 0.04a1 1.92 ± 0.03b2 1.76 ± 0.06b3 2.57 ± 0.06c4 1.95 ± 0.14b6
PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM oocytes: PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM
1.59 ± 0.06a1 0.95 ± 0.05b3 2.05 ± 0.05c4 1.10 ± 0.04b6 1.09 ± 0.22b8 1.11 ± 0.01a1 1.50 ± 0.04bd2 2.24 ± 0.15c3 1.73 ± 0.11bd5 1.34 ± 0.04ad7
All values are Log Relative Quantification Values with same alphabetic superscripts in a column with in in vivo or in vitro stages and same numeric superscripts between corresponding in vivo and in vitro stages are not significantly different (p ≤ 0.05). Table 3 CCND1 expression in cumulus cells and oocytes isolated from sheep ovarian follicles developed in vivo or in vitro. in vivo stages cumulus cells: Preantral follicles (PFs’) Early antral follicles Antral follicles Large antral follicles Cumulus cells from COCs after 24 h of IVM oocytes: Preantral follicles Early antral follicles Antral follicles Large antral follicles Oocytes from COCs after 24 h of
in vitro stages 1.24 ± 0.05a1 1.48 ± 0.02a2 0.87 ± 0.03b4 0.80 ± 0.15b5 1.48 ± 0.09a6
PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM
1.17 ± 0.04a1 0.34 ± 0.04b3 0.66 ± 0.03b4 0.85 ± 0.17ab5 1.12 ± 0.217a7
0.27 ± 0.97a1 1.3 ± 0.05b2 2.16 ± 0.08c3 1.88 ± 0.19c5 0.78 ± 0.12a7
PFs’ exposed to culture medium Two day cultured PFs’ Four day cultured PFs’ Six day cultured PFs’ COCs from six day cultured PFs’ after 24 h of IVM
0.0 ± 0.04a1 1.18 ± 0.24b2 1.38 ± 0.133b4 0.49 ± 0.08c6 2.00 ± 0.09d8
All values are Log Relative Quantification. Values with same alphabetic superscripts in a column with in in vivo or in vitro stages and same numeric superscripts between corresponding in vivo and in vitro stages are not significantly different (p ≤ 0.05).
6
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
in vitro maturation increased significantly (Fig. 2A and Table 2) but in the similarly treated COCs’ from in vitro grown large antral follicles (six day cultured follicles) the expression (Fig. 2A and Table 2) did not change. The expression of CCNB1 in the oocytes in COCs’ from both in vivo and in vitro developed large antral follicles matured in vitro for 24 h decreased significantly (Fig. 2 B and Table 2). Cyclin D1 (CCND1) expression in the cumulus cells decreased significantly as PFs’ developed in vitro into early antral follicles followed by a non-significant increase at all subsequent in vitro development stages’ (Fig. 2C and Table 3). CCND1 expression in the oocytes from in vitro grown follicles increased significantly as the PFs’ developed into early antral follicles which, did not change at the antral follicle stage of development (Fig. 2D and Table 3) and then decreased significantly in the large antral follicles (Fig. 2C and Table 3). The expression of CCND1 in the cumulus cells in COCs’ from both in vivo and in vitro grown large antral follicles showed a significant increase (Fig. 2C and Table 3) after 24 h of in vitro maturation. In the oocytes from in vivo developed large antral follicles after 24 h of in vitro maturation, the expression of CCND1 showed a significant decrease (Fig. 2D and Table 3) but in the oocytes in similarly treated COCs from in vitro grown large antral follicles the expression increased significantly (Fig. 2D and Table 3). 3.3. Comparison of the expression of cell cycle genes during in vivo and in vitro development of the ovarian follicles While the quantitative expression of CCNB1 was not significantly different between the cumulus cells isolated from the PFs’ and PFs exposed to the culture medium for 2 min and in vivo vs. in vitro grown antral follicles, it was significantly higher in the in vivo than in vitro developed early antral follicles (Table 2). On the contrary the expression was significantly lower in the cumulus cells from in vivo grown large antral follicles than the in vitro developed ones (Table 2). The expression of CCNB1 between the corresponding development stages of the oocytes isolated from the in vivo grown and cultured ovarian follicles was similar except at the large antral follicle stage where it was significantly higher in the in vivo oocytes (Table 2). CCNB1 expression was significantly higher in both cumulus cells and oocytes in COCs’ derived from in vivo grown than in vitro grown large antral follicles matured in vitro for 24 h (Table 2). Quantitative expression of CCND1 in the cumulus cells isolated from corresponding in vivo and in vitro development stages of the ovarian follicles was similar except in the in vitro developed early antral follicle where it was significantly lower (Table 3). The expression of CCND1 in the oocytes from the in vivo grown follicles was higher at all the stages of development studied (Table 3) although it was not significant at preantral and early antral stages. CCND1 expression was significantly higher in the cumulus cells in COCs’ derived from in vivo than in vitro developed large antral follicles after in vitro maturation for 24 h (Table 3). However in the oocytes derived from in vivo grown large antral follicles matured in vitro for 24 h the expression of CCND1 was significantly lower (Table 3). 4. Discussion Although there are random reports on the expression of cyclins B1 (CCNB1) and D1 (CCND1) in mammalian oocytes and embryos (Josefsberg et al., 2001, 2003; Kuroda et al., 2004; Kohoutek et al., 2004), the present study for the first time systematically investigated the quantitative expression patterns of CCNB1 and CCND1 in the cumulus cells and oocytes at different development stages of in vivo grown and cultured ovarian follicles in mammals (sheep).
