Rapid and visual detection of enterovirus using recombinase polymerase amplification combined with lateral flow strips

Sensors & Actuators: B. Chemical 311 (2020) 127903

Contents lists available at ScienceDirect

Sensors and Actuators B: Chemical journal homepage: www.elsevier.com/locate/snb

Rapid and visual detection of enterovirus using recombinase polymerase amplification combined with lateral flow strips

T

Xiaohan Yanga,b,1, Jia Xiea,1, Siqi Hua, Wenli Zhana,b, Lei Duana, Keyi Chena,b, Changbin Zhanga,b, Aihua Yina,b, Mingyong Luoa,b,* a b

Medical Genetic Centre, Guangdong Women and Children Hospital, Guangzhou Medical University, Guangzhou, China Medical Genetic Centre, Guangdong Women and Children Hospital, Guangzhou, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Enterovirus Recombinase polymerase amplification Lateral flow strips Rapid detection

Enteroviruses (EVs) are the most common causative pathogen of infection in children aged under 5 years. Routine laboratory methods for detecting EV are time consuming, labor intensive, and require sophisticated thermal cycling instruments and skilled operators, which are not available in limited-resource settings. In this study, a novel isothermal amplification, recombinase polymerase amplification (RPA) combined with lateral flow strips (LFS), was established to detect EVs. Specific RPA-LFS primers and probe were designed to target the highly conserved regions of 5′-UTR. The analytical sensitivity for detection of EV was 5 copies per reaction, with 100 % specificity. The clinical performance was evaluated using 177 clinical samples, and the coincidence rates between RPA and commercial quantitative real-time PCR was 100 %. In conclusion, the RPA-LFS developed in this study is a rapid, specific, sensitive, and accurate assay for detecting EV and could thus be an ideal diagnostic tool for EV infections in limited-resource settings. It is the first time that RPA-LFS assay has been applied to the detection of EV infection.

1. Introduction Enteroviruses (EVs), a member of the Picornaviridae family, are the most common infectious pathogens affecting children under 5 years old [1,2]. With respect to genetic characteristics, EV infecting humans are divided into four species: A–D [3]. Species A enteroviruses, such as Coxsackievirus A (CA) 2–8, 10, and 16 and Enterovirus A71 (EV71), are the predominant etiologic agents of hand, foot, and mouth disease (HFMD). Since 1997, several HFMD outbreaks had occurred in the AsiaPacific region, and thus HFMD has become an important disease that seriously threatens the health of children worldwide [4–6]. Generally, EV infections in infants and young children are asymptomatic or selflimiting diseases. However, severe complications, including aseptic meningitis, acute flaccid paralysis, encephalitis, and cardiorespiratory failure, and even death have been observed in some cases of EV infection [7,8]. To date, there is no specific antiviral treatment for EV infection, and the only commercial vaccine against EV71 cannot protect

children from other EVs [9]. Therefore, a rapid and sensitive detection assay for EV at the early stage of infection is vital for improving outcomes and monitoring disease prevalence, including that of HFMD. The traditional laboratory methods for EV detection include virus isolation culture and serological methods [10–12]. However, virus isolation culture is time-consuming and labor-intensive, and has low sensitivity (62.6–75 %) [13,14]; serological methods such as ELISA and neutralization are obsolete due to cross-reactivity and inherent requirements for different EV types [15]. Thus, the aforementioned disadvantage limits their application for timely diagnosis at an early stage of the infection and for large-scale screening during epidemics. Molecular diagnostic methods with high sensitivity and specificity, including reverse transcription polymerase chain reaction (RT-PCR) and quantitative real-time polymerase chain reaction (q-PCR), can detect EV within 3 h and are thus superior to traditional laboratory methods in detecting EV [16,17]. However, these methods require sophisticated thermal cycling instruments and skilled operators, making them

Abbreviations: EV, enterovirus; EV71, Enterovirus A71; AGE, agarose gel electrophoresis; CA, Coxsackievirus A; HFMD, hand, foot, and mouth disease; RPA, recombinase polymerase amplification; POCT, point-of-care testing; q-PCR, quantitative real-time polymerase chain reaction; LFS, lateral flow strips; E, Echovirus; LAMP, loop-mediated isothermal amplification; NASBA, nucleic acid sequence-based amplification; RT-RPA, real-time reverse transcription RPA; RT-PCR, reverse transcription polymerase chain reaction; FMD, foot-and-mouth disease; LOC, lab-on-a-chip ⁎ Corresponding author at: Medical Genetic Centre, Guangdong Women and Children Hospital, No.521, Xingnan Avenue, Panyu District, Guangzhou, China. E-mail address: [email protected] (M. Luo). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.snb.2020.127903 Received 24 October 2019; Received in revised form 16 January 2020; Accepted 19 February 2020 Available online 20 February 2020 0925-4005/ © 2020 Elsevier B.V. All rights reserved.

