- Email: [email protected]
Rapid detection and identification of Streptococcus macedonicus by species-specific PCR and DNA hybridisation
International Journal of Food Microbiology 81 (2003) 231 – 239 www.elsevier.com/locate/ijfoodmicro
Rapid detection and identification of Streptococcus macedonicus by species-specific PCR and DNA hybridisation Marina Papadelli, Eugenia Manolopoulou, George Kalantzopoulos, Effie Tsakalidou * Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Iera Odos 75, 118 55 Athens, Greece Accepted 12 June 2002
Abstract The aim of this study was to develop a simple and specific method for the rapid detection and identification of Streptococcus macedonicus. The method was based on polymerase chain reaction (PCR) using species-specific primers derived from the 16S rRNA gene. Specific identification was proven on seven S. macedonicus strains, while 16 strains belonging to different lactic acid bacteria species were tested negative. The PCR assay was capable of detecting 100 pg of S. macedonicus DNA, and it was also efficient on single colonies of the bacterium. Furthermore, the same bacterial strains were used for the specificity evaluation of a S. macedonicus species-specific probe. Neither species-specific PCR nor DNA hybridisation experiments could differentiate Streptococcus waius from S. macedonicus, due to the identity of the 16S rRNA gene of the two species, indicating high phylogenetical relatedness. This was further confirmed by the comparative sequence analysis of the 16S – 23S rRNA intergenic regions. It was thus clearly demonstrated that S. waius, recently described as a novel Streptococcus species, is phylogenetically identical to S. macedonicus. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Streptococcus macedonicus; Species-specific PCR; Probe
1. Introduction Lactic acid bacteria possess a large number of metabolic properties, which are responsible for their successful use as starters cultures in the food and feed industry, and as probiotics and dietary additives for nutritional and health purposes (Marteau and Rambaud, 1993; Stiles, 1996; Tannock, 1997). In order to design new starters for the production of fermented
*
Corresponding author. Tel.: +30-10-529-4676; fax: +30-10529-4672. E-mail address: [email protected] (E. Tsakalidou).
products of high and standardized quality, research on the selection and characterization of strains among all genera of lactic acid bacteria has been intensified over the last decades. Detecting and identifying various species of lactic acid bacteria with rapid methods is of major importance among others for quality control of dairy products, especially when mixed cultures are present, for monitoring fermentation processes, and in vivo identification of probiotic strains. Conventional identification methods based on physiological characteristics, as well as advanced phenotypic methods, such as cell wall composition analysis, whole-cell protein fingerprinting and fatty acid analysis, often require consid-
0168-1605/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 6 0 5 ( 0 2 ) 0 0 2 4 3 - X
232
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
erable time and skill, and the results are not always satisfactory, especially in cases of phylogenetically closely related species (Pot et al., 1994; Vandamme et al., 1996). In order to face this, research has recently focused on the application of molecular techniques for more rapid and reliable identification of these bacteria. Accumulation of data related to the sequences of the 16S rRNA, 23S rRNA, the 16S– 23S rRNA intergenic spacer regions or genes encoding enzymes has allowed identification of lactic acid bacteria using specific oligonucleotides as probes or in PCR assays (Ward et al., 1998; Flint et al., 1999; Deasy et al., 2000; Igarashi et al., 2001; Fortina et al., 2001; Chagnaud et al., 2001). During a survey of the lactic acid bacterial flora of naturally fermented Greek Kasseri cheese, several thermophilic streptococci strains were isolated, which were initially assigned to Streptococcus thermophilus. However, the SDS-PAGE analysis of whole-cell proteins revealed that the group was quite different from S. thermophilus. Indeed, the comparative 16S and 23S rRNA sequence analysis showed that these isolates represented a new species within the genus Streptococcus, which was named Streptococcus macedonicus (Tsakalidou et al., 1998). In the present work, we describe a 16S rRNAbased species-specific PCR technique for rapid identification and detection of S. macedonicus and its discrimination from other lactic acid bacteria. Additionally, the specificity of a probe targeted against the 16S rRNA of S. macedonicus is evaluated. Finally, we demonstrate that Streptococcus waius, recently described as a novel Streptococcus species isolated from pasteurized skimmed milk in New Zealand (Flint et al., 1999), is phylogenetically identical to S. macedonicus.
2. Materials and methods 2.1. Microorganisms and growth conditions Microorganisms used in this study are listed in Table 1. S. macedonicus ACA-DC 206T was grown at 37 jC either in M17 broth (Biokar Diagnostics, Beauvais, France) or in 10% (w/v) sterile skim milk, supplemented with 0.3% (w/v) yeast extract (Oxoid, Basingstoke, Hampshire, UK). Streptococcus, Enter-
ococcus, and Lactococcus strains were grown in M17 broth (Biokar Diagnostics) at 37 jC, while Lactobacillus strains were grown in MRS broth (Biokar Diagnostics) at 30 jC. 2.2. Primer design Primers used, their position on the target sequence and the respective source microorganisms are listed in Table 2. The S. macedonicus species-specific forward primer 16MAC was designed from its 16S rRNA gene (GenBank Z94012), and it was selected according to the variability observed between this gene sequence and the respective ones from other phylogenetically closely related streptococcal species like Streptococcus bovis (AF104114), S. thermophilus (X68418), Streptococcus salivarius (X58320), Streptococcus alactolyticus (AF201899), Streptococcus equinus (AB002514), Streptococcus infantarius (AF177729) and Streptococcus caprinus (Y10869). The BSF8/20 and BSR534/18 universal primers were obtained from the European Small Subunit Ribosomal RNA database (http://www.rrna.uia.ac.be/ssu), and correspond to the 8 –27 and 517– 534 bp of the 16S rRNA region of Escherichia coli (AE000542), respectively. The 16WAI reverse primer was designed according to the sequence of S. waius-specific probe described by Flint et al. (1999) and it was used in conjunction with the universal forward primer Y1 (Young et al., 1991). Finally, the 16INT and 23INT primers were designed according to the gene sequence of the S. macedonicus 16S rRNA (Z94012) and 23S rRNA (Z94013), respectively. All oligonucleotides used in this study were synthesized by MWG Biotech (Ebersberg, Germany). 2.3. PCR amplification Total DNA of lactic acid bacteria used as target in the PCR assays was isolated according to the method of Leenhouts et al. (1990). Amplification was also carried out by adding directly to the PCR reaction mixture 1 Al of log-phase milk culture, or 1 Al of its 10-fold serial dilutions in water, or a single colony of the target microorganism. Each 50-Al reaction mixture contained 1 PCR buffer [50 mM Tris – HCl, pH 9; 15 mM (NH4)2SO4; 0.1% (v/v) Triton X-100], 200 AM of each dATP, dCTP, dGTP and dTTP, 1.5 mM MgCl2, 0.2 AM of
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
233
Table 1 Lactic acid bacteria used in this study and results of S. macedonicus and S. waius species-specific PCR assays Species
Strain
S. macedonicus-specific PCR product (bp) (primers 16MAC/BSF534/18)
S. waius-specific PCR product (bp) (primers Y1/16WAI)
Lactobacillus bulgaricus Lactobacillus farciminis Lactobacillus fermentum Lactobacillus sakei spp. sakei Lactococcus lactis spp. lactis Streptococcus alactolyticus Streptococcus bovis Streptococcus equinus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus salivarius Streptococcus thermophilus Streptococcus uberis Streptococcus waius Enterococcus durans Enterococcus faecalis Enterococcus faecium Enterococcus gallinarum Enterococcus hirae
LMG 6901T LMG 9200T LMG 6902T LMG 9468T LMG 6890T LMG 14808T LMG 8518T LMG 14897T ACA-DC 206T ACA-DC 186 ACA-DC 191 ACA-DC 192 ACA-DC 193 ACA-DC 198 ACA-DC 211 LMG 11489T LMG 6896T LMG 9465T NZRCC 20100T LMG 10746T LMG 7937T LMG 11423T LMG 13129T LMG 6399T
1500 and 700 – 1500 – – – – – 350 350 350 350 350 350 350 – – – 350 – – 2000 2000 –
NT NT NT NT NT NT NT NT 190 190 190 190 190 190 190 NT NT NT 190 NT NT NT NT NT
ACA-DC, Culture Collection of the Laboratory of Dairy Research, Agricultural University of Athens, Greece; NZRCC, New Zealand Reference Culture Collection, New Zealand Dairy Research Institute, New Zealand; LMG, Culture Collection of the Laboratory of Microbiology Ghent, University of Ghent, Belgium; ( – ): no amplification product; NT: not tested; T: type strain.
each primer, 1 U of Dynazyme polymerase (Fynnzymes, Espoo, Finland) and 1– 2 Al of sample. The PCR cycling programmes used with the different sets of primers are listed in Table 3. PCR conditions were optimised on the basis of theoretical calculations of melting temperatures of the primer pairs used and on the results of several amplification experiments.
2.4. DNA hybridisations The species-specific oligonucleotide probe ACADC 206/81 (Table 2), corresponding to positions 74 – 91 within the S. macedonicus 16S rRNA gene (Tsakalidou et al., 1998), was 3V-end labelled with digoxigenin (MWG Biotech). This probe was used
Table 2 Description of the oligonucleotides used in this study Oligonucleotide
Source organism and gene
Position of 1st nucleotide
Sequence (5V!3V)
16MAC BSR534/18 BSF8/20 Y1 16WAI 16INT 23INT ACA-DC 206/81
S. macedonicus, 16S E. coli, 16S rRNA E. coli, 16S rRNA E. coli, 16S rRNA S. waius, 16S rRNA S. macedonicus, 16S S. macedonicus, 23S S. macedonicus, 16S
175 534 8 20 185 1487 46 91
TAGTGTTTAACACATGTTAGAGA ATTACCGCGGCTGCTGGC AGAGTTTGATCCTGGCTCAG TGGCTCAGAACGAACGCTGGCCCG GTCTCTAACATGTGTTAAACAC GGGTGAAGTCGTAACAAGGTAGCC GCTCTAGTGCCAAGGCATCCACC CTTCCAACTCTAGCAAGC-digoxigenin
rRNA
rRNA rRNA rRNA
234
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
Table 3 PCR cycling programmes applied with the four set of primers used in this study and sizes of the PCR products obtained Set of primers
Denaturation
Annealing
16MAC, BSR534/18 Y1, 16WAI BSF8/20, BSR534/18 16INT, 23INT
94 94 94 94
57 56 53 57
jC jC jC jC
30 30 30 30
s s s s
jC jC jC jC
30 30 30 30
s s s s
Polymerization
Size of PCR product (bp)
72 72 72 72
350 190 530 270
jC jC jC jC
30 s 40 s 1 min 30 s
In all cases, the reaction mixture was first denaturated at 94 jC for 2 min followed by the series of amplification repeated for 30 cycles.
for Southern hybridisation of the 16S rRNA region, which was in vitro amplified using the BSF8/20 and BSR534/18 universal primers; the same probe was also used for dot-blot hybridisation of total bacterial DNA. Southern hybridisations were carried out as previously described (Tsakalidou et al., 1998). For dot-blot hybridisations, approximately 0.5 –1 Ag of bacterial total DNA of each strain was spotted onto nylon membrane positively charged (Roche, Mannheim, Germany), according to the manufacturer’s instructions. 2.5. 16S – 23S rRNA intergenic region sequence determination and analysis The 16S –23S rRNA intergenic region was amplified from total DNA of S. macedonicus ACA-DC 206T using the 16INT and 23INT primers. Direct sequence analysis of the amplified product was performed by the MWG Biotech, using the ABI3700 system (Perkin Elmer Biosystems, Tucson, AZ, USA) with the standard sequencing protocols suggested by PE Biosystems. DNA homology searches were carried out with the NCBI databases, using the BLAST network service (Altschul et al., 1990).
3. Results and discussion 3.1. Species-specific PCR In order to specifically detect and identify S. macedonicus, a PCR assay was developed using the forward species-specific primer 16MAC in combination with the universal reverse primer BSR534/18. As mentioned before, the S. macedonicus-specific primer 16MAC was selected according to the variability observed between the 16S rRNA gene sequence of
S. macedonicus and the respective genes of other phylogenetically closely related streptococcal species. Surprisingly, when the nucleotide sequences of the S. macedonicus and S. waius 16S rRNA gene (Z94012 and AF088900, respectively) were aligned, only one nucleotide substitution and one additional nucleotide were detected in the sequence of S. waius, while the rest of the gene was 100% identical between the two species. Both differences were located at the 5V-end of the 16S rRNA gene (positions 7 and 9), which indicates that they could be sequence analyses misreads. This finding strongly indicated the high phylogenetical relatedness between these two Streptococcus species, which was further confirmed in this study. A total of 24 strains were considered for establishment of the species-specific PCR procedure (Table 1). These included strains belonging to lactic acid bacteria species, the majority are found in dairy products. PCR amplifications with 16MAC, BSR534/18 primers are shown in Table 1. A single product of about 350 bp, which was in good accordance with the theoretical size of the 16S rRNA fragment expected (360 bp), was obtained only when DNA from various strains of S. macedonicus and the type strain of S. waius was used as target for the PCR. No amplification was observed with the type strains of Streptococcus thermophilus, Streptococcus salivarius, Streptococcus bovis, Streptococcus equinus, Streptococcus uberis, Streptococcus alactolyticus, Enterococcus faecalis, Enterococcus durans, Enterococcus hirae, Lactococcus lactis spp. lactis, Lactobacillus sakei spp. sakei and Lactobacillus farciminis. PCR with total DNA from Enterococcus faecium, Enterococcus galinarum, Lactobacillus fermentum and Lactobacillus bulgaricus yielded one or more products, however of larger size (2000, 2000, 1500, 1500 and 700 bp, respectively), easily distinguishable from the one obtained with S. macedonicus and S. waius (Table 1).
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
To further test the specificity of the method, we evaluated the ability to detect S. macedonicus in mixtures of bacterial chromosomal DNAs. For this purpose, species-specific PCR assays were performed using DNA mixtures of different lactic acid bacterial species, in the presence or absence of total DNA from S. macedonicus ACA-DC 206T. Mixtures contained DNA either from six Streptococcus spp. strains, or five Enterococcus spp. strains, or four Lactobacillus spp. strains and one Lactococcus spp. strain (Fig. 1). When S. macedonicus DNA was present in the PCR mixture, the expected product of about 350 bp was the only fragment amplified, indicating that the presence of a large amount of DNA from other bacteria had no inhibitory effect on the PCR. Moreover, the unspecific PCR products obtained from E. faecium, E. galinarum, L. fermentum and L. bulgaricus (Table 1) were no more amplified when DNA from S. macedonicus was present in the PCR mixture. These results indicate that when a variety of DNAs of other species was mixed, the method could reliably detect only DNA from S. macedonicus. In the absence of S. macedonicus DNA, no amplification of the 350 bp product was observed, and only the unspecific
235
PCR products, wherever these were expected, were amplified (Fig. 1). The sensitivity of S. macedonicus-specific PCR was studied by evaluating its detection limit. PCR method was assessed with serially diluted DNA from S. macedonicus ACA-DC 206T. It was shown that the PCR assay detected as little as 100 pg of S. macedonicus DNA (Fig. 2). However, this detection limit was higher comparatively to those determined for the PCR detection of S. salivarius, Streptococcus mutans and Streptococcus sobrinus (Igarashi et al., 1996, 2000, 2001). The PCR assay performed with cellular suspension of a single colony of each of the seven S. macedonicus strains, as well as the S. waius type strain, yielded a strong amplification product of the expected size of 350 bp (Fig. 3). Direct PCR on colonies can be advantageous in terms of time and labour costs comparatively to physiological and biochemical identification of bacteria. Similar results have been previously reported by Zapparoli and Torriani (1997) and Fortina et al. (2001). Finally, direct PCR detection of S. macedonicus in milk was also investigated. Results of the PCR assay with 16MAC-BSR534/18 primers using 1 Al of 10-
Fig. 1. Species-specific PCR assays with DNA mixtures from different lactic acid bacteria. Lane 1: S. macedonicus; lanes 2 and 3: S. thermophilus, S. salivarius, S. bovis, S. equinus, S. uberis, S. alactolyticus; lanes 4 and 5: E. faecalis, E. faecium, E. durans, E. hirae, E. gallinarum; lanes 6 and 7: L. lactis spp. lactis, L. sakei spp. sakei, L. farciminis, L. fermentum, L. bulgaricus. In the case of lanes 2, 4 and 6, DNA from S. macedonicus ACA-DC 206T was also present in the PCR mixture. Strain numbers are listed in Table 1. Lane M, DNA molecular weights marker 50 bp.
236
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
faecium or E. gallinarum milk cultures containing about 104 cells per reaction tube. This PCR detection limit was higher than that estimated for Lactobacillus helveticus grown in skim milk, which varied from 1 to 10 cells per reaction tube (Fortina et al., 2001). It should be stressed here that S. macedonicus species-specific PCR experiments could not differentiate S. waius from S. macedonicus (Table 1). Moreover, when the S. waius species-specific primer pair 16WAI/Y1, previously designed according to its 16S rRNA gene (Flint et al., 1999), was used in PCR assays with total DNA from each of the seven S. macedonicus strains and the type strain of S. waius, in all cases, the same product of about 190 bp was amplified (Table 1). Fig. 2. Sensitivity of species-specific PCR with genomic DNA purified from S. macedonicus ACA-DC 206T. Amount of the target genomic DNA in the reaction mixture. Lane 1: 100 ng; lane 2: 10 ng; lane 3: 1 ng; lane 4: 100 pg; lane 5: 10 pg; lane 6: 1 pg; lane M: DNA molecular weights marker 50 bp.
fold serial dilutions of S. macedonicus ACA-DC 206T log-phase milk culture are shown in Fig. 4. The PCR assay successfully enabled us to detect as low as 103 cells of S. macedonicus per reaction tube, while no amplification was observed with L. fermentum or E.
3.2. Species-specific DNA hybridisation Two species-specific probes for S. macedonicus were previously designed for 16S and 23S rRNA gene targets (Tsakalidou et al., 1998). In particular, ACADC206/81 probe targeted against the 74– 93 bp region of the 16S rRNA gene (Z94012) and ACA-DC206/ 274 targeted against the 298– 315 bp region of the 23S rRNA gene (Z94013) of S. macedonicus ACADC 206T. The specificity of these probes was pre-
Fig. 3. S. macedonicus species-specific PCR directly on single colonies of each of the seven S. macedonicus strains studied, as well as the S. waius type strain. S. macedonicus strain numbers. Lane 1: ACA-DC 206T; lane 2: ACA-DC 186; lane 3: ACA-DC 191; lane 4: ACA-DC 192; lane 5: ACA-DC193; lane 6: ACA-DC 198; lane 7: S. waius type strain NZRCC 20100T; lane M: DNA molecular weights marker 50 bp.
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
237
Fig. 4. S. macedonicus species-specific PCR in skim milk and subsequent 10-fold serial dilutions. S. macedonicus ACA-DC 206T cells per reaction tube. Lane 1: 104; lane 2: 103; lane 3: 102; lane 4: E. faecium LMG 11423T, 104 cells; lane 5: E. gallinarum LMG 13129T, 104 cells; lane 6: L. fermentum LMG 6902T, 104 cells; lane 7: sterile skim milk; lane M: DNA molecular weights marker 50 bp.
viously evaluated against only four species, namely S. bovis, S. equinus, S. salivarius and L. lactis (Tsakalidou et al., 1998). In the present study, the specificity of the ACA-DC206/81-specific probe was further evaluated using the 24 strains listed in Table 1, against
the in vitro amplified partial 16S rRNA gene. More specifically, the BSF8/20– BSR534/18 universal primer pair was used in a PCR assay with total bacterial DNA as target and amplified a region of about 530 bp of the 16S rRNA gene (Fig. 5A). Southern hybrid-
Fig. 5. Southern hybridisation with the S. macedonicus species-specific probe ACA-DC 206/81. (A) PCR assays with BSF8/20, BSR534/18 primers using total DNA from different microbial strains. Lane 1: S. bovis; lane 2: S. equinus; lane 3: S. salivarius; lane 4: S. thermophilus; lane 5: S. uberis; lane 6: S. alactolyticus; lane 7: E. faecalis; lane 8: E. faecium; lane 9: E. hirae; lane 10: E. gallinarum; lane 11: E. durans; lane 12: L. fermentum; lane 13: L. farciminis; lane 14: S. waius; lane 15: L. sakei spp. sakei; lane 16: L. bulgaricus; lane 17: L. lactis spp. lactis; lanes 18 – 24: S. macedonicus strains listed in Table 1; lanes M: DNA molecular weights marker 50 bp. (B) Southern hybridisation of agarose gels A with the ACA-DC 206/81 probe.
238
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
isation of these PCR products using the ACA-DC206/ 81-specific oligonucleotide probe gave positive result only in the case of the seven S. macedonicus strains and S. waius type strain, while no hybridisation signal was obtained with the PCR products amplified from total DNA of the rest strains (Fig. 5B). Moreover, when this probe was used in dot-blot hybridisations with total bacterial DNA, the same specificity was observed (data not shown). 3.3. 16S – 23S rRNA intergenic region As already shown, neither S. macedonicus nor S. waius species-specific PCR nor DNA hybridisation experiments could differentiate these two species. This was expected from the identity between the two 16S rRNA genes (Z94012 and AF088900, respectively). The identity of the two species was further confirmed by the comparison of the 16S – 23S rRNA spacer region. The 16S –23S rRNA spacer region of S. macedonicus ACA-DC 206T was amplified using the 16INT and 23INT set of primers (Table 2). A fragment of the expected size (about 270 bp) was obtained and sequenced. This new sequence data appears in the GenBank Nucleotide Sequence Database under accession number AY078992. BLAST analysis of this nucleotide sequence revealed 100% identity with the respective intergenic region from S. waius (AF088899), while lower homology (91 – 94%) was revealed with the intergenic region from Streptococcus agalactiae (AF291417), Streptococcus difficile (AF064441) and S. salivarius (AB051016). S. waius was recently isolated from pasteurized skimmed milk in New Zealand and described as a novel Streptococcus species based on phenotypic observations, restriction endonuclease analysis, ribotyping, random amplified polymorphic DNA analysis, DNA – DNA hybridisation, G + C contents and comparison of the sequences of the 16S rRNA gene, and the 16S – 23S intergenic spacer region (Flint et al., 1999). However, the authors did not include S. macedonicus in the phylogenetic analyses. Based on the overall results of the present study, it is clearly demonstrated that the two Streptococcus species are phylogenetically identical. In conclusion, the species-specific primer pair designed and the PCR conditions developed in this study allowed the clear-cut discrimination of S. mace-
donicus from most lactic acid bacteria species usually occurring in dairy products. The presence of competing DNA did not affect the efficiency of the method, while its detection limit was rather low. Furthermore, the assay developed was successfully applied to whole cells from a single colony and in the real food matrix (milk). Therefore, this specific and rapid PCR-based technique is an attractive alternative to the conventional methods of identification. Furthermore, the successful evaluation of the S. macedonicus-specific probe allows the application of DNA hybridisation as an additional identification tool. Finally, this study clearly demonstrates that S. waius, recently described as a novel Streptococcus species, is phylogenetically identical to S. macedonicus.
References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. Journal of Molecular Biology 215, 403 – 410. Chagnaud, P., Machinis, K., Coutte, L.A., Marecat, A., Mercenier, A., 2001. Rapid PCR-based procedure to identify lactic acid bacteria: application to six common Lactobacillus species. Journal of Food Microbiology 44, 139 – 148. Deasy, B.M., Rea, M.C., Fitzgerald, G.F., Cogan, T.M., Beresford, T.P., 2000. A rapid PCR method to distinguish between Lactococcus and Enterococcus. Systematic and Applied Microbiology 23, 510 – 522. Flint, S.H., Lawrence, J.H., Brooks, J.D., 1999. Streptococcus waius sp. nov.: a thermophilic streptococcus from a biofilm. International Journal of Systematic Bacteriology 49, 759 – 767. Fortina, M.G., Ricci, G., Mora, D., Parini, C., Manachini, P.L., 2001. Specific identification of Lactobacillus helveticus by PCR with pepC, pepN and htrA targeted primers. FEMS Microbiology Letters 198, 85 – 89. Igarashi, T., Yamamoto, A., Goto, N., 1996. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction. Oral Microbiology and Immunology 11, 294 – 298. Igarashi, T., Yamamoto, A., Goto, N., 2000. Polymerase chain reaction for detection and identification of Streptococcus sobrinus. Journal of Medical Microbiology 49, 1069 – 1074. Igarashi, T., Yano, Y., Yamamoto, A., Sasa, R., Goto, N., 2001. Identification of Streptococcus salivarius by PCR and DNA probe. Letters in Applied Microbiology 32, 394 – 397. Leenhouts, K.J., Kok, J., Venema, G., 1990. Stability of integrated plasmids in the chromosome of Lactobacillus lactis. Applied and Environmental Microbiology 56, 2726 – 2735. Marteau, P., Rambaud, J.-C., 1993. Potential of using lactic acid bacteria for therapy and immunomodulation in man. FEMS Microbiology Reviews 12, 207 – 220. Pot, B., Ludwig, W., Kersters, K., Schleifer, K.-H., 1994. Taxonomy
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239 of lactic acid bacteria. In: De Vuyst, L., Vandamme, E.J. (Eds.), Bacteriocins of Lactic Acid Bacteria. Blackie Academic & Professional, Glasgow, pp. 13 – 90. Stiles, M.E., 1996. Biopreservation by lactic acid bacteria. Antonie Leeuwenhoek 70, 331 – 345. Tannock, G.W., 1997. Probiotic properties of lactic-acid bacteria: plenty of scope for fundamental R&D. Trends in Biotechnology 15, 270 – 274. Tsakalidou, E., Zoidou, E., Pot, B., Wassil, L., Ludwig, W., Devriese, L.A., Kalantzopoulos, G., Schleifer, K.H., Kersters, K., 1998. Identification of streptococci from Greek Kasseri cheese and description of Streptococcus macedonicus sp. nov. International Journal of Systematic Bacteriology 48, 519 – 527. Vandamme, P., Pot, B., Gillis, M., De Vos, P., Kersters, K., Swings,
239
J., 1996. Polyphasic taxonomy: a consensus approach to bacterial systematics. Microbiological Reviews 60, 407 – 438. Ward, L.J., Brown, J.C., Davey, G.P., 1998. Two methods for the genetic differentiation of Lactococcus lactis ssp. lactis and cremoris based on differences in the 16S rRNA gene sequence. FEMS Microbiology Letters 166, 15 – 20. Young, J.P.W., Downer, H.J., Eardly, B.D., 1991. Phylogeny of the prototrophic Rhizobium strain BTAi1 by polymerase chain reaction-based sequencing of a 16S rRNA gene segment. Journal of Bacteriology 143, 2271 – 2277. Zapparoli, G., Torriani, S., 1997. Rapid identification and detection of Lactobacillus sanfrancisco in sourdough by species-specific PCR with 16S rRNA-targeted primers. Systematic and Applied Microbiology 20, 640 – 644.
Rapid detection and identification of Streptococcus macedonicus by species-specific PCR and DNA hybridisation Marina Papadelli, Eugenia Manolopoulou, George Kalantzopoulos, Effie Tsakalidou * Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Iera Odos 75, 118 55 Athens, Greece Accepted 12 June 2002
Abstract The aim of this study was to develop a simple and specific method for the rapid detection and identification of Streptococcus macedonicus. The method was based on polymerase chain reaction (PCR) using species-specific primers derived from the 16S rRNA gene. Specific identification was proven on seven S. macedonicus strains, while 16 strains belonging to different lactic acid bacteria species were tested negative. The PCR assay was capable of detecting 100 pg of S. macedonicus DNA, and it was also efficient on single colonies of the bacterium. Furthermore, the same bacterial strains were used for the specificity evaluation of a S. macedonicus species-specific probe. Neither species-specific PCR nor DNA hybridisation experiments could differentiate Streptococcus waius from S. macedonicus, due to the identity of the 16S rRNA gene of the two species, indicating high phylogenetical relatedness. This was further confirmed by the comparative sequence analysis of the 16S – 23S rRNA intergenic regions. It was thus clearly demonstrated that S. waius, recently described as a novel Streptococcus species, is phylogenetically identical to S. macedonicus. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Streptococcus macedonicus; Species-specific PCR; Probe
1. Introduction Lactic acid bacteria possess a large number of metabolic properties, which are responsible for their successful use as starters cultures in the food and feed industry, and as probiotics and dietary additives for nutritional and health purposes (Marteau and Rambaud, 1993; Stiles, 1996; Tannock, 1997). In order to design new starters for the production of fermented
*
Corresponding author. Tel.: +30-10-529-4676; fax: +30-10529-4672. E-mail address: [email protected] (E. Tsakalidou).
products of high and standardized quality, research on the selection and characterization of strains among all genera of lactic acid bacteria has been intensified over the last decades. Detecting and identifying various species of lactic acid bacteria with rapid methods is of major importance among others for quality control of dairy products, especially when mixed cultures are present, for monitoring fermentation processes, and in vivo identification of probiotic strains. Conventional identification methods based on physiological characteristics, as well as advanced phenotypic methods, such as cell wall composition analysis, whole-cell protein fingerprinting and fatty acid analysis, often require consid-
0168-1605/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 6 0 5 ( 0 2 ) 0 0 2 4 3 - X
232
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
erable time and skill, and the results are not always satisfactory, especially in cases of phylogenetically closely related species (Pot et al., 1994; Vandamme et al., 1996). In order to face this, research has recently focused on the application of molecular techniques for more rapid and reliable identification of these bacteria. Accumulation of data related to the sequences of the 16S rRNA, 23S rRNA, the 16S– 23S rRNA intergenic spacer regions or genes encoding enzymes has allowed identification of lactic acid bacteria using specific oligonucleotides as probes or in PCR assays (Ward et al., 1998; Flint et al., 1999; Deasy et al., 2000; Igarashi et al., 2001; Fortina et al., 2001; Chagnaud et al., 2001). During a survey of the lactic acid bacterial flora of naturally fermented Greek Kasseri cheese, several thermophilic streptococci strains were isolated, which were initially assigned to Streptococcus thermophilus. However, the SDS-PAGE analysis of whole-cell proteins revealed that the group was quite different from S. thermophilus. Indeed, the comparative 16S and 23S rRNA sequence analysis showed that these isolates represented a new species within the genus Streptococcus, which was named Streptococcus macedonicus (Tsakalidou et al., 1998). In the present work, we describe a 16S rRNAbased species-specific PCR technique for rapid identification and detection of S. macedonicus and its discrimination from other lactic acid bacteria. Additionally, the specificity of a probe targeted against the 16S rRNA of S. macedonicus is evaluated. Finally, we demonstrate that Streptococcus waius, recently described as a novel Streptococcus species isolated from pasteurized skimmed milk in New Zealand (Flint et al., 1999), is phylogenetically identical to S. macedonicus.
2. Materials and methods 2.1. Microorganisms and growth conditions Microorganisms used in this study are listed in Table 1. S. macedonicus ACA-DC 206T was grown at 37 jC either in M17 broth (Biokar Diagnostics, Beauvais, France) or in 10% (w/v) sterile skim milk, supplemented with 0.3% (w/v) yeast extract (Oxoid, Basingstoke, Hampshire, UK). Streptococcus, Enter-
ococcus, and Lactococcus strains were grown in M17 broth (Biokar Diagnostics) at 37 jC, while Lactobacillus strains were grown in MRS broth (Biokar Diagnostics) at 30 jC. 2.2. Primer design Primers used, their position on the target sequence and the respective source microorganisms are listed in Table 2. The S. macedonicus species-specific forward primer 16MAC was designed from its 16S rRNA gene (GenBank Z94012), and it was selected according to the variability observed between this gene sequence and the respective ones from other phylogenetically closely related streptococcal species like Streptococcus bovis (AF104114), S. thermophilus (X68418), Streptococcus salivarius (X58320), Streptococcus alactolyticus (AF201899), Streptococcus equinus (AB002514), Streptococcus infantarius (AF177729) and Streptococcus caprinus (Y10869). The BSF8/20 and BSR534/18 universal primers were obtained from the European Small Subunit Ribosomal RNA database (http://www.rrna.uia.ac.be/ssu), and correspond to the 8 –27 and 517– 534 bp of the 16S rRNA region of Escherichia coli (AE000542), respectively. The 16WAI reverse primer was designed according to the sequence of S. waius-specific probe described by Flint et al. (1999) and it was used in conjunction with the universal forward primer Y1 (Young et al., 1991). Finally, the 16INT and 23INT primers were designed according to the gene sequence of the S. macedonicus 16S rRNA (Z94012) and 23S rRNA (Z94013), respectively. All oligonucleotides used in this study were synthesized by MWG Biotech (Ebersberg, Germany). 2.3. PCR amplification Total DNA of lactic acid bacteria used as target in the PCR assays was isolated according to the method of Leenhouts et al. (1990). Amplification was also carried out by adding directly to the PCR reaction mixture 1 Al of log-phase milk culture, or 1 Al of its 10-fold serial dilutions in water, or a single colony of the target microorganism. Each 50-Al reaction mixture contained 1 PCR buffer [50 mM Tris – HCl, pH 9; 15 mM (NH4)2SO4; 0.1% (v/v) Triton X-100], 200 AM of each dATP, dCTP, dGTP and dTTP, 1.5 mM MgCl2, 0.2 AM of
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
233
Table 1 Lactic acid bacteria used in this study and results of S. macedonicus and S. waius species-specific PCR assays Species
Strain
S. macedonicus-specific PCR product (bp) (primers 16MAC/BSF534/18)
S. waius-specific PCR product (bp) (primers Y1/16WAI)
Lactobacillus bulgaricus Lactobacillus farciminis Lactobacillus fermentum Lactobacillus sakei spp. sakei Lactococcus lactis spp. lactis Streptococcus alactolyticus Streptococcus bovis Streptococcus equinus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus macedonicus Streptococcus salivarius Streptococcus thermophilus Streptococcus uberis Streptococcus waius Enterococcus durans Enterococcus faecalis Enterococcus faecium Enterococcus gallinarum Enterococcus hirae
LMG 6901T LMG 9200T LMG 6902T LMG 9468T LMG 6890T LMG 14808T LMG 8518T LMG 14897T ACA-DC 206T ACA-DC 186 ACA-DC 191 ACA-DC 192 ACA-DC 193 ACA-DC 198 ACA-DC 211 LMG 11489T LMG 6896T LMG 9465T NZRCC 20100T LMG 10746T LMG 7937T LMG 11423T LMG 13129T LMG 6399T
1500 and 700 – 1500 – – – – – 350 350 350 350 350 350 350 – – – 350 – – 2000 2000 –
NT NT NT NT NT NT NT NT 190 190 190 190 190 190 190 NT NT NT 190 NT NT NT NT NT
ACA-DC, Culture Collection of the Laboratory of Dairy Research, Agricultural University of Athens, Greece; NZRCC, New Zealand Reference Culture Collection, New Zealand Dairy Research Institute, New Zealand; LMG, Culture Collection of the Laboratory of Microbiology Ghent, University of Ghent, Belgium; ( – ): no amplification product; NT: not tested; T: type strain.
each primer, 1 U of Dynazyme polymerase (Fynnzymes, Espoo, Finland) and 1– 2 Al of sample. The PCR cycling programmes used with the different sets of primers are listed in Table 3. PCR conditions were optimised on the basis of theoretical calculations of melting temperatures of the primer pairs used and on the results of several amplification experiments.
2.4. DNA hybridisations The species-specific oligonucleotide probe ACADC 206/81 (Table 2), corresponding to positions 74 – 91 within the S. macedonicus 16S rRNA gene (Tsakalidou et al., 1998), was 3V-end labelled with digoxigenin (MWG Biotech). This probe was used
Table 2 Description of the oligonucleotides used in this study Oligonucleotide
Source organism and gene
Position of 1st nucleotide
Sequence (5V!3V)
16MAC BSR534/18 BSF8/20 Y1 16WAI 16INT 23INT ACA-DC 206/81
S. macedonicus, 16S E. coli, 16S rRNA E. coli, 16S rRNA E. coli, 16S rRNA S. waius, 16S rRNA S. macedonicus, 16S S. macedonicus, 23S S. macedonicus, 16S
175 534 8 20 185 1487 46 91
TAGTGTTTAACACATGTTAGAGA ATTACCGCGGCTGCTGGC AGAGTTTGATCCTGGCTCAG TGGCTCAGAACGAACGCTGGCCCG GTCTCTAACATGTGTTAAACAC GGGTGAAGTCGTAACAAGGTAGCC GCTCTAGTGCCAAGGCATCCACC CTTCCAACTCTAGCAAGC-digoxigenin
rRNA
rRNA rRNA rRNA
234
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
Table 3 PCR cycling programmes applied with the four set of primers used in this study and sizes of the PCR products obtained Set of primers
Denaturation
Annealing
16MAC, BSR534/18 Y1, 16WAI BSF8/20, BSR534/18 16INT, 23INT
94 94 94 94
57 56 53 57
jC jC jC jC
30 30 30 30
s s s s
jC jC jC jC
30 30 30 30
s s s s
Polymerization
Size of PCR product (bp)
72 72 72 72
350 190 530 270
jC jC jC jC
30 s 40 s 1 min 30 s
In all cases, the reaction mixture was first denaturated at 94 jC for 2 min followed by the series of amplification repeated for 30 cycles.
for Southern hybridisation of the 16S rRNA region, which was in vitro amplified using the BSF8/20 and BSR534/18 universal primers; the same probe was also used for dot-blot hybridisation of total bacterial DNA. Southern hybridisations were carried out as previously described (Tsakalidou et al., 1998). For dot-blot hybridisations, approximately 0.5 –1 Ag of bacterial total DNA of each strain was spotted onto nylon membrane positively charged (Roche, Mannheim, Germany), according to the manufacturer’s instructions. 2.5. 16S – 23S rRNA intergenic region sequence determination and analysis The 16S –23S rRNA intergenic region was amplified from total DNA of S. macedonicus ACA-DC 206T using the 16INT and 23INT primers. Direct sequence analysis of the amplified product was performed by the MWG Biotech, using the ABI3700 system (Perkin Elmer Biosystems, Tucson, AZ, USA) with the standard sequencing protocols suggested by PE Biosystems. DNA homