- Email: [email protected]
Rapid and sensitive detection of infectious spleen and kidney necrosis virus by recombinase polymerase amplification combined with lateral flow dipsticks
Aquaculture 519 (2020) 734926
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Rapid and sensitive detection of infectious spleen and kidney necrosis virus by recombinase polymerase amplification combined with lateral flow dipsticks Haoxuan Lia,b, Gailing Yuana, Yangzhi Luoc, Yunzhen Yuc, Taoshan Aic, Jianguo Sua,b,
T
⁎
a
Department of Aquatic Animal Medicine, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China Laboratory for Marine Biology and Biotechnology, Pilot National Laboratory for Marine Science and Technology, Qingdao 266237, China c Wuhan Chopper Fishery Bio-Tech Co.,Ltd, Wuhan Academy of Agricultural Science, Wuhan 430207, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Siniperca chuatsi ISKNV Recombinase polymerase amplification Lateral flow dipstick Rapid detection
Mandarin fish (Siniperca chuatsi) is a vital freshwater cultured species in China. Infectious spleen and kidney necrosis virus disease (ISKNVD), caused by infectious spleen and kidney necrosis virus (ISKNV), results in significant financial losses to mandarin fish farming industry. Rapid and convenient detection of ISKNV is urgent demands for diagnosis. In this study, we developed rapid, convenient and sensitive detection methods RPA (recombinase polymerase amplification) and RPA-LFD (combining RPA with lateral flow dipsticks (LFD)), targeting the conserved sequences of MCP and ORF007 genes in ISKNV. The RPA-LFD method could achieve detection within 30 min at 38 °C. Both methods had high sensitivity (102 copies/μL) and were 10 times more sensitive than that in general PCR. And they were highly specific for diagnosis of ISKNV. 24 samples of mandarin fish from farms were tested using RPA and RPA-LFD methods, both of them showed consistent results with the general PCR detection. In short, RPA and RPA-LFD provide a novel alternative for the simple, rapid and sensitive detection of ISKNV and show great potential for diagnosis of ISKNVD in the farm.
1. Introduction Siniperca chuatsi, commonly known as mandarin fish or Chinese perch, is an important freshwater cultured species with great market value in China (Song et al., 2018). In recent years, with the expansion of mandarin fish farming industry, a variety of pathogenic microorganisms have resulted in frequent outbreaks of disease, which bring substantial economic losses to the aquaculture industry (Gray et al., 2009; Jung-Schroers et al., 2016; Tanaka et al., 2014). Infectious spleen and kidney necrosis virus disease (ISKNVD) caused by Infectious spleen and kidney necrosis virus (ISKNV) is a severe viral disease affecting more than 50 marine and freshwater fish species, such as mandarin fish, platy fish, largemouth bass, zebrafish and barramundi (Bermudez et al., 2018; Dong et al., 2017; He et al., 2002; Mohr et al., 2015; Wang et al., 2007). The spread of ISKNVD has caused massive mortality and huge economic losses to mandarin fish farming industry in China. Because of the highly infectious nature of ISKNV and its potential impact on susceptible fish populations globally, ISKNV has been listed by the Office International Des Epizooties (OIE) at present (Fusianto et al., 2019; Zhang et al., 2019).
⁎
ISKNV is a member of the genus Megalocytivirus in the family Iridoviridae. Currently, there are 11 species in the family of Iridoviridae, divided among 5 genera, including Ranavirus, Chioriridovirus, Iridovirus, Megalocytivirus and Lymphocystivirus (Liu et al., 2018a; Shi et al., 2010). The mature virion of ISKNV is a regular icosahedron, about 150 nm in diameter, with a core that contains a linear dsDNA molecule more than 110 kb. Like several other vertebrate iridoviruses, the ISKNV genome is highly methylated at cytosines in the CpG and circularly permuted (He et al., 2001a). ISKNV infects kidney and spleen tissues of mandarin fish, and can lead to massive mortality in the larvae and juvenile mandarin fish with cumulative mortality as high as 100% reported (Jung-Schroers et al., 2016). Moreover, outbreaks of ISKNVD have been pervasive in China and noted in quite a few provinces, including Guangdong, Hubei, Jiangsu, Anhui, and others (He et al., 2001b). In order to effectively implement any control methods for this disease in cultured mandarin fish, it is of vital importance to detect the virus (Dong et al., 2013; Fu et al., 2012). Therefore, rapid and sensitive methods for detection of ISKNV are necessary for developing means to prevent and control this disease. Polymerase chain reaction (PCR) (Lao et al., 2009), quantitative
Corresponding author at: Department of Aquatic Animal Medicine, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China. E-mail address: [email protected] (J. Su).
https://doi.org/10.1016/j.aquaculture.2020.734926 Received 27 November 2019; Received in revised form 23 December 2019; Accepted 5 January 2020 Available online 07 January 2020 0044-8486/ © 2020 Elsevier B.V. All rights reserved.
Aquaculture 519 (2020) 734926
H. Li, et al.
Table 1 Primers for basic RPA in this study. Primer name
Primer direction
Sequence (5′–3′)
Product sizes (bp)
MCPF177 MCPR178 MCPF179 MCPR180 MCPF181 MCPR182 007F193 007R194 007F195 007R196 007F197 007R198
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CTTCACGGGGTGACTGAACCTGAGGTCCAG GTACTGACAAGCGAGGAGCGTGAGGTGGTG TGAACCTGAGGTCCAGATGCACCAAAGAATT TGTACTGACAAGCGAGGAGCGTGAGGTGGTG CCAGCGGATGTAGCTGTTCTCCTTGCTGGA CTTTGCCCGTGAGACCGTGCGTAGTTCCTG AAGATACGCAGCACAGAGTCCTGGATGACAACG TACGCCTCGGCCACAAACAGCATCAAGCAA GCCGACACAAAGATACGCAGCACAGAGTCC CAACATGACGCTCACATGCAGTGGCGAGGT ACGACACATGAATTTGAACGCATACGCCGC CGTTGTCATCCAGGACTCTGTGCTGCGTATCTT
147
Sequence (5′–3′)
MCPF181 MCPR182 MCP probe
CCAGCGGATGTAGCTGTTCTCCTTGCTGGA (Biotin)CTTTGCCCGTGAGACCGTGCGTAGTTCCTG (FAM)ATCTTAACACGCAGCCACACATTAATGAGGT(THF) GTCGCCGCCCCTCGCCACC(C3spacer) ACGACACATGAATTTGAACGCATACGCCGC (Biotin)CGTTGTCATCCAGGACTCTGTGCTGCGTATCTT (FAM)CCACGCCCATGCCGCCGACCAAGAGCACCATGC(THF) GATTACCCCGCGCTTG(C3spacer)
007F197 007R198 007 probe
Table 3 Primers for generic PCR in this study. Primer name
Direction
Sequence (5′–3′)
Product sizes (bp)
MCPF148 MCPR149 007F150 007R151 MCPF155 MCPR156 007F157 007R158
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
TTACAGGATAGGGAAGCCTGC ATGTCTGCAATCTCAGGTGCA TTATATATGACCGGGCTCATT ATGGGTGCTGCCCAGTC ATGCCAATCATCTTGTTGTAGCC GGTGTCATTTAACGACCTGGTG CCGACACAAAGATACGCAGC ACTTTGGTCAGTACGCCTCG
1362
196 164 114 295
complicated instruments. Therefore, a more convenient method is still required for diagnosis of ISKNV. Recombinase polymerase amplification (RPA) is a novel isothermal nucleic acid amplification technique which relies on recombinase, single stranded binding protein and strand displacing DNA polymerase to accomplish nucleic acid amplification (Piepenburg et al., 2006). It does not require a stringent incubation temperature and can achieve nucleic acid amplification at constant temperature ranging from 25 to 42 °C (Boyle et al., 2013). Recently, RPA has become a promising molecular biological technology for rapid diagnosis of various pathogens (Liu et al., 2016; Miao et al., 2019). Several types of RPA detections have been described, and RPA combined with lateral flow dipsticks (LFD) appears especially suitable for rapid detection of diversified clinical specimens in non-laboratory situations (Piepenburg et al., 2006). The RPA assay has been reported for the rapid detection of WSSV, IHNNV, CyHV-2 and other fish pathogens (Wang et al., 2018; Xia et al., 2014; Xia et al., 2015). However, the detection of ISKNV using RPA and RPA-LFD has not yet been reported. In the present study, we aimed to develop a rapid and sensitive detection method that combines RPA with LFD for the detection of ISKNV in the field. Targeting the MCP and ORF007 gene of ISKNV, we designed RPA primers and probes for detection of ISKNV. The sensitivity and specificity were evaluated. And the practicability was determined by detecting clinical samples.