Sensors & Actuators: B. Chemical 311 (2020) 127903

X. Yang, et al.

unsuitable for primary clinical setting and field situations. Therefore, these typical aforementioned methods are not suitable for the detection of EV in resource-limited settings. To address the above shortcomings and meet the need of point-ofcare testing (POCT), some isothermal nucleic acid amplification technologies have been developed for detecting infectious pathogens [18–21]. Compared to conventional PCR, isothermal amplification technologies do not need expensive thermocycling equipment for denaturation, annealing, and extension, and thus they could be used in simple and crude conditions at a constant reaction temperature. Recombinase polymerase amplification (RPA), one of the isothermal amplification methods with high sensitivity and specificity, has received considerable attention owing to a shorter detecting time and constant low reaction temperature [20,22]. Recombinase, single-stranded DNAbinding protein and strand-displacing polymerase are the main enzymes in the amplification reaction. Since RPA technology was first reported in 2006, it has been widely applied in many fields, including in virus, bacteria, parasite, base mutation, and food safety [23–27]. RPA products can be analyzed using agarose gel electrophoresis (AGE), probe-based fluorescence monitoring, and lateral flow strips (LFS) [22,23]. LFS, a portable device, can be used to visually detect products. Compared to AGE and fluorescence monitoring, LFS may be more suitable for application in limited-resource settings. In this study, we attempted to develop an RPA-LFS assay for simple, rapid, and sensitive detection of EV (PanEV-RPA-LFS).

2.2. RPA primer and probe design 5′-UTR, a non-coding region, is highly conserved and typically chosen for detecting EVs [29]. Due to the high evolutionary rates of EVs, it is impossible to align all available sequences. A multiple sequence alignment of 5′-UTR, submitted to the GenBank database in the recent 5 years, was performed with the MEGA 5.0 program to identify the highly conserved region of EV. Based on the highly conserved region of EV 5′-UTR, primers and probe were designed in accordance with the TwistAmp® nfo kits manual (TwistDx, Cambridge, England). Primers and probe were synthesized by Sangon Biotech (Shanghai, China). Primers and probe for RPA assay are listed in Table 2, and EV 71 (GenBank accession no. FJ600325.1) used as a reference sequence to locate each primer and probe. 2.3. Standard plasmid construction To optimize the RPA assay and evaluate the detection limit, a 576 bp fragment at 5′-UTR of CA6 genome was amplified via PCR using a pair primer (forward primer: 5′-AGTCCTCCGGCCCCTGAATGCGGCTA ATCC-3′; reverse primer: 5′-ATTGTCACCATAAGCAGCC-3′) [30]. The PCR product was purified and cloned into the pESI-T simple vector. The recombinant plasmids were quantified with a NanoDrop 2000 spectrophotometer (Thermo Scientific, US), and the DNA copy number was calculated. The recombinant plasmids were verified via sequencing and stored at -80 ℃ until use.

2. Material and methods

2.4. Nucleic acid extraction and cDNA synthesis

2.1. Sample collection and virus isolation

Viral RNA was extracted using QIAamp viral RNA mini kit (Qiagen, Germany) according to the manufacturer’s instructions. The RNA was eluted in 60 μl of elution buffer. In the sensitivity assays, the plasmid spiked in stool sample was extracted using EX-DNA/RNA Virus Kit (Suzhou Tianlong Bio-techology Co., Ltd, Suzhou, China). cDNA was synthesized with PrimerScript™ 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) in a total volume of 10 μl according to the manufacturer’s instructions. The tube with cDNA was used in the next step of RPA assay.

The specificity of this assay was evaluated by a panel of common EVs isolated from HFMD cases verified via sequencing as described previously and other pathogens pertinent to EV [28]. The samples were stored at −80℃ until RNA purification. All the pathogens were shown in Table 1. In addition, a total of 177 clinical samples, including stool/ rectal samples (n = 129), throat swabs (n = 38), and cerebrospinal fluid (n = 10), were collected from patients with suspected HFMD admitted to Guangdong Women and Children Hospital, Guangzhou. To evaluate the clinical performance of RPA, all clinical sample were tested by commercial q-PCR and RPA in parallel. The samples were immediately processed. This study was approved by the ethics committee of Guangdong Women and Children Hospital. All information collected from patients was anonymized prior to analysis, and informed consent was waived.

2.5. PanEV-RPA-LFS assay PanEV-RPA-LFS was performed using the TwistAmp® nfo kits in a 50 μl volume. A pre-mixture containing 29.5 μl rehydration buffer, 3.2 μl dH2O, 2.1 μl forward primer (10 μm), 2.1 μl reverse primer (10 μm), and 0.6 μl probe (10 μm) was prepared in advance. Then, the pre-

Table 1 Enterovirus and other pathogens used to evaluate the specificity in this study. Pathogens

a

Coxsackievirus A

Coxsackievirus B

EV 71 Echoviruses

a b c

Subtype/subgroup

Source

CA2 CA4 CA5 CA6 CA9 CA10 CA16 CB2 CA4 CB5 / E6 E11 E18

Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical Clinical

Result sample sample sample sample sample sample sample sample sample sample sample sample sample sample

+ + + + + + + + + + + + + +

c

Pathogens

b

Influenza A Influenza B Respiratory syncytial virus Adenovirus Rotavirus Human parechovirus Cytomegalovirus Human rhinovirus Escherichia coli Staphylococcus aureus Streptococcus pneumoniae Haemophilus influenzae Monilia albicans

The subtypes of enterovirus used to evaluate the specificity of PanEV-RPA-LFS in this study. Other pathogens used to evaluate the specificity of PanEV-RPA-LFS in this study. The result of specificity of PanEV-RPA-LFS. +, positive result; -, negative result. 2

Subtype/subgroup

Source

Result

Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown / / / / /

Clinical sample Clinical sample Clinical sample Clinical sample Clinical sample Clinical sample Clinical sample Clinical sample ATCC 35218 ATCC 25923 ATCC 49619 ATCC 10211 ATCC 10231

– – – – – – – – – – – – –

c

Sensors & Actuators: B. Chemical 311 (2020) 127903

X. Yang, et al.

Table 2 Sequences of primers and probe for PanEV-RPA-LFS assay. Primers/Probea

Sequence (5′-3′)

Genomic position

PanEV-F

[Biotin]AGTCCTCCGGCCCCTGAATG CGGCTAATCC GGATGGCCAATCCAATAGCTATATGGTAACAA [FAM]GGAAACACGGACACCCAAA GTAGTCGGTTC[dSpacer]GCTGCAGA GTTRCCC[C3-spacer]b

432-461

PanEV-R PanEV-P

a b

596-627 509-554

Product size (bp)

195 123

PanEV-F, Forward primer; PanEV-R, Reverse primer, PanEV-P, Probe. FAM, Carboxyfluorescein; dSpacer: A tetrahydrofuran residue; C3-spacer, 3′-block.

mixture and 2.5 μl magnesium acetate solution (280 mm) were added to the tube in the previous step; this tube contained 10 μl cDNA. The premix was incubated in a heat block at 39℃. Each RPA reaction was performed by the same operator for three times. The RPA products were detected via AGE and LFS as described in our previous study [31]. The RPA products were purified using QIAquick PCR Purification Kit (Qiagen, Germany). Then, the purified products were subjected to electrophoresis on a 2% agarose gel and analyzed under ultraviolet light. The products, labelled with FAM and biotin, were visualized using LFS within 5−10 min. A mixed solution containing 5 μl product mixed with 100 μl HybriDetect Assay Buffer (Milenia Biotec GmbH, Germany) was detected using LFS. The sample was considered to be EV positive when both a test line and a control line were visible, and negative when only a control line was visible. The result was considered to be invalid if the control line was invisible. 2.6. q-PCR assay Commercial q-PCR assay kits for EV were purchased from Daan Gene (Guangzhou, China). The reactions were carried out using 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA, USA). All procedures were performed according to the manufacturer’s instructions. 3. Results 3.1. Optimization of PanEV-RPA-LFS assay To determine the optimal reaction conditions of this assay, the plasmids containing 104 copies used as a template to evaluate the difference in incubation temperatures and times. At the beginning of this assay, the mixtures were incubated at 36, 37, 38, 39, 40, and 41℃ for 40 min, and the amplicons were analyzed using AGE. The template could be successfully amplified under all temperatures, and the highest intensity lines were detected at 39℃ (Fig. 1a). Then, 39℃ was chosen as the optimal reaction temperature for PanEV-RPA-LFS assay. Similarly, the assays were performed at 39℃ for a series of reaction times (5, 10, 15, 20, 30, 35, and 40 min) to define the optimal reaction time. As shown in Fig. 1b, no line was observed in reactions incubated for 5 min, and the product lines emerged when the incubation time was increased to 10 min. The brightness of lines increased as the incubation time increased from 10 to 30 min, and no significant differences in lines were observed when the mixture was incubated between 30 and 40 min. The results were consistent in the three analysis. Therefore, 30 min was ultimately used as the optimal reaction time for PanEV-RPA-LFS assay.

Fig. 1. Optimization of Pan-RPA-LFS reaction conditions. (a) Different reaction temperatures were evaluated to determine the optimal temperature for PanRPA-LFS assay. (b) Different reaction times were evaluated to determine the optimal reaction time for Pan-RPA-LFS assay. BC, black control with no template; M, DL1000 Marker.

successfully with clear target lines on the AGE and LFS. In the Fig. 3, no lines were observed for all the other pathogens pertinent to EVs in the PanEV-RPA-LFS assay. No cross-reactions with other pathogens were observed in this assay. The same results were observed in all three tests. The results demonstrated the high specificity of the primers and probes used in the detection of EVs. 3.3. Sensitivity of PanEV-RPA-LFS assay To validate the sensitivity of PanEV-RPA-LFS assay, recombinant plasmids and spiked samples were used. A panel of serially diluted recombinant plasmids were used to determine the sensitivity of RPA assay. The plasmids were diluted at a range of 5 × 105 to 5 × 10° copies/μl as the template in the RPA reactions, and all reaction products were analyzed using LFS for three times. As shown in Fig. 4 (a), the test line and control line were clearly observed in all LFS except for blank

3.2. Specificity of PanEV-RPA-LFS assay The specificity of PanEV-RPA-LFS assay for EVs was evaluated by using nucleic acids extracted from a panel of EV subtypes and other pathogens pertinent to EVs, which produced similar clinical symptoms or colonized the same organs. As shown in Fig. 2, CA2, CA4-6, CA9-10, CA16, CB2, CB4-5, EV71, Echovirus (E) 6, E11, and E18 were amplified 3

Sensors & Actuators: B. Chemical 311 (2020) 127903

X. Yang, et al.

Fig. 2. Specificity of Pan-RPA-LFS assay for EV subtypes. The specificity was evaluated according to EV subtypes using AGE (a) and LFS (b). Lane 1, CA2; Lane 2, CA4; Lane 3, CA5; Lane 4, CA6; Lane 5, CA9; Lane 6, CA10; Lane 7, CA16; Lane 8, CB2; Lane 9, CB4; Lane 10, CB5; Lane 11, EV71; Lane 12, E6; Lane 13, E11; Lane 14, E18. BC, black control with no template; M, DL1000 Marker.

Fig. 3. Specificity of Pan-RPA-LFS assay for other pathogens. The specificity was evaluated according to other pathogens using AGE. Lane 1, influenza A; Lane 2, influenza B; Lane 3, respiratory syncytial virus (RSV); Lane 4, adenovirus; Lane 5, rotavirus; Lane 6, human parechovirus; Lane 7, cytomegalovirus (CMV); Lane 8, human rhinovirus; Lane 9, Escherichia coli (E. coli); Lane 10, Staphylococcus aureus (S. aureus); Lane 11, Streptococcus pneumoniae; Lane 12, Haemophilus influenzae; Lane 13, Monilia albican; Lane 14, positive control. BC, black control with no template; M, DL1000 Marker.

LFS, and the result of q-PCR was the same as that of the RPA (Table 3). The detailed results had been shown in Supplemental File 1. In the Fig. 5, three representative clinical samples were tested by PanEV-RPALFS and q-PCR, and the result of two assays were consistent. This indicated that PanEV-RPA-LFS assay has similar performance with that of q-PCR, but the PanEV-RPA-LFS assay performed at a lower temperature and in less time.

control, and the results were consistent in the three analysis. Therefore, the detection limit of RPA-LFS assay was 5 copies per reaction for EVs. In addition, the sensitivity of RPA assay was also validated by a series of recombinant plasmids spiked in stool samples to better reflect the actual situation of clinical samples. Stool samples were collected from children without EV infection. A succession of plasmids extracted from stool samples were used as the template in the RPA reactions, and the concentrations of plasmid ranged from 5 × 105 to 5 × 10° copies/ μl. All the reaction products were analyzed using LFS thrice. As shown in Fig. 4(b), the test line and control line were clearly observed from 5 × 105 to 5 × 101 copies/μl, and only control line were observed for blank control and 5 × 10° copies/μl. The results were consistent in the three analyses. For the plasmids spiked in stool samples, the detection limits of RPA-LFS assay were 50 copies per reaction.

4. Discussion In recent decades, outbreaks and sporadic children infection with enterovirus have been reported [2,4,6]. The clinical manifestations of patients are usually atypical at the early stage of infection, and thus timely diagnosis is essential to the disease control and prevention. In this study, we developed a novel RPA-LFS assay with high sensitivity and specificity for the detection of EV. The PanEV-RPA assay was amplified at 39℃ for 30 min, and the result could be easily determined by inspecting visible lines on the LFS without need for training. Therefore, the RPA assay in this study is an ideal diagnostic tool for detecting EVs in limited-resource settings. The RPA-LFS developed in this study is first reported to detect EV infection. The primers and probe of RPA were designed based on the highly

3.4. Evaluation of PanEV-RPA-LFS assay with clinical specimens To validate the clinical performance of the PanEV-RPA-LFS assay, a total of 177 clinical samples were collected from patients with suspected HFMD. Nucleic acid extracted from all samples was tested using PanEV-RPA-LFS and q-PCR, respectively. Among the 177 samples, 122 samples were positive and 55 samples were negative for PanEV-RPA4

Sensors & Actuators: B. Chemical 311 (2020) 127903

X. Yang, et al.

Fig. 4. Sensitivity of Pan-RPA-LFS assay. The sensitivity was evaluated according to EV standard plasmids and spiked samples using LFS. (a) The sensitivity was evaluated using 10-fold serially diluted EV standard plasmids ranging from 5 × 10° to 5 × 105 copies per reaction, (b) The sensitivity was evaluated using spiked samples ranging from 5 × 10° to 5 × 105 copies per reaction. BC, black control with no template. Table 3 Comparison of clinical performance between PanEV-RPA-LFS assay and RTPCR.

Fig. 5. Comparison of Pan-RPA-LFS assay with q-PCR performed on three representative clinical samples. (a) The three representative clinical samples were detected by Pan-RPA-LFS assay. (b) The three representative clinical samples were detected by q-PCR assay. The cycle threshold value of samples (1-3) were 34.6, 28.9, and 21.7, respectively. BC, black control with no template.

Real-time PCR

RPA (n = 177)

Positive Negative

Positive

Negative

122 0

0 55

is made according to the cytopathic effect induced by EV and the increase of EV-specific antibody concentrations. However, several obvious shortcomings, e.g., the long turnaround time, low sensitivity, and cross-reactivity of the antigens between different serotypes make them inappropriate for routine EV diagnosis [15]. In addition, molecular methods, such as RT-PCR, q-PCR, microarray, and gold nanoparticle improved immuno-PCR, have been widely developed to detect EVs [33–35]. Several commercial diagnosis kits for the clinical detection of EV have been validated to have good sensitivity and repeatability. Compared to cell culture and serological methods, molecular methods have high sensitivity, specificity, and throughput, and thus they could identify infectious pathogens in the early stage and monitor diseases during epidemic. However, these molecular methods require sophisticated instruments and trained workers, limiting their applicability for primary health care settings and the field. Therefore, it is urgent to develop a rapid and sensitive method to detect EV in limited-resource settings. Aside from our RPA-LFS assay, other isothermal amplification techniques that include nucleic acid sequence-based amplification

conserved region of 5′-UTR, which can specifically detect enteroviruses without cross-reactivity with other pathogens. The specificity of PanEVRPA assay indicated that positive signals were only observed in EVs and no cross-reactivity with other pathogens. For the plasmid samples and spiked samples, the detection of limits of PanEV-RPA assay were 5 and 50 copies per reaction. The discrepancy of sensitivity results was associated with the process of nucleic acid extraction. The nucleic acid extraction and recovery rate was an important factor affecting the sensitivity of this assay, and it may depend on the concentration nucleic acid [32]. Therefore, to increase the sensitivity of this assay in subsequent studies, it is necessary to improve the recovery rate of nucleic acid extraction. To evaluate the clinical performance of PanEV-RPA assay, 177 samples were detected by PanEV-RPA-LFS assay and a commercial q-PCR kit. The results of the RPA assay were completely consistent with those of the q-PCR assay. Virus isolation culture and serological methods are the conventional methods for EV detection. Under these two methods, clinical diagnosis 5

Sensors & Actuators: B. Chemical 311 (2020) 127903

X. Yang, et al.

5. Conclusion

(NASBA) and loop-mediated isothermal amplification (LAMP) to detect EV have already been reported [18,19]. NASBA could amplify singlestranded RNA sequences at one temperature based on three enzymes (reverse transcriptase, RNase H, and DNA-dependent RNA polymerase), but an initial heating step was needed, which allowed annealing of the primers to the targets before amplification reaction. For LAMP, complete amplification was performed at 60-65℃ for 1 h without a sophisticated thermal cycle and, therefore, it is considered an ideal option in limited-resource settings. However, LAMP requires four special primers, making it difficult for the design of primers at the target region. Our RPA-LFS assay had distinct advantages over NASBA and LAMP. First, the amplification reaction at 39℃ can be completed within 30 min without an additional heating step. The constant low reaction temperature and shorter reaction time make RPA-LFS extremely useful in the field. Some studies have successfully used human body parts (about 36-37℃), such as axilla and closed fists, as a heat block for incubating RPA reactions [21,36]. Moreover, the design of RPA primers was simpler than that of primers for LAMP, which is important in diagnostic methods for certain pathogens with high genetic variability, including EVs, influenza viruses, and foot-and-mouth disease (FMD) viruses. Further, LFS, a visual device, was integrated with RPA, which can simplify the operation process and eliminate the need for well-trained personnel. Therefore, the RPA combined with LFS method has the potential to become an ideal tool for POCT. RPA method has achieved many satisfactory achievements to detect pathogens in field, such as FMD virus and Ebola virus [37,38]. In the EV detection, only CA6 and EV71 were reported using real-time reverse transcription RPA (RT-RPA) [39,40]. The sensitivities for CA6 and EV71 were 202 and 3.767 log10 copies per reaction, respectively. The specificities were 100 %, and their clinical performance was similar to that of commercial q-PCR diagnosis kits. However, the results of these assays need to be analyzed using fluorescence monitor; thus, compared to the RT-RPA, RPA-LFS in this study was more suitable for POCT as it did not require complex equipment. Moreover, the PanEV-RPA-LFS could detect not only CA6 and EV71, but also other subtypes of EVs; therefore, it can be used for large-scale assessments during epidemics, particularly of HFMD. However, the assay has some limitations. First, commercial nucleic acid exaction kits used in this study require specialized lab equipment in specimen processing, which may undermine the applicability in the field. Further studies should pay more attention on the development of rapid and efficient nucleic acid extraction methods, which will improve the application of isothermal amplification technology in POCT. Second, to simplify operation and reduce errors, we wanted to integrate the reverse transcription process with RPA reaction in a single tube, which failed and identified no target amplicon. We suspected that the failure may have been caused by an interfering substance in the clinical specimens or the mutual inhibition between reverse transcriptase and enzymes of RPA at a similar optimum reaction temperature. To improve practicability, we made minor modifications in the operation process. When cDNA was synthesized, a pre-mixture containing RPA reagents was transferred to the same tube in the last step. However, in further studies, attention is still required when performing reverse transcription and RPA reaction in a single tube, which could upgrade optimize practicability. Third, potential contamination was a notable drawback of RPA-LFS, which may be caused by opening the reaction tube when the product was analyzed via LFS [41]. Thus, it is crucial to take precautions to prevent potential contamination during the assay, such as using a sealed device during the analysis of RPA products [42]. In addition, RPA combined with lab-on-a-chip (LOC) platforms were developed with some incomparable advantages [43,44], including crosscontamination prevention, shortened operation time, less consumption of reagents, higher reproducibility, and good cost-efficiency. LOC could complete parallel analysis or successive operations at separate chambers, which would be one of the promising directions of RPA in the future.

In this study, we developed a rapid and simple RPA-LFS assay for the EV detection for the first time. The RPA-LFS assay has good sensitivity and specificity and may provide an appropriate alternative for the detection of EVs for POCT. Further study is required to integrate the sample processing, amplification, and result analysis in a portable device. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This work was supported by the Guangdong Science and Technology Department (Grant numbers 2016A020218011); the Medical Science and Technology Research Project of Guangdong Province (Grant numbers A2018212); and the Guangzhou Science, Technology and Innovation Commission (Grant number 201904010452). The funders had no role in study design, data collection, data analysis, data interpretation, writing of the report, or decision to submit for publication. We would also like to thank Editage (www. editage.com) for English language editing. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.snb.2020.127903. References [1] C. Lin, Y. Wang, S. Chen, C. Hsiung, C. Lin, Precise genotyping and recombination detection of Enterovirus, BMC Genomics 16 (Suppl. 12) (2015) S8. [2] W. Xing, Q. Liao, C. Viboud, J. Zhang, J. Sun, J.T. Wu, et al., Hand, foot, and mouth disease in China, 2008–12: an epidemiological study, Lancet Infect. Dis. 14 (2014) 308–318. [3] R. Zell, Picornaviridae—the ever-growing virus family, Arch. Virol. 163 (2018) 299–317. [4] S. AbuBakar, H.Y. Chee, M.F. Al-Kobaisi, J. Xiaoshan, K.B. Chua, S.K. Lam, Identification of enterovirus 71 isolates from an outbreak of hand, foot and mouth disease (HFMD) with fatal cases of encephalomyelitis in Malaysia, Virus Res. 61 (1999) 1–9. [5] T. Fujimoto, M. Chikahira, S. Yoshida, H. Ebira, A. Hasegawa, A. Totsuka, et al., Outbreak of central nervous system disease associated with hand, foot, and mouth disease in Japan during the Summer of 2000: detection and molecular epidemiology of enterovirus 71, Microbiol. Immunol. 46 (2002) 621–627. [6] Y. Zhang, Z. Zhu, W. Yang, J. Ren, X. Tan, Y. Wang, et al., An emerging recombinant human enterovirus 71 responsible for the 2008 outbreak of hand foot and mouth disease in Fuyang city of China, Virol. J. 7 (2010) 94. [7] X.W. Li, X. Ni, S.Y. Qian, Q. Wang, R.M. Jiang, W.B. Xu, et al., Chinese guidelines for the diagnosis and treatment of hand, foot and mouth disease (2018 edition), World J. Pediatr. 14 (2018) 437–447. [8] T. Solomon, P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn, M.H. Ooi, Virology, epidemiology, pathogenesis, and control of enterovirus 71, Lancet Infect. Dis. 10 (2010) 778–790. [9] F. Zhu, W. Xu, J. Xia, Z. Liang, Y. Liu, X. Zhang, et al., Efficacy, safety, and immunogenicity of an enterovirus 71 vaccine in China, N. Engl. J. Med. 370 (2014) 818–828. [10] T. Chonmaitree, C. Ford, C. Sanders, H.L. Lucia, Comparison of cell cultures for rapid isolation of enteroviruses, J. Clin. Microbiol. 26 (1988) 2576–2580. [11] F. Xu, Q. Yan, H. Wang, J. Niu, L. Li, F. Zhu, et al., Performance of detecting IgM antibodies against enterovirus 71 for early diagnosis, PLoS One 5 (2010) e11388. [12] R.H. Yolken, V.M. Torsch, Enzyme-linked immunosorbent assay for detection and identification of coxsackieviruses A, Infect. Immun. 31 (1981) 742–750. [13] H.A. Rotbart, A. Ahmed, S. Hickey, R. Dagan, G.H. McCracken Jr., R.J. Whitley, et al., Diagnosis of enterovirus infection by polymerase chain reaction of multiple specimen types, Pediatr. Infect. Dis. J. 16 (1997) 409–411. [14] E. Terletskaia-Ladwig, S. Meier, R. Hahn, M. Leinmüller, F. Schneider, M. Enders, A convenient rapid culture assay for the detection of enteroviruses in clinical samples: comparison with conventional cell culture and RT-PCR, J. Med. Microbiol. 57 (2008) 1000–1006. [15] H. Harvala, E. Broberg, K. Benschop, N. Berginc, S. Ladhani, P. Susi, et al.,

6

Sensors & Actuators: B. Chemical 311 (2020) 127903

X. Yang, et al.

[16]

[17]

[18]

[19]

[20]

[21]

[22] [23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32] [33]

[34]

[35]

Recommendations for enterovirus diagnostics and characterisation within and beyond Europe, J. Clin. Virol. 101 (2018) 11–17. J. Puenpa, K. Suwannakarn, J. Chansaenroj, S. Vongpunsawad, Y. Poovorawan, Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease, J. Virol. Methods 248 (2017) 92–99. Z.O. Shoja, H. Tabatabai, M. Sarijloo, S. Shahmahmoodi, T.M. Azad, R. Nategh, Detection of enteroviruses by reverse-transcriptase polymerase chain reaction in cell culture negative stool specimens of patients with acute flaccid paralysis, J. Virol. Methods 142 (2007) 95–97. J.D. Fox, S. Han, A. Samuelson, Y. Zhang, M.L. Neale, D. Westmoreland, Development and evaluation of nucleic acid sequence based amplification (NASBA) for diagnosis of enterovirus infections using the NucliSens® Basic Kit, J. Clin. Virol. 24 (2002) 117–130. H. Yaqing, Z. Wenping, Y. Zhiyi, W. Xionghu, Y. Shouyi, Y. Hong, et al., Detection of human Enterovirus 71 reverse transcription loop-mediated isothermal amplification (RT-LAMP), Lett. Appl. Microbiol. 54 (2012) 233–239. T. Dai, X. Yang, T. Hu, B. Jiao, Y. Xu, X. Zheng, et al., Comparative evaluation of a novel recombinase polymerase amplification-lateral flow dipstick (RPA-LFD) assay, LAMP, conventional PCR, and leaf-disc baiting methods for detection of phytophthora sojae, Front. Microbiol. 10 (2019) 1884. L. Liu, J. Wang, R. Zhang, M. Lin, R. Shi, Q. Han, et al., Visual and equipment-free reverse transcription recombinase polymerase amplification method for rapid detection of foot-and-mouth disease virus, BMC Vet. Res. 14 (2018) 263. O. Piepenburg, C.H. Williams, D.L. Stemple, N.A. Armes, DNA detection using recombination proteins, PLoS Biol. 4 (2006) e204. B.A. Rohrman, R.R. Richards-Kortum, A paper and plastic device for performing recombinase polymerase amplification of HIV DNA, Lab Chip 12 (2012) 3082–3088. J. Chen, Y. Xu, H. Yan, Y. Zhu, L. Wang, Y. Zhang, et al., Sensitive and rapid detection of pathogenic bacteria from urine samples using multiplex recombinase polymerase amplification, Lab Chip 18 (2018) 2441–2452. S. Kersting, V. Rausch, F.F. Bier, M. von Nickisch-Rosenegk, Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis, Malar. J. 13 (2014) 99. R. Wang, F. Zhang, L. Wang, W. Qian, C. Qian, J. Wu, et al., Instant, visual, and instrument-free method for on-site screening of GTS 40-3-2 soybean based on bodyheat triggered recombinase polymerase amplification, Anal. Chem. 89 (2017) 4413–4418. T. Li, Y.M. Jalbani, G. Zhang, Z. Zhao, Z. Wang, Y. Zhao, et al., Rapid authentication of mutton products by recombinase polymerase amplification coupled with lateral flow dipsticks, Sens. Actuators B Chem. 290 (2019) 242–248. W.A. Nix, M.S. Oberste, M.A. Pallansch, Sensitive, seminested PCR amplification of VP1 sequences for direct identification of all enterovirus serotypes from original clinical specimens, J. Clin. Microbiol. 44 (2006) 2698–2704. M. Iturriza-Gómara, B. Megson, J. Gray, Molecular detection and characterization of human enteroviruses directly from clinical samples using RT-PCR and DNA sequencing, J. Med. Virol. 78 (2006) 243–253. S. Ge, Q. Yan, S. He, S. Zhuang, J. Niu, N. Xia, Specific primer amplification of the VP1 region directed by 5’ UTR sequence analysis: enterovirus testing and identification in clinical samples from hand-foot-and-mouth disease patients, J. Virol. Methods 193 (2013) 463–469. S. Hu, H. Zhong, W. Huang, W. Zhan, X. Yang, B. Tang, et al., Rapid and visual detection of Group B streptococcus using recombinase polymerase amplification combined with lateral flow strips, Diagn. Microbiol. Infect. Dis. 93 (2019) 9–13. C. Katevatis, A. Fan, C.M. Klapperich, Low concentration DNA extraction and recovery using a silica solid phase, PLoS One 12 (2017) e0176848. D. Jin, T.H. Heo, J.H. Byeon, G.H. Kim, M.K. Kim, S.H. Eun, et al., Analysis of clinical information and reverse transcriptase-polymerase chain reaction for early diagnosis of enteroviral meningitis, Korean J. Pediatr. 58 (2015) 446–450. B. Jiang, J. Zhang, X. You, C. Dong, X. Cheng, X. Dai, et al., Diagnosis of hand, foot, and mouth disease caused by EV71 and other enteroviruses by a one-step, single tube, duplex RT-PCR, J. Med. Virol. 84 (2012) 1803–1808. T.-C. Chen, G.-W. Chen, C.A. Hsiung, J.-Y. Yang, S.-R. Shih, Y.-K. Lai, et al., Combining multiplex reverse transcription-PCR and a diagnostic microarray to

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

detect and differentiate enterovirus 71 and coxsackievirus A16, J. Clin. Microbiol. 44 (2006) 2212–2219. Z.A. Crannell, B. Rohrman, R. Richards-Kortum, Equipment-free incubation of recombinase polymerase amplification reactions using body heat, PLoS One 9 (2014) e112146. A. Abd El, A. Wahed, M. El-Deeb, H. El-Tholoth, A. Kader, A. Ahmed, S. Hassan, et al., A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus, PLoS One 8 (2013) e71642. O. Faye, O. Faye, B. Soropogui, P. Patel, A.A. El Wahed, C. Loucoubar, et al., Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015, Euro Surveill. 20 (2015) 30053. K. Wang, Y. Wu, D. Yin, S. Tang, G. Hu, Y. He, Development and evaluation of a rapid recombinase polymerase amplification assay for detection of coxsackievirus A6, Arch. Virol. 162 (2017) 287–290. D. Yin, Y. Zhu, K. Wang, J. Wang, X. Zhang, M. Han, et al., Development and evaluation of a rapid recombinase polymerase amplification assay for the detection of human enterovirus 71, Arch. Virol. 163 (2018) 2459–2463. Y. Xi, C.Z. Xu, Z.Z. Xie, D.L. Zhu, J.M. Dong, Rapid and visual detection of dengue virus using recombinase polymerase amplification method combined with lateral flow dipstick, Mol. Cell. Probes 46 (2019) 101413. N. Sun, Y. Wang, X. Yao, F. Chen, D. Gao, W. Wang, et al., Visual signal generation for the detection of influenza viruses by duplex recombinase polymerase amplification with lateral flow dipsticks, Anal. Bioanal. Chem. 411 (2019) 3591–3602. S. Lutz, P. Weber, M. Focke, B. Faltin, J. Hoffmann, C. Muller, et al., Microfluidic lab-on-a-foil for nucleic acid analysis based on isothermal recombinase polymerase amplification (RPA), Lab Chip 10 (2010) 887–893. I.L.G. Law, J.F.C. Loo, H.C. Kwok, H.Y. Yeung, C.C.H. Leung, M. Hui, et al., Automated real-time detection of drug-resistant Mycobacterium tuberculosis on a lab-on-a-disc by Recombinase Polymerase Amplification, Anal. Biochem. 544 (2018) 98–107.

Xiaohan Yang is a researcher at Medical Genetic Centre, Guangdong Women and Children Hospital. His research interests include development and application of molecular detection technology and molecular epidemiology. Jia Xie is a graduate student at Guangzhou Medical University. Her research interests include RPA and molecular epidemiology. Siqi Hu is a graduate student at Guangzhou Medical University. Her research interests include fast testing technology and thalassemia. Wenli Zhan is a researcher at Medical Genetic Centre, Guangdong Women and Children Hospital. Her research focus is flow cytometry. Lei Duan is a graduate student at Guangzhou Medical University. His research focus is rotavirus. Keyi Chen is a researcher at Medical Genetic Centre, Guangdong Women and Children Hospital. His research interests include development and application of detection method in Down's screening. Changbin Zhang is a researcher at Medical Genetic Centre, Guangdong Women and Children Hospital. His research interests include development of new methods for detection of pathogenic microorganisms. Aihua Yin is a professor at Medical Genetic Centre, Guangdong Women and Children Hospital. Her research interests include prenatal diagnosis. Mingyong Luo is a doctor in Medical Genetic Centre, Guangdong Women and Children Hospital. His research interests include development and application of new molecular diagnosis technology, molecular epidemiology, and thalassemia.

7