In the present study CCNB1 and CCND1 were expressed in cumulus cells as well as oocytes at all the development stages of in vivo and in vitro grown ovarian follicles (Tables 2 and 3). Expression of CCNB1 and CCND1 was reported in the ovaries, oocytes from COCs, immature oocytes, mature oocytes, ovulated and unfertilized eggs and fertilized eggs in different species of mammals (Josefsberg et al., 2001, 2003; Kuroda et al., 2004; Kohoutek et al., 2004). Since Cyclin B1 and D1 are essential for meiotic maturation and early embryonic transition in mammalian oocytes (Taieb et al., 1997; Kuroda et al., 2004), it is conceivable that they are expressed throughout the development of ovarian follicles both in the oocytes as well as the cumulus cells. Cyclin B1 expression did not change in the cumulus cells during in vivo development of preantral follicles to the antral stage indicating that a continuous and constant expression of this cyclin gene supports the multiplication and expansion of the cumulus cells (Cooper and Hausman, 2007). Similarly a decrease in the CCNB1 expression in the cumulus cells at the large antral stage may be related to the fact that the increase in follicle size at this stage being predominantly due to increase in antrum formation and accumulation of follicular fluid (Hirshfield, 1985, 1990), the expression of the cell cycle gene could be temporarily diminished. Similarly stage specific changes observed in the CCNB1 expression in the in vivo grown oocytes are possibly related to germinal vesicle breakdown and meiotic maturation (Robert et al., 2002; Kuroda et al., 2004). CCND1 expression in the cumulus cells from in vivo grown ovarian follicles did not change as the preantral follicles developed into early antral follicles but decreased significantly in the antral and large antral follicles indicating that during antrum formation and accumulation of follicular fluid CCND1 transcripts were not accumulated and/or degraded. A steady increase in the expression of CCND1 in in vivo oocytes from preantral to antral follicles which, remained high at the large antral follicle stage suggests that CCND1 is involved in the oocyte growth and maturation (Musgrove et al., 1993; Kohoutek et al., 2004) as the preantral follicles developed into pre-ovulatory follicles. In vitro culture apparently down regulated the expression of CCNB1and CCND1 both in the cumulus cells and oocytes at some but not all development stages in the present study. Since CCNB1 and CCND1 are key factors in the multiplication and expansion of cumulus cells (Cooper and Hausman, 2007) and in the regulation of germinal vesicle breakdown and meiotic maturation (Josefsberg et al., 2001; Robert et al., 2002) in the mammalian oocytes and since the oocytes in cultured follicles do not attain MII stage as frequently as the in vivo ones do (Arunakumari et al., 2010; Magalhaes et al., 2011), lowered expression of CCNB1and CCND1 in the cumulus cells and oocytes at different development stages of in vitro grown ovarian follicles (Tables 2 and 3) in the present study signposts to a possible cause for the compromised development potential of the mammalian oocytes in the cultured ovarian follicles. Further in vitro culture induced different levels and patterns of expression of CCNB1 in the cumulus cells and oocytes and supported similar levels but different patterns of expression of CCND1 in the cumulus cells and oocytes. Thus the in vitro culture conditions were able to mimic the in vivo situation with reference to cyclin genes expression but to a limited extent. It is reasonable to assume that not only the quantitative levels of expression of cyclin genes but stage specific alterations in the expression of these genes determine the efficiency of the development of ovarian follicles to the ovulatory stage. Nuclear factor Kappa B (NF-kB), insulin, insulin like growth factor I (IGF-I), foetal calf serum (FCS), basic fibroblast growth factor (bFGF) were reported to induce CCNB1 and CCND1 expression in the cultured human cell lines (Musgrove et al., 1993; Hinz et al., 1999). While the present culture medium contained IGFI, the other growth factors/hormones known to stimulate cyclin expression are missing. Obviously modifications to the culture
V.P. Chakravarthi et al. / Small Ruminant Research 143 (2016) 1–7
medium/conditions are required to recuperate the expression of cyclin genes on par with in vivo situation. It may be argued that the aberrant expression of cell cycle genes observed in the cultured follicles may be not the cause but the result of the poor development of PFs’ in culture. Since the present RQ values of cell cycle genes are the averages of three sets of samples obtained by pooling of cumulus cells and oocytes from 30 to 50 follicles which were all apparently normal and did not show any signs of degeneration at any development stage studied, it is believed that the subtle changes in gene expression precede gross development abnormalities rather than the other way round. Such an inference is supported by earlier reports on the role of cell cycle genes (Josefsberg et al., 2001, 2003; Kohoutek et al., 2004; Kuroda et al., 2004) in different species of mammals. Future studies on temporal changes in the expression of cell cycle in individual ovarian follicles shall provide the final proof in this connection. It is reasonable to summarise that the expression of cell cycle (present study), apoptosis (Chakravarthi et al., 2015), steroidogenesis (Lakshminarayana et al., 2014) and growth factor (Kona et al., 2016) regulating genes is defective in the cultured ovarian follicles in sheep. Thus the hypothesis that the aberrant expression of developmentally important genes might be an important cause for the compromised development potential of the oocytes in cultured ovarian follicles is defensible. Next endeavour would be to correct the aberrations in the expression of these and other developmentally important genes to improve the in vitro development of ovarian follicles in mammals. Nuclear factor Kappa B (NF-kB), insulin, insulin like growth factor I (IGF-I), foetal calf serum (FCS), basic fibroblast growth factor (bFGF) were reported to induce CCNB1 and CCND1 expression in the cultured human cell lines (Musgrove et al., 1993; Hinz et al., 1999). While the present culture medium contained IGF-I, the other growth factors/hormones known to stimulate cyclin expression are missing. 5. Conclusion It is concluded that the cell cycle genes follow specific patterns of expression during ovarian folliculogenesis synchronous with specific development events and in vitro culture deranged the expression of these genes in the ovarian follicles in sheep. Acknowledgments This work was supported by a research grant from the Council of Scientific and Industrial Research (CSIR) (Grant No. 37 (1483)/11/EMR-II), Government of India to V.H. Rao. V. Praveen Chakravarthi was supported by the University Grants Commission (No. 20-6/2009(I) EU-IV) and Sivasagar Reddy Kona by the Council of Scientific and Industrial Research. Ms. Vagdevi provided the technical assistance. Authors declare no conflict of interest. References Anguita, B., Paramio, M.T., Jimenez-Macedo, A.R., Morato, R., Mogas, T., Izquierdo, D., 2008. Total RNA and protein content, Cyclin B1 expression and developmental competence of prepubertal goat oocytes. Anim. Reprod. Sci. 103, 290–303.
7
Arunakumari, G., Shanmugasundaram, N., Rao, V.H., 2010. Development of morulae from the oocytes of cultured sheep preantral follicles. Theriogenology 74, 884–894. Chakravarthi, V.P., Kona, S.S.R., Siva Kumar, A.V.N., Bhaskar, M., Rao, V.H., 2015. Quantitative patterns of expression of anti and pro apoptotic genes in the in vivo grown and cultured ovarian follicles in sheep. Theriogenology 839, 590–595. Cooper, G.M., Hausman, R.E., 2007. The cell −A molecular approach. In: The Cell Cycle, fourth ed. American Society of Microbiologists Press, Washington, pp. 649–688. Eppig, J.J., Schroeder, A.C., 1989. Capacity of mouse oocytes from preantral follicles to undergo embryogenesis and development to live young after growth maturation, and fertilization in vitro. Biol. Reprod. 41, 268–276. Hinz, M., Krappmann, D., Richten, A., Heder, A., Scheidereit, C., Strauss, M., 1999. NF-kB function in growth control: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol. Cell. Biol. 19, 2690–2698. Hirshfield, A.N., 1985. Comparison of granulosa cell proliferation in small follicles of hypophysectomized, prepubertal, and mature rats. Biol. Reprod. 32, 979–987. Hirshfield, A.N., 1990. Development of follicles in the mammalian ovary. Int. Rev. Cytol. 124, 43–101. Jones, K.T., Lane, S.I., 2013. Molecular causes of aneuploidy in mammalian eggs. Development 140, 3719–3730. Josefsberg, L.B.Y., Kaufman, O., Galiani, D., Kovo, M., Dekel, N., 2001. Inactivation of M-phase promoting factor at exit from first embryonic mitosis in the rat is independent of cyclin B1 degradation. Biol. Reprod. 64, 871–878. Josefsberg, L.B.Y., Galiani, D., Lazar, S., Kaufman, O., Seger, R., Dekel, N., 2003. Maturation-promoting factor governs mitogen-activated protein kinase activation and interphase suppression during meiosis of rat oocytes. Biol. Reprod. 68, 1282–1290. Kamalamma, P., Kona, S.S.R., Chakravarthi, V.P., Kumar, A.S., Punyakumari, B., Rao, V.H., 2016. Effect of leptin on in vitro development of ovine preantral ovarian follicles. Theriogenology 85, 224–229. Kohoutek, J., Dvorak, P., Hamp, A., 2004. Temporal distribution of CDK4, CDK6, D-type cyclins, and p27 in developing mouse oocytes. Biol. Reprod. 70, 139–145. Kona, S.S.R., Chakravarthi, V.P., Siva Kumar, A.V.N., Srividya, D., Padmaja, K., Rao, V.H., 2016. Quantitative expression patterns of GDF9 and BMP15 genes in sheep ovarian follicles grown in vivo or cultured in vitro. Theriogenology 85, 315–322. Kuroda, T., Naito, K., Sugiura, K., Yamashita, M., Takakura, I., Tojo, H., 2004. Analysis of the roles of cyclin B1 and cyclin B2 in porcine oocyte maturation by inhibiting synthesis with antisense RNA injection. Biol. Reprod. 70, 154–159. Lakshminarayana, B.N.V., Chakravarthi, V.P., Brahmaiah, K.V., Rao, V.H., 2014. Quantification of P450 aromatase gene expression in cultured and in vivo grown ovarian follicles in sheep. Small Rumin. Res. 117, 66–72. Liu, K., Rajareddy, S., Liu, L., Jagarlamudi, K., Boman, K., Selstam, G., Reddy, P., 2006. Control of mammalian oocyte growth and early follicular development by the oocyte PI3 kinase pathway: new roles for an old timer. Dev. Biol. 299, 1–11. Magalhaes, D.M., Duarte, A.B., Araujo, V.R., 2011. In vitro production of a caprine embryo from a preantral follicle cultured in media supplemented with growth hormone. Theriogenology 75, 182–188. Mamo, S., Gal, A.B., Polgar, Z., Dinnyes, A., 2008. Expression profiles of the pluripotency marker gene POU5F1 and validation of reference genes in rabbit oocytes and pre implantation stage embryos. BMC Mol. Biol. 9, 67. Moore, G.D., Ayabe, T., Kopf, G.S., Schultz, R.M., 1996. Temporal patterns of gene expression of G1-S cyclins and CDKs during the first and second mitotic cell cycles in mouse embryos. Mol. Reprod. Dev. 45, 264–275. Murray, A.W., 2014. Recycling the cell cycle: cyclins revisited. Cell 116, 221–234. Musgrove, E.A., Hmilton, J.A., Lee, C.S., Sweene, K.J., Watts, C.K., Sutherland, R.L., 1993. Growth factor, steroid and steroid antagonist regulation of cyclin gene expression associated with changes in T-47D human breast cancer cell cycle progression. Mol. Cell. Biol. 13, 3577–3587. Rao, B.S., Naidu, K.S., Amarnath, D., Vagdevi, R., Rao, A.S., Bramaiah, K.V., Rao, V.H., 2002. In vitro maturation of sheep oocytes in different media during breeding and non-breeding seasons. Small Rumin. Res. 43, 31–36. Robert, C., McGraw, S., Massicotte, L., Pravetoni, M., Gandolfi, F., Sirard, M.A., 2002. Quantification of housekeeping transcript levels during the development of bovine preimplantation embryos. Biol. Reprod. 67, 1465–1472. Taieb, F., Thibier, C., Jessus, C., 1997. On cyclins, oocytes, and eggs. Mol. Reprod. Dev. 48, 397–411.