Table 2 Primers and probes for RPA-LFD in this study. Primer name
134
1458 114 183
polymerase chain reaction (qPCR) (Lin et al., 2017), loop-mediated isothermal amplification (LAMP) (Ding et al., 2010), cross-priming amplification (CPA) (Liu et al., 2018b), enzyme linked immunosorbent assay (ELISA) (Huang et al., 2012), histopathology (He et al., 2002) and virus isolation (Dong et al., 2008) have been reported for diagnosis of ISKNV, but these methods are inconvenient to be used for field detection in fish farms because they require long reaction time and
2. Materials and methods 2.1. Fish and virus Mandarin fish (100 g mean weight and 10 cm mean length) were obtained from an aquaculture farm in Huangshi, Hubei province and were acclimated at 27 ± 1 °C. Infectious spleen and kidney neurosis
Fig. 1. Screening primers of recombinase polymerase amplification (RPA) for infectious spleen and kidney necrosis virus (ISKNV) detection. (A) Agarose gel electrophoresis of RPA products generated using three sets of primers based on MCP sequence. (B) Agarose gel electrophoresis of RPA products generated using three sets of primers based on ORF007 sequence. ISKNV genomic DNA (+) and negative samples water (−) were used as templates in RPA, respectively. 2
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 2. Optimizing the reaction conditions for RPA and RPA-LFD assays. The amplification products of RPA in different temperatures (A), time (B), and concentrations of primer pair (C) were detected by agarose gel electrophoresis. ISKNV genomic DNA (+) and negative samples water (−) were severally used as templates of RPA. The amplification products of RPA-LFD in different temperatures (D) and time (E) were detected through lateral flow dipsticks (LFD). The primers used for optimizing reaction conditions were the optimal MCP primers.
RPA primer design principles (RPA primers are ideally 30–35 nt in length and form an amplicon of 100 to 300 bp), then the RPA amplicon was detected on a 2% agarose gel to identify the optimal primers. Primers for RPA were listed in Table 1. Probes for RPA-LFD were designed on the sequence between RPA primers. The probe added a FAM on the 5′ end, a C3 spacer on the 3′ end and a dSpacer in the middle. And the reverse primers for RPA-LFD added a biotin on the 5′ end. Primers and probes for RPA-LFD were listed in Table 2. The primers and probes in this study were synthesized by Sangon Biotech (Shanghai, China).
virus (ISKNV) were kindly provided by professor Lingbing Zeng, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences. Other viruses and bacteria were kept in our lab. 2.2. Nucleic acid extraction ISKNV genomic DNA was extracted from the head-kidney and spleen of infected mandarin fish. The samples were cut with scissors and homogenized with 150 μL DNA isolation buffer (0.5% sodium dodecyl sulfate, 300 mM NaCl, 10 mM Tris HCl, 10 mM EDTA, pH 8.0, 20 μg/mL RNase). After incubated for 1 h at 37 °C, proteinase K was added to a concentration of 150 μg/mL and the samples were incubated at 55 °C overnight. Total DNA was extracted by conventional phenolchloroform procedure. The extracted DNA was then stored at −20 °C until ready for use.
2.4. Establishment of RPA and RPA-LFD assays The basic RPA was initiated by using the TwistAmp Basic kit (TwistDx, Cambridge, UK), and the reaction system contained 2.4 μL forward primer, 2.4 μL reverse primer, 29.5 μL rehydration buffer, 12.2 μL ddH2O and 1 μL sample DNA, and then started the reaction by adding 2.5 μL magnesium acetate. To define the optimal amplification temperature, RPA was performed at 20, 25, 30, 35, 38, 42, 45 and 50 °C for 30 min. To determine the optimal amplification time, reactions were performed at the most suitable temperature for 1, 5, 10, 15, 20, 25, 30
2.3. Design of primers and probes The highly conserved sequences MCP and ORF007 genes of ISKNV (GenBank accession number: AF371960.1) were chosen as target sequences. A series of RPA candidate primers were designed following 3
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 3. Specificity of RPA and RPA-LFD assays. The samples used for RPA and RPA-LFD specificity tests were ISKNV and other microbes. The products of RPA using the MCP primers (A) and ORF007 primers (B) were identified through agarose gel electrophoresis. The products of RPA-LFD with the MCP primers (C) and ORF007 primers (D) were detected by lateral flow dipsticks (LFD).
and 35 min. To test the optimal concentration of primers, reactions were performed using 0.5, 1, 5, 10, 15, 20 μM primers. The RPA productions were purified by AxyPrep PCR Clean-up Kit (Axygen, USA) and analyzed on 2% agarose gel electrophoresis subsequently. TwistAmp nfo kit (TwistDX, Cambridge, UK) and Hybridetect 1 (Milenia Biotec GmbH, GieBen, Germany) dipsticks were used for RPALFD. The reaction system included 2.1 μL forward primer, 2.1 μL reverse primer, 29.5 μL rehydration buffer, 0.6 μL probe, 12.2 μL ddH2O and 1 μL DNA and was also started by 2.5 μL magnesium acetate. RPALFD reactions were performed in gradient temperature and time as previously mentioned. Then, the products were diluted at 1:20 with ddH2O. Dipsticks were put into the diluted samples and the results can be read in 5 min.
amplification of PCR, RPA and RPA-LFD. Detection results of PCR, RPA and RPA-LFD were compared, and the sensitivity of the three methods was evaluated. The primers for generic PCR in this study were presented in Table 3, and primers MCPF155/MCPR156 and 007F157/ 007R158 in the table were used for generic PCR detection of ISKNV.
2.5. Specificity of RPA and RPA-LFD assays
3. Results
The specificity of RPA primers and probes was tested using ISKNV DNA, cyprinid herpesvirus 2 (CyHV-2) DNA, grass carp reovirus genotype I (GCRV-I) cDNA, grass carp reovirus genotype II (GCRV-II) cDNA, Aeromonas hydrophila DNA, Aeromonas veronii DNA, Staphylococcus aureus DNA and negative control (water) under optimal conditions. Amplification results of RPA and RPA-LFD were analyzed, and the specificity of RPA primers and probes was determined.
3.1. Evaluation of RPA primers
2.7. Practical evaluation of RPA and RPA-LFD assays DNA was extracted from mandarin fish collected in aquaculture farms. And the extracted DNA was used to verify the performance of PCR, RPA and RPA-LFD. The results of PCR, RPA and RPA-LFD were compared, and the practical performance of the three methods was evaluated.
The highly conserved sequences MCP and ORF007 of ISKNV were selected as target regions for primer and probe design, and six pairs of primers were designed for RPA assay. In the primer screening assay, all the three primer combinations of MCP and three primer combinations of ORF007 (Table 1) amplified the target sequences successfully, but MCP primers MCPF181/MCPR182 and ORF007 primers 007F197/ 007R198 yielded the best products on the agarose gel (Fig. 1). Therefore, primers MCPF181/MCPR182 and 007F197/007R198 were best for RPA assay. Target product amplified by MCPF181/MCPR182 was 196 bp in length and target product amplified by 007F197/007R198 was 295 bp in length.
2.6. Sensitivity of RPA and RPA-LFD assays The sequences MCP (1362 bp) and ORF007 (1458 bp) were obtained through PCR and cloned into the pMD18-T plasmids to generate recombinant plasmids pMD18-MCP and pMD18-ORF007. Then the concentration of the recombinant plasmids was determined by measuring absorbance at 260 nm and 280 nm and was converted to copy numbers. pMD18-MCP and pMD18-ORF007 recombinant plasmids were diluted a range of 100 to 107 copies/μL, and were used for
3.2. Optimal reaction conditions for RPA and RPA-LFD assays To obtain the optimal amplification temperature for RPA and RPA4
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 4. Comparison of the sensitivity of generic PCR, RPA and RPA-LFD assays. Using 100–107 copies/μL pMD18-MCP plasmid standards as samples, the minimum detectable concentration were determined by generic PCR (A), RPA (C) and RPA-LFD (E). And using 100–107 copies/μL pMD18-ORF007 plasmid standards as samples, the smallest detectable concentration were determined by generic PCR (B), RPA (D) and RPA-LFD (F).
of specificity detected by the ORF007 primers were the same as those of MCP primers (Fig. 3B and D). The results indicated that primers and probes of MCP and ORF007 were specific for ISKNV detection.
LFD, a temperature range of 20–50 °C was assessed in 30 min reactions. The results showed that both RPA and RPA-LFD reactions could be run at a wide range of temperatures from 25 to 42 °C, and the test band was the brightest at 38 °C (Fig. 2A and D). Thus, 38 °C was selected as the reaction temperature of ISKNV RPA and RPA-LFD. Next, the optimum reaction time was estimated between 1 and 35 min. The results indicated that the weak band could be seen in the test area when the reaction time was 5 min, and the distinct bands were seen when the reaction time was from 15 to 35 min (Fig. 2B and E). To complete RPA and RPA-LFD assays well, the reaction time was set at 30 min. RPA reactions were conducted in different concentrations of primers, the most distinct band was seen when the concentration was 10 μM (Fig. 2C). Therefore, 10 μM was chosen as the optimum concentration of primers for RPA and RPA-LFD.
3.4. Sensitivity of RPA and RPA-LFD assays The RPA, RPA-LFD and PCR assays were performed using a dilution series of plasmid standard samples containing 100–107 copies/μL of recombinant plasmids (pMD18-MCP or pMD18-ORF007). The results showed the minimum detectable concentration of generic PCR using the PCR primers of MCP was 103 copies/μL (Fig. 4A), and that of generic PCR using the PCR primers of ORF007 was also 103 copies/μL (Fig. 4B). The minimum detectable concentration of RPA and RPA-LFD using the MCP primers was 102 copies/μL (Fig. 4C and E), and that of RPA and RPA-LFD using the ORF007 primers was also 102 copies/μL (Fig. 4D and F). The sensitivity of RPA was the same as that of RPA-LFD. Both RPA and RPA-LFD were 10 times more sensitive than that in generic PCR method.
3.3. Specificity of RPA and RPA-LFD assays The specificity of RPA was investigated using DNA or cDNA samples from various viruses and bacteria. The RPA and RPA-LFD using the MCP primers did not detect cyprinid herpesvirus 2 (CyHV-2) DNA, grass carp reovirus genotype I (GCRV-I) cDNA, grass carp reovirus genotype II (GCRV-II) cDNA, Aeromonas hydrophila DNA, Aeromonas veronii DNA, Staphylococcus aureus DNA and negative control (water) samples, only ISKNV DNA yielded a positive result by agarose gel electrophoresis (Fig. 3A) and lateral flow dipsticks (Fig. 3C). The results
3.5. Practicability of RPA and RPA-LFD assays The practicability in diagnosing ISKNVD was evaluated by comparing detection results of RPA and RPA-LFD on 24 mandarin fish samples with generic PCR results on the same samples. The results showed that nine generic PCR positive samples (Fig. 5A) were also 5
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 5. Evaluation of the practicability of RPA and RPA-LFD using the MCP primers. 24 samples from aquaculture farms were detected by generic PCR (A), RPA (B) and RPA-LFD (C).
compared with LAMP and CPA. For example, the test conditions (38 °C within 30 min) are easily implemented. LAMP and CPA for ISKNV detection require a high temperature (60–65 °C), and reaction time of LAMP is longer than RPA (60 min) (Ding et al., 2010; Liu et al., 2018b). By comparison, RPA assay takes less than 30 min at 38 °C to complete. As such, RPA is simpler and more easily used than LAMP, CPA and PCR. In the present study, RPA and RPA-LFD methods were developed and evaluated for rapid, sensitive, and specific identification of ISKNV. The nucleotide sequences encoding the capsid proteins MCP and ORF007 are highly conserved sequences of ISKNV and often used as target genes for ISKNV detection (Lao et al., 2009; Lin et al., 2017). In this study, targeting the MCP and ORF007 genes, six primer combinations of RPA were designed for detection of ISKNV. Primer pairs MCPF181/MCPR182 and 007F197/007R198 were most effective in amplification and were selected for subsequent RPA detection (Fig. 1). The RPA reaction could be conducted excellently at 38 °C (Fig. 2A and D). Thus, 38 °C was selected as the standard assay temperature. And RPA reactions could be detectable when the reaction time was 5 min. To achieve good effects of detection, 30 min was selected as the standard assay time (Fig. 2B and E). The specificity of the RPA assay was determined by testing different microbes. Only ISKNV sample yielded a positive result by agarose gel electrophoresis (Fig. 3A and B) and lateral flow dipsticks (Fig. 3C and D). These results suggested RPA and RPALFD assays were specific for the detection of ISKNV. The sensitivity of the RPA and RPA-LFD was found to be 10 times sensitivity than generic
positive by RPA and RPA-LFD using the MCP primers (Fig. 5B and C). And using the ORF007 primers, these nine samples were also positive by generic RCR (Fig. 6A), RPA (Fig. 6B) and RPA-LFD (Fig. 6C). The results suggested that the developed RPA and RPA-LFD assays could feasibly be used for diagnostic and detection of ISKNV. 4. Discussion Mandarin fish (Siniperca chuatsi) is a significant cultured species with a large farming scale and economic value in China (Song et al., 2018). ISKNV has become a major pathogen in cultivated mandarin fish, and outbreaks of ISKNVD have posed a serious threat to the mandarin fish farming industry (Tao et al., 2007). Therefore, there is a critical need for rapid and convenient diagnosis of ISKNVD to prevent spread of this disease. Classical diagnostic methods are available and include dot blot hybridization, virus isolation in cell cultures, and various serological methods (Dong et al., 2008). In recent years, molecular biological methods have become more common for detection and identification of ISKNV and included generic PCR (Lao et al., 2009) and qPCR (Lin et al., 2017). However, these techniques can be limited for use in the small farms. The need of effective methods for rapid and accurate detection of ISKNV has led to the development of nucleic acid isothermal amplification methods, including LAMP (Ding et al., 2010) and CPA (Liu et al., 2018b). RPA is a novel isothermal amplification method for rapid DNA amplification. RPA has several advantages 6
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 6. Evaluation of the applicability of RPA and RPA-LFD using the ORF007 primers. 24 samples from aquaculture farms were detected by generic PCR (A), RPA (B) and RPA-LFD (C).
Acknowledgements
PCR. Both RPA and RPA-LFD were able to detect recombinant plasmid samples at concentrations as low as 102 copies/μL (Fig. 4). In addition, both RPA and RPA-LFD methods showed consistent positive results with those of the generic PCR detection (Figs. 5 and 6), but RPA and RPA-LFD methods were more rapid than generic PCR. The whole RPALFD assay yielded results in 30 min, whereas PCR generates results approximately 2 h, furthermore, professional apparatus (PCR machine) is necessary for generic PCR reaction. In summary, our developed RPA and LFD assays take only 30 min, which are two times faster than the LAMP method, and four times faster than the generic PCR detection of ISKNV. And the reaction temperature is easier to achieve than LAMP and PCR. The RPA and RPA-LFD are also 10 times more sensitive than the generic PCR detection method. The high sensitivity and specificity of the methods are also the pivotal advantages. The results in this study indicated the appropriateness of RPA and RPA-LFD for rapid diagnosis of ISKNVD and that they have great potential for on-site testing of ISKNV.
The authors would like to thank Prof. Lingbing Zeng, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, for kindly gifted ISKNV. We also thank Mr. Jiacheng Zhang, Mr. Xingchen Huo, Miss Chengjian Fan for technical advice and assistance in experiments. This work was supported by Key Project of Scientific & Technological Innovation of Hubei Province (2018ABA101), National Key Research and Development Program of China (2018YFD0900504) and Special Grant of Scientific & Technological Innovation and Entrepreneuship Service Capacity Construction of Hubei Province (2018BEC482). References Bermudez, R., Losada, A.P., de Azevedo, A.M., Guerra-Varela, J., Perez-Fernandez, D., Sanchez, L., Padros, F., Nowak, B., Quiroga, M.I., 2018. First description of a natural infection with spleen and kidney necrosis virus in zebrafish. J. Fish Dis. 41, 1283–1294. Boyle, D.S., Lehman, D.A., Lillis, L., Peterson, D., Singhal, M., Armes, N., Parker, M., Piepenburg, O., Overbaugh, J., 2013. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification. MBio. 4, 1–8. Ding, W.C., Chen, J., Shi, Y.H., Lu, X.J., Li, M.Y., 2010. Rapid and sensitive detection of infectious spleen and kidney necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. Arch. Virol. 155, 385–389. Dong, C., Weng, S., Shi, X., Xu, X., Shi, N., He, J., 2008. Development of a mandarin fish Siniperca chuatsi fry cell line suitable for the study of infectious spleen and kidney necrosis virus (ISKNV). Virus Res. 135, 273–281. Dong, C., Xiong, X., Luo, Y., Weng, S., Wang, Q., He, J., 2013. Efficacy of a formalin-killed cell vaccine against infectious spleen and kidney necrosis virus (ISKNV) and
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
7
Aquaculture 519 (2020) 734926
H. Li, et al.
474–484. Liu, W., Zhou, Y., Fan, Y., Jiang, N., Cain, K., Zeng, L., 2018b. Development of crosspriming amplification coupled with vertical flow visualization for rapid detection of infectious spleen and kidney necrosis virus (ISKNV) in mandarin fish, Siniperca chuatsi. J. Virol. Methods 253, 38–42. Miao, F., Zhang, J., Li, N., Chen, T., Wang, L., Zhang, F., Mi, L., Zhang, J., Wang, S., Wang, Y., Zhou, X., Zhang, Y., Li, M., Zhang, S., Hu, R., 2019. Rapid and sensitive recombinase polymerase amplification combined with lateral flow strip for detecting African swine fever virus. Front. Microbiol. 10, 1–7. Mohr, P.G., Moody, N.J., Williams, L.M., Hoad, J., Cummins, D.M., Davies, K.R., Crane, M.S., 2015. Molecular confirmation of infectious spleen and kidney necrosis virus (ISKNV) in farmed and imported ornamental fish in Australia. Dis. Aquat. Org. 116, 103–110. Piepenburg, O., Williams, C.H., Stemple, D.L., Armes, N.A., 2006. DNA detection using recombination proteins. PLoS Biol. 4, 1115–1121. Shi, C.Y., Jia, K.T., Yang, B., Huang, J., 2010. Complete genome sequence of a Megalocytivirus (family Iridoviridae) associated with turbot mortality in China. Virol. J. 7, 159. Song, Y., Cheng, F., Zhao, S., Xie, S., 2018. Ontogenetic development and otolith microstructure in the larval and juvenile stages of mandarin fish Siniperca chuatsi. Ichthyol. Res. 66, 57–66. Tanaka, N., Izawa, T., Kuwamura, M., Higashiguchi, N., Kezuka, C., Kurata, O., Wada, S., Yamate, J., 2014. The first case of infectious spleen and kidney necrosis virus (ISKNV) infection in aquarium-maintained mandarin fish, Siniperca chuatsi (Basilewsky), in Japan. J. Fish Dis. 37, 401–405. Tao, J.J., Gui, J.F., Zhang, Q.Y., 2007. Isolation and characterization of a rhabdovirus from co-infection of two viruses in mandarin fish. Aquaculture. 262, 1–9. Wang, Y.Q., Lu, L., Weng, S.P., Huang, J.N., Chan, S.M., He, J.G., 2007. Molecular epidemiology and phylogenetic analysis of a marine fish infectious spleen and kidney necrosis virus-like (ISKNV-like) virus. Arch. Virol. 152, 763–773. Wang, H., Sun, M., Xu, D., Podok, P., Xie, J., Jiang, Y., Lu, L., 2018. Rapid visual detection of cyprinid herpesvirus 2 by recombinase polymerase amplification combined with a lateral flow dipstick. J. Fish Dis. 41, 1201–1206. Xia, X., Yu, Y., Weidmann, M., Pan, Y., Yan, S., Wang, Y., 2014. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay. PLoS One 9, e104667. Xia, X., Yu, Y., Hu, L., Weidmann, M., Pan, Y., Yan, S., Wang, Y., 2015. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay. Arch. Virol. 160, 987–994. Zhang, J., Fu, X., Zhang, Y., Zhu, W., Zhou, Y., Yuan, G., Liu, X., Ai, T., Zeng, L., Su, J., 2019. Chitosan and anisodamine improve the immune efficacy of inactivated infectious spleen and kidney necrosis virus vaccine in Siniperca chuatsi. Fish Shellfish Immunol. 89, 52–60.
immunoproteomic analysis of its major immunogenic proteins. Vet. Microbiol. 162, 419–428. Dong, H.T., Jitrakorn, S., Kayansamruaj, P., Pirarat, N., Rodkhum, C., Rattanarojpong, T., Senapin, S., Saksmerprome, V., 2017. Infectious spleen and kidney necrosis disease (ISKND) outbreaks in farmed barramundi (Lates calcarifer) in Vietnam. Fish Shellfish Immunol. 68, 65–73. Fu, X., Li, N., Lai, Y., Liu, L., Lin, Q., Shi, C., Huang, Z., Wu, S., 2012. Protective immunity against iridovirus disease in mandarin fish, induced by recombinant major capsid protein of infectious spleen and kidney necrosis virus. Fish Shellfish Immunol. 33, 880–885. Fusianto, C., Hick, P.M., Becker, J.A., 2019. Stability of infectious spleen and kidney necrosis virus and susceptibility to physical and chemical disinfectants. Aquaculture. 506, 104–111. Gray, M.J., Miller, D.L., Hoverman, J.T., 2009. Ecology and pathology of amphibian ranaviruses. Dis. Aquat. Org. 87, 243–266. He, J.G., Deng, M., Weng, S.P., Li, Z., Zhou, S.Y., Long, Q.X., Wang, X.Z., Chan, S.M., 2001a. Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology. 291, 126–139. He, J.G., Wang, S.P., Zeng, K., Huang, Z.J., Chan, S.M., 2001b. Systemic disease caused by an iridovirus-like agent in cultured mandarinfish, Siniperca chuatsi (Basilewsky), in China. J. Fish Dis. 23, 219–222. He, J.G., Zeng, K., Weng, S.P., Chan, S.M., 2002. Experimental transmission, pathogenicity and physical-chemical properties of infectious spleen and kidney necrosis virus ISKNV. Aquaculture. 204, 11–24. Huang, Z., Tang, J., Li, M., Fu, Y., Dong, C., Zhong, J., He, J., 2012. Immunological evaluation of Vibrio alginolyticus, Vibrio harveyi, Vibrio vulnificus and infectious spleen and kidney necrosis virus (ISKNV) combined-vaccine efficacy in Epinephelus coioides. Vet. Immunol. Immunopathol. 150, 61–68. Jung-Schroers, V., Adamek, M., Wohlsein, P., Wolter, J., Wedekind, H., Steinhagen, D., 2016. First outbreak of an infection with infectious spleen and kidney necrosis virus (ISKNV) in ornamental fish in Germany. Dis. Aquat. Org. 119, 239–244. Lao, H.H., Ye, X., Zou, W.M., Bai, J.J., Tan, A.P., 2009. Detection of infectious spleen and kidney necrosis virus (ISKNV) of mandarin fish (Siniperca chuatsi) by nested PCR. South China Fish Sci. 5, 69–72 (in Chinese with English abstract). Lin, Q., Fu, X., Liu, L., Liang, H., Guo, H., Yin, S., Kumaresan, V., Huang, Z., Li, N., 2017. Application and development of a TaqMan real-time PCR for detecting infectious spleen and kidney necrosis virus in Siniperca chuatsi. Microb. Pathog. 107, 98–105. Liu, W., Liu, H.X., Zhang, L., Hou, X.X., Wan, K.L., Hao, Q., 2016. A novel isothermal assay of Borrelia burgdorferi by recombinase polymerase amplification with lateral flow detection. Int. J. Mol. Sci. 17, 1–8. Liu, X., Chen, N., Gao, X., Zhang, Y., Li, X., Zhang, Y., Bing, X., Huang, H., Zhang, X., 2018a. The infection of red seabream iridovirus in mandarin fish (Siniperca chuatsi) and the host immune related gene expression profiles. Fish Shellfish Immunol. 74,
8
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Rapid and sensitive detection of infectious spleen and kidney necrosis virus by recombinase polymerase amplification combined with lateral flow dipsticks Haoxuan Lia,b, Gailing Yuana, Yangzhi Luoc, Yunzhen Yuc, Taoshan Aic, Jianguo Sua,b,
T
⁎
a
Department of Aquatic Animal Medicine, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China Laboratory for Marine Biology and Biotechnology, Pilot National Laboratory for Marine Science and Technology, Qingdao 266237, China c Wuhan Chopper Fishery Bio-Tech Co.,Ltd, Wuhan Academy of Agricultural Science, Wuhan 430207, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Siniperca chuatsi ISKNV Recombinase polymerase amplification Lateral flow dipstick Rapid detection
Mandarin fish (Siniperca chuatsi) is a vital freshwater cultured species in China. Infectious spleen and kidney necrosis virus disease (ISKNVD), caused by infectious spleen and kidney necrosis virus (ISKNV), results in significant financial losses to mandarin fish farming industry. Rapid and convenient detection of ISKNV is urgent demands for diagnosis. In this study, we developed rapid, convenient and sensitive detection methods RPA (recombinase polymerase amplification) and RPA-LFD (combining RPA with lateral flow dipsticks (LFD)), targeting the conserved sequences of MCP and ORF007 genes in ISKNV. The RPA-LFD method could achieve detection within 30 min at 38 °C. Both methods had high sensitivity (102 copies/μL) and were 10 times more sensitive than that in general PCR. And they were highly specific for diagnosis of ISKNV. 24 samples of mandarin fish from farms were tested using RPA and RPA-LFD methods, both of them showed consistent results with the general PCR detection. In short, RPA and RPA-LFD provide a novel alternative for the simple, rapid and sensitive detection of ISKNV and show great potential for diagnosis of ISKNVD in the farm.
1. Introduction Siniperca chuatsi, commonly known as mandarin fish or Chinese perch, is an important freshwater cultured species with great market value in China (Song et al., 2018). In recent years, with the expansion of mandarin fish farming industry, a variety of pathogenic microorganisms have resulted in frequent outbreaks of disease, which bring substantial economic losses to the aquaculture industry (Gray et al., 2009; Jung-Schroers et al., 2016; Tanaka et al., 2014). Infectious spleen and kidney necrosis virus disease (ISKNVD) caused by Infectious spleen and kidney necrosis virus (ISKNV) is a severe viral disease affecting more than 50 marine and freshwater fish species, such as mandarin fish, platy fish, largemouth bass, zebrafish and barramundi (Bermudez et al., 2018; Dong et al., 2017; He et al., 2002; Mohr et al., 2015; Wang et al., 2007). The spread of ISKNVD has caused massive mortality and huge economic losses to mandarin fish farming industry in China. Because of the highly infectious nature of ISKNV and its potential impact on susceptible fish populations globally, ISKNV has been listed by the Office International Des Epizooties (OIE) at present (Fusianto et al., 2019; Zhang et al., 2019).
⁎
ISKNV is a member of the genus Megalocytivirus in the family Iridoviridae. Currently, there are 11 species in the family of Iridoviridae, divided among 5 genera, including Ranavirus, Chioriridovirus, Iridovirus, Megalocytivirus and Lymphocystivirus (Liu et al., 2018a; Shi et al., 2010). The mature virion of ISKNV is a regular icosahedron, about 150 nm in diameter, with a core that contains a linear dsDNA molecule more than 110 kb. Like several other vertebrate iridoviruses, the ISKNV genome is highly methylated at cytosines in the CpG and circularly permuted (He et al., 2001a). ISKNV infects kidney and spleen tissues of mandarin fish, and can lead to massive mortality in the larvae and juvenile mandarin fish with cumulative mortality as high as 100% reported (Jung-Schroers et al., 2016). Moreover, outbreaks of ISKNVD have been pervasive in China and noted in quite a few provinces, including Guangdong, Hubei, Jiangsu, Anhui, and others (He et al., 2001b). In order to effectively implement any control methods for this disease in cultured mandarin fish, it is of vital importance to detect the virus (Dong et al., 2013; Fu et al., 2012). Therefore, rapid and sensitive methods for detection of ISKNV are necessary for developing means to prevent and control this disease. Polymerase chain reaction (PCR) (Lao et al., 2009), quantitative
Corresponding author at: Department of Aquatic Animal Medicine, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China. E-mail address: [email protected] (J. Su).
https://doi.org/10.1016/j.aquaculture.2020.734926 Received 27 November 2019; Received in revised form 23 December 2019; Accepted 5 January 2020 Available online 07 January 2020 0044-8486/ © 2020 Elsevier B.V. All rights reserved.
Aquaculture 519 (2020) 734926
H. Li, et al.
Table 1 Primers for basic RPA in this study. Primer name
Primer direction
Sequence (5′–3′)
Product sizes (bp)
MCPF177 MCPR178 MCPF179 MCPR180 MCPF181 MCPR182 007F193 007R194 007F195 007R196 007F197 007R198
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CTTCACGGGGTGACTGAACCTGAGGTCCAG GTACTGACAAGCGAGGAGCGTGAGGTGGTG TGAACCTGAGGTCCAGATGCACCAAAGAATT TGTACTGACAAGCGAGGAGCGTGAGGTGGTG CCAGCGGATGTAGCTGTTCTCCTTGCTGGA CTTTGCCCGTGAGACCGTGCGTAGTTCCTG AAGATACGCAGCACAGAGTCCTGGATGACAACG TACGCCTCGGCCACAAACAGCATCAAGCAA GCCGACACAAAGATACGCAGCACAGAGTCC CAACATGACGCTCACATGCAGTGGCGAGGT ACGACACATGAATTTGAACGCATACGCCGC CGTTGTCATCCAGGACTCTGTGCTGCGTATCTT
147
Sequence (5′–3′)
MCPF181 MCPR182 MCP probe
CCAGCGGATGTAGCTGTTCTCCTTGCTGGA (Biotin)CTTTGCCCGTGAGACCGTGCGTAGTTCCTG (FAM)ATCTTAACACGCAGCCACACATTAATGAGGT(THF) GTCGCCGCCCCTCGCCACC(C3spacer) ACGACACATGAATTTGAACGCATACGCCGC (Biotin)CGTTGTCATCCAGGACTCTGTGCTGCGTATCTT (FAM)CCACGCCCATGCCGCCGACCAAGAGCACCATGC(THF) GATTACCCCGCGCTTG(C3spacer)
007F197 007R198 007 probe
Table 3 Primers for generic PCR in this study. Primer name
Direction
Sequence (5′–3′)
Product sizes (bp)
MCPF148 MCPR149 007F150 007R151 MCPF155 MCPR156 007F157 007R158
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
TTACAGGATAGGGAAGCCTGC ATGTCTGCAATCTCAGGTGCA TTATATATGACCGGGCTCATT ATGGGTGCTGCCCAGTC ATGCCAATCATCTTGTTGTAGCC GGTGTCATTTAACGACCTGGTG CCGACACAAAGATACGCAGC ACTTTGGTCAGTACGCCTCG
1362
196 164 114 295
complicated instruments. Therefore, a more convenient method is still required for diagnosis of ISKNV. Recombinase polymerase amplification (RPA) is a novel isothermal nucleic acid amplification technique which relies on recombinase, single stranded binding protein and strand displacing DNA polymerase to accomplish nucleic acid amplification (Piepenburg et al., 2006). It does not require a stringent incubation temperature and can achieve nucleic acid amplification at constant temperature ranging from 25 to 42 °C (Boyle et al., 2013). Recently, RPA has become a promising molecular biological technology for rapid diagnosis of various pathogens (Liu et al., 2016; Miao et al., 2019). Several types of RPA detections have been described, and RPA combined with lateral flow dipsticks (LFD) appears especially suitable for rapid detection of diversified clinical specimens in non-laboratory situations (Piepenburg et al., 2006). The RPA assay has been reported for the rapid detection of WSSV, IHNNV, CyHV-2 and other fish pathogens (Wang et al., 2018; Xia et al., 2014; Xia et al., 2015). However, the detection of ISKNV using RPA and RPA-LFD has not yet been reported. In the present study, we aimed to develop a rapid and sensitive detection method that combines RPA with LFD for the detection of ISKNV in the field. Targeting the MCP and ORF007 gene of ISKNV, we designed RPA primers and probes for detection of ISKNV. The sensitivity and specificity were evaluated. And the practicability was determined by detecting clinical samples.
Table 2 Primers and probes for RPA-LFD in this study. Primer name
134
1458 114 183
polymerase chain reaction (qPCR) (Lin et al., 2017), loop-mediated isothermal amplification (LAMP) (Ding et al., 2010), cross-priming amplification (CPA) (Liu et al., 2018b), enzyme linked immunosorbent assay (ELISA) (Huang et al., 2012), histopathology (He et al., 2002) and virus isolation (Dong et al., 2008) have been reported for diagnosis of ISKNV, but these methods are inconvenient to be used for field detection in fish farms because they require long reaction time and
2. Materials and methods 2.1. Fish and virus Mandarin fish (100 g mean weight and 10 cm mean length) were obtained from an aquaculture farm in Huangshi, Hubei province and were acclimated at 27 ± 1 °C. Infectious spleen and kidney neurosis
Fig. 1. Screening primers of recombinase polymerase amplification (RPA) for infectious spleen and kidney necrosis virus (ISKNV) detection. (A) Agarose gel electrophoresis of RPA products generated using three sets of primers based on MCP sequence. (B) Agarose gel electrophoresis of RPA products generated using three sets of primers based on ORF007 sequence. ISKNV genomic DNA (+) and negative samples water (−) were used as templates in RPA, respectively. 2
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 2. Optimizing the reaction conditions for RPA and RPA-LFD assays. The amplification products of RPA in different temperatures (A), time (B), and concentrations of primer pair (C) were detected by agarose gel electrophoresis. ISKNV genomic DNA (+) and negative samples water (−) were severally used as templates of RPA. The amplification products of RPA-LFD in different temperatures (D) and time (E) were detected through lateral flow dipsticks (LFD). The primers used for optimizing reaction conditions were the optimal MCP primers.
RPA primer design principles (RPA primers are ideally 30–35 nt in length and form an amplicon of 100 to 300 bp), then the RPA amplicon was detected on a 2% agarose gel to identify the optimal primers. Primers for RPA were listed in Table 1. Probes for RPA-LFD were designed on the sequence between RPA primers. The probe added a FAM on the 5′ end, a C3 spacer on the 3′ end and a dSpacer in the middle. And the reverse primers for RPA-LFD added a biotin on the 5′ end. Primers and probes for RPA-LFD were listed in Table 2. The primers and probes in this study were synthesized by Sangon Biotech (Shanghai, China).
virus (ISKNV) were kindly provided by professor Lingbing Zeng, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences. Other viruses and bacteria were kept in our lab. 2.2. Nucleic acid extraction ISKNV genomic DNA was extracted from the head-kidney and spleen of infected mandarin fish. The samples were cut with scissors and homogenized with 150 μL DNA isolation buffer (0.5% sodium dodecyl sulfate, 300 mM NaCl, 10 mM Tris HCl, 10 mM EDTA, pH 8.0, 20 μg/mL RNase). After incubated for 1 h at 37 °C, proteinase K was added to a concentration of 150 μg/mL and the samples were incubated at 55 °C overnight. Total DNA was extracted by conventional phenolchloroform procedure. The extracted DNA was then stored at −20 °C until ready for use.
2.4. Establishment of RPA and RPA-LFD assays The basic RPA was initiated by using the TwistAmp Basic kit (TwistDx, Cambridge, UK), and the reaction system contained 2.4 μL forward primer, 2.4 μL reverse primer, 29.5 μL rehydration buffer, 12.2 μL ddH2O and 1 μL sample DNA, and then started the reaction by adding 2.5 μL magnesium acetate. To define the optimal amplification temperature, RPA was performed at 20, 25, 30, 35, 38, 42, 45 and 50 °C for 30 min. To determine the optimal amplification time, reactions were performed at the most suitable temperature for 1, 5, 10, 15, 20, 25, 30
2.3. Design of primers and probes The highly conserved sequences MCP and ORF007 genes of ISKNV (GenBank accession number: AF371960.1) were chosen as target sequences. A series of RPA candidate primers were designed following 3
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 3. Specificity of RPA and RPA-LFD assays. The samples used for RPA and RPA-LFD specificity tests were ISKNV and other microbes. The products of RPA using the MCP primers (A) and ORF007 primers (B) were identified through agarose gel electrophoresis. The products of RPA-LFD with the MCP primers (C) and ORF007 primers (D) were detected by lateral flow dipsticks (LFD).
and 35 min. To test the optimal concentration of primers, reactions were performed using 0.5, 1, 5, 10, 15, 20 μM primers. The RPA productions were purified by AxyPrep PCR Clean-up Kit (Axygen, USA) and analyzed on 2% agarose gel electrophoresis subsequently. TwistAmp nfo kit (TwistDX, Cambridge, UK) and Hybridetect 1 (Milenia Biotec GmbH, GieBen, Germany) dipsticks were used for RPALFD. The reaction system included 2.1 μL forward primer, 2.1 μL reverse primer, 29.5 μL rehydration buffer, 0.6 μL probe, 12.2 μL ddH2O and 1 μL DNA and was also started by 2.5 μL magnesium acetate. RPALFD reactions were performed in gradient temperature and time as previously mentioned. Then, the products were diluted at 1:20 with ddH2O. Dipsticks were put into the diluted samples and the results can be read in 5 min.
amplification of PCR, RPA and RPA-LFD. Detection results of PCR, RPA and RPA-LFD were compared, and the sensitivity of the three methods was evaluated. The primers for generic PCR in this study were presented in Table 3, and primers MCPF155/MCPR156 and 007F157/ 007R158 in the table were used for generic PCR detection of ISKNV.
2.5. Specificity of RPA and RPA-LFD assays
3. Results
The specificity of RPA primers and probes was tested using ISKNV DNA, cyprinid herpesvirus 2 (CyHV-2) DNA, grass carp reovirus genotype I (GCRV-I) cDNA, grass carp reovirus genotype II (GCRV-II) cDNA, Aeromonas hydrophila DNA, Aeromonas veronii DNA, Staphylococcus aureus DNA and negative control (water) under optimal conditions. Amplification results of RPA and RPA-LFD were analyzed, and the specificity of RPA primers and probes was determined.
3.1. Evaluation of RPA primers
2.7. Practical evaluation of RPA and RPA-LFD assays DNA was extracted from mandarin fish collected in aquaculture farms. And the extracted DNA was used to verify the performance of PCR, RPA and RPA-LFD. The results of PCR, RPA and RPA-LFD were compared, and the practical performance of the three methods was evaluated.
The highly conserved sequences MCP and ORF007 of ISKNV were selected as target regions for primer and probe design, and six pairs of primers were designed for RPA assay. In the primer screening assay, all the three primer combinations of MCP and three primer combinations of ORF007 (Table 1) amplified the target sequences successfully, but MCP primers MCPF181/MCPR182 and ORF007 primers 007F197/ 007R198 yielded the best products on the agarose gel (Fig. 1). Therefore, primers MCPF181/MCPR182 and 007F197/007R198 were best for RPA assay. Target product amplified by MCPF181/MCPR182 was 196 bp in length and target product amplified by 007F197/007R198 was 295 bp in length.
2.6. Sensitivity of RPA and RPA-LFD assays The sequences MCP (1362 bp) and ORF007 (1458 bp) were obtained through PCR and cloned into the pMD18-T plasmids to generate recombinant plasmids pMD18-MCP and pMD18-ORF007. Then the concentration of the recombinant plasmids was determined by measuring absorbance at 260 nm and 280 nm and was converted to copy numbers. pMD18-MCP and pMD18-ORF007 recombinant plasmids were diluted a range of 100 to 107 copies/μL, and were used for
3.2. Optimal reaction conditions for RPA and RPA-LFD assays To obtain the optimal amplification temperature for RPA and RPA4
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 4. Comparison of the sensitivity of generic PCR, RPA and RPA-LFD assays. Using 100–107 copies/μL pMD18-MCP plasmid standards as samples, the minimum detectable concentration were determined by generic PCR (A), RPA (C) and RPA-LFD (E). And using 100–107 copies/μL pMD18-ORF007 plasmid standards as samples, the smallest detectable concentration were determined by generic PCR (B), RPA (D) and RPA-LFD (F).
of specificity detected by the ORF007 primers were the same as those of MCP primers (Fig. 3B and D). The results indicated that primers and probes of MCP and ORF007 were specific for ISKNV detection.
LFD, a temperature range of 20–50 °C was assessed in 30 min reactions. The results showed that both RPA and RPA-LFD reactions could be run at a wide range of temperatures from 25 to 42 °C, and the test band was the brightest at 38 °C (Fig. 2A and D). Thus, 38 °C was selected as the reaction temperature of ISKNV RPA and RPA-LFD. Next, the optimum reaction time was estimated between 1 and 35 min. The results indicated that the weak band could be seen in the test area when the reaction time was 5 min, and the distinct bands were seen when the reaction time was from 15 to 35 min (Fig. 2B and E). To complete RPA and RPA-LFD assays well, the reaction time was set at 30 min. RPA reactions were conducted in different concentrations of primers, the most distinct band was seen when the concentration was 10 μM (Fig. 2C). Therefore, 10 μM was chosen as the optimum concentration of primers for RPA and RPA-LFD.
3.4. Sensitivity of RPA and RPA-LFD assays The RPA, RPA-LFD and PCR assays were performed using a dilution series of plasmid standard samples containing 100–107 copies/μL of recombinant plasmids (pMD18-MCP or pMD18-ORF007). The results showed the minimum detectable concentration of generic PCR using the PCR primers of MCP was 103 copies/μL (Fig. 4A), and that of generic PCR using the PCR primers of ORF007 was also 103 copies/μL (Fig. 4B). The minimum detectable concentration of RPA and RPA-LFD using the MCP primers was 102 copies/μL (Fig. 4C and E), and that of RPA and RPA-LFD using the ORF007 primers was also 102 copies/μL (Fig. 4D and F). The sensitivity of RPA was the same as that of RPA-LFD. Both RPA and RPA-LFD were 10 times more sensitive than that in generic PCR method.
3.3. Specificity of RPA and RPA-LFD assays The specificity of RPA was investigated using DNA or cDNA samples from various viruses and bacteria. The RPA and RPA-LFD using the MCP primers did not detect cyprinid herpesvirus 2 (CyHV-2) DNA, grass carp reovirus genotype I (GCRV-I) cDNA, grass carp reovirus genotype II (GCRV-II) cDNA, Aeromonas hydrophila DNA, Aeromonas veronii DNA, Staphylococcus aureus DNA and negative control (water) samples, only ISKNV DNA yielded a positive result by agarose gel electrophoresis (Fig. 3A) and lateral flow dipsticks (Fig. 3C). The results
3.5. Practicability of RPA and RPA-LFD assays The practicability in diagnosing ISKNVD was evaluated by comparing detection results of RPA and RPA-LFD on 24 mandarin fish samples with generic PCR results on the same samples. The results showed that nine generic PCR positive samples (Fig. 5A) were also 5
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 5. Evaluation of the practicability of RPA and RPA-LFD using the MCP primers. 24 samples from aquaculture farms were detected by generic PCR (A), RPA (B) and RPA-LFD (C).
compared with LAMP and CPA. For example, the test conditions (38 °C within 30 min) are easily implemented. LAMP and CPA for ISKNV detection require a high temperature (60–65 °C), and reaction time of LAMP is longer than RPA (60 min) (Ding et al., 2010; Liu et al., 2018b). By comparison, RPA assay takes less than 30 min at 38 °C to complete. As such, RPA is simpler and more easily used than LAMP, CPA and PCR. In the present study, RPA and RPA-LFD methods were developed and evaluated for rapid, sensitive, and specific identification of ISKNV. The nucleotide sequences encoding the capsid proteins MCP and ORF007 are highly conserved sequences of ISKNV and often used as target genes for ISKNV detection (Lao et al., 2009; Lin et al., 2017). In this study, targeting the MCP and ORF007 genes, six primer combinations of RPA were designed for detection of ISKNV. Primer pairs MCPF181/MCPR182 and 007F197/007R198 were most effective in amplification and were selected for subsequent RPA detection (Fig. 1). The RPA reaction could be conducted excellently at 38 °C (Fig. 2A and D). Thus, 38 °C was selected as the standard assay temperature. And RPA reactions could be detectable when the reaction time was 5 min. To achieve good effects of detection, 30 min was selected as the standard assay time (Fig. 2B and E). The specificity of the RPA assay was determined by testing different microbes. Only ISKNV sample yielded a positive result by agarose gel electrophoresis (Fig. 3A and B) and lateral flow dipsticks (Fig. 3C and D). These results suggested RPA and RPALFD assays were specific for the detection of ISKNV. The sensitivity of the RPA and RPA-LFD was found to be 10 times sensitivity than generic
positive by RPA and RPA-LFD using the MCP primers (Fig. 5B and C). And using the ORF007 primers, these nine samples were also positive by generic RCR (Fig. 6A), RPA (Fig. 6B) and RPA-LFD (Fig. 6C). The results suggested that the developed RPA and RPA-LFD assays could feasibly be used for diagnostic and detection of ISKNV. 4. Discussion Mandarin fish (Siniperca chuatsi) is a significant cultured species with a large farming scale and economic value in China (Song et al., 2018). ISKNV has become a major pathogen in cultivated mandarin fish, and outbreaks of ISKNVD have posed a serious threat to the mandarin fish farming industry (Tao et al., 2007). Therefore, there is a critical need for rapid and convenient diagnosis of ISKNVD to prevent spread of this disease. Classical diagnostic methods are available and include dot blot hybridization, virus isolation in cell cultures, and various serological methods (Dong et al., 2008). In recent years, molecular biological methods have become more common for detection and identification of ISKNV and included generic PCR (Lao et al., 2009) and qPCR (Lin et al., 2017). However, these techniques can be limited for use in the small farms. The need of effective methods for rapid and accurate detection of ISKNV has led to the development of nucleic acid isothermal amplification methods, including LAMP (Ding et al., 2010) and CPA (Liu et al., 2018b). RPA is a novel isothermal amplification method for rapid DNA amplification. RPA has several advantages 6
Aquaculture 519 (2020) 734926
H. Li, et al.
Fig. 6. Evaluation of the applicability of RPA and RPA-LFD using the ORF007 primers. 24 samples from aquaculture farms were detected by generic PCR (A), RPA (B) and RPA-LFD (C).
Acknowledgements
PCR. Both RPA and RPA-LFD were able to detect recombinant plasmid samples at concentrations as low as 102 copies/μL (Fig. 4). In addition, both RPA and RPA-LFD methods showed consistent positive results with those of the generic PCR detection (Figs. 5 and 6), but RPA and RPA-LFD methods were more rapid than generic PCR. The whole RPALFD assay yielded results in 30 min, whereas PCR generates results approximately 2 h, furthermore, professional apparatus (PCR machine) is necessary for generic PCR reaction. In summary, our developed RPA and LFD assays take only 30 min, which are two times faster than the LAMP method, and four times faster than the generic PCR detection of ISKNV. And the reaction temperature is easier to achieve than LAMP and PCR. The RPA and RPA-LFD are also 10 times more sensitive than the generic PCR detection method. The high sensitivity and specificity of the methods are also the pivotal advantages. The results in this study indicated the appropriateness of RPA and RPA-LFD for rapid diagnosis of ISKNVD and that they have great potential for on-site testing of ISKNV.
The authors would like to thank Prof. Lingbing Zeng, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, for kindly gifted ISKNV. We also thank Mr. Jiacheng Zhang, Mr. Xingchen Huo, Miss Chengjian Fan for technical advice and assistance in experiments. This work was supported by Key Project of Scientific & Technological Innovation of Hubei Province (2018ABA101), National Key Research and Development Program of China (2018YFD0900504) and Special Grant of Scientific & Technological Innovation and Entrepreneuship Service Capacity Construction of Hubei Province (2018BEC482). References Bermudez, R., Losada, A.P., de Azevedo, A.M., Guerra-Varela, J., Perez-Fernandez, D., Sanchez, L., Padros, F., Nowak, B., Quiroga, M.I., 2018. First description of a natural infection with spleen and kidney necrosis virus in zebrafish. J. Fish Dis. 41, 1283–1294. Boyle, D.S., Lehman, D.A., Lillis, L., Peterson, D., Singhal, M., Armes, N., Parker, M., Piepenburg, O., Overbaugh, J., 2013. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification. MBio. 4, 1–8. Ding, W.C., Chen, J., Shi, Y.H., Lu, X.J., Li, M.Y., 2010. Rapid and sensitive detection of infectious spleen and kidney necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. Arch. Virol. 155, 385–389. Dong, C., Weng, S., Shi, X., Xu, X., Shi, N., He, J., 2008. Development of a mandarin fish Siniperca chuatsi fry cell line suitable for the study of infectious spleen and kidney necrosis virus (ISKNV). Virus Res. 135, 273–281. Dong, C., Xiong, X., Luo, Y., Weng, S., Wang, Q., He, J., 2013. Efficacy of a formalin-killed cell vaccine against infectious spleen and kidney necrosis virus (ISKNV) and
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
7
Aquaculture 519 (2020) 734926
H. Li, et al.
474–484. Liu, W., Zhou, Y., Fan, Y., Jiang, N., Cain, K., Zeng, L., 2018b. Development of crosspriming amplification coupled with vertical flow visualization for rapid detection of infectious spleen and kidney necrosis virus (ISKNV) in mandarin fish, Siniperca chuatsi. J. Virol. Methods 253, 38–42. Miao, F., Zhang, J., Li, N., Chen, T., Wang, L., Zhang, F., Mi, L., Zhang, J., Wang, S., Wang, Y., Zhou, X., Zhang, Y., Li, M., Zhang, S., Hu, R., 2019. Rapid and sensitive recombinase polymerase amplification combined with lateral flow strip for detecting African swine fever virus. Front. Microbiol. 10, 1–7. Mohr, P.G., Moody, N.J., Williams, L.M., Hoad, J., Cummins, D.M., Davies, K.R., Crane, M.S., 2015. Molecular confirmation of infectious spleen and kidney necrosis virus (ISKNV) in farmed and imported ornamental fish in Australia. Dis. Aquat. Org. 116, 103–110. Piepenburg, O., Williams, C.H., Stemple, D.L., Armes, N.A., 2006. DNA detection using recombination proteins. PLoS Biol. 4, 1115–1121. Shi, C.Y., Jia, K.T., Yang, B., Huang, J., 2010. Complete genome sequence of a Megalocytivirus (family Iridoviridae) associated with turbot mortality in China. Virol. J. 7, 159. Song, Y., Cheng, F., Zhao, S., Xie, S., 2018. Ontogenetic development and otolith microstructure in the larval and juvenile stages of mandarin fish Siniperca chuatsi. Ichthyol. Res. 66, 57–66. Tanaka, N., Izawa, T., Kuwamura, M., Higashiguchi, N., Kezuka, C., Kurata, O., Wada, S., Yamate, J., 2014. The first case of infectious spleen and kidney necrosis virus (ISKNV) infection in aquarium-maintained mandarin fish, Siniperca chuatsi (Basilewsky), in Japan. J. Fish Dis. 37, 401–405. Tao, J.J., Gui, J.F., Zhang, Q.Y., 2007. Isolation and characterization of a rhabdovirus from co-infection of two viruses in mandarin fish. Aquaculture. 262, 1–9. Wang, Y.Q., Lu, L., Weng, S.P., Huang, J.N., Chan, S.M., He, J.G., 2007. Molecular epidemiology and phylogenetic analysis of a marine fish infectious spleen and kidney necrosis virus-like (ISKNV-like) virus. Arch. Virol. 152, 763–773. Wang, H., Sun, M., Xu, D., Podok, P., Xie, J., Jiang, Y., Lu, L., 2018. Rapid visual detection of cyprinid herpesvirus 2 by recombinase polymerase amplification combined with a lateral flow dipstick. J. Fish Dis. 41, 1201–1206. Xia, X., Yu, Y., Weidmann, M., Pan, Y., Yan, S., Wang, Y., 2014. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay. PLoS One 9, e104667. Xia, X., Yu, Y., Hu, L., Weidmann, M., Pan, Y., Yan, S., Wang, Y., 2015. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay. Arch. Virol. 160, 987–994. Zhang, J., Fu, X., Zhang, Y., Zhu, W., Zhou, Y., Yuan, G., Liu, X., Ai, T., Zeng, L., Su, J., 2019. Chitosan and anisodamine improve the immune efficacy of inactivated infectious spleen and kidney necrosis virus vaccine in Siniperca chuatsi. Fish Shellfish Immunol. 89, 52–60.
immunoproteomic analysis of its major immunogenic proteins. Vet. Microbiol. 162, 419–428. Dong, H.T., Jitrakorn, S., Kayansamruaj, P., Pirarat, N., Rodkhum, C., Rattanarojpong, T., Senapin, S., Saksmerprome, V., 2017. Infectious spleen and kidney necrosis disease (ISKND) outbreaks in farmed barramundi (Lates calcarifer) in Vietnam. Fish Shellfish Immunol. 68, 65–73. Fu, X., Li, N., Lai, Y., Liu, L., Lin, Q., Shi, C., Huang, Z., Wu, S., 2012. Protective immunity against iridovirus disease in mandarin fish, induced by recombinant major capsid protein of infectious spleen and kidney necrosis virus. Fish Shellfish Immunol. 33, 880–885. Fusianto, C., Hick, P.M., Becker, J.A., 2019. Stability of infectious spleen and kidney necrosis virus and susceptibility to physical and chemical disinfectants. Aquaculture. 506, 104–111. Gray, M.J., Miller, D.L., Hoverman, J.T., 2009. Ecology and pathology of amphibian ranaviruses. Dis. Aquat. Org. 87, 243–266. He, J.G., Deng, M., Weng, S.P., Li, Z., Zhou, S.Y., Long, Q.X., Wang, X.Z., Chan, S.M., 2001a. Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology. 291, 126–139. He, J.G., Wang, S.P., Zeng, K., Huang, Z.J., Chan, S.M., 2001b. Systemic disease caused by an iridovirus-like agent in cultured mandarinfish, Siniperca chuatsi (Basilewsky), in China. J. Fish Dis. 23, 219–222. He, J.G., Zeng, K., Weng, S.P., Chan, S.M., 2002. Experimental transmission, pathogenicity and physical-chemical properties of infectious spleen and kidney necrosis virus ISKNV. Aquaculture. 204, 11–24. Huang, Z., Tang, J., Li, M., Fu, Y., Dong, C., Zhong, J., He, J., 2012. Immunological evaluation of Vibrio alginolyticus, Vibrio harveyi, Vibrio vulnificus and infectious spleen and kidney necrosis virus (ISKNV) combined-vaccine efficacy in Epinephelus coioides. Vet. Immunol. Immunopathol. 150, 61–68. Jung-Schroers, V., Adamek, M., Wohlsein, P., Wolter, J., Wedekind, H., Steinhagen, D., 2016. First outbreak of an infection with infectious spleen and kidney necrosis virus (ISKNV) in ornamental fish in Germany. Dis. Aquat. Org. 119, 239–244. Lao, H.H., Ye, X., Zou, W.M., Bai, J.J., Tan, A.P., 2009. Detection of infectious spleen and kidney necrosis virus (ISKNV) of mandarin fish (Siniperca chuatsi) by nested PCR. South China Fish Sci. 5, 69–72 (in Chinese with English abstract). Lin, Q., Fu, X., Liu, L., Liang, H., Guo, H., Yin, S., Kumaresan, V., Huang, Z., Li, N., 2017. Application and development of a TaqMan real-time PCR for detecting infectious spleen and kidney necrosis virus in Siniperca chuatsi. Microb. Pathog. 107, 98–105. Liu, W., Liu, H.X., Zhang, L., Hou, X.X., Wan, K.L., Hao, Q., 2016. A novel isothermal assay of Borrelia burgdorferi by recombinase polymerase amplification with lateral flow detection. Int. J. Mol. Sci. 17, 1–8. Liu, X., Chen, N., Gao, X., Zhang, Y., Li, X., Zhang, Y., Bing, X., Huang, H., Zhang, X., 2018a. The infection of red seabream iridovirus in mandarin fish (Siniperca chuatsi) and the host immune related gene expression profiles. Fish Shellfish Immunol. 74,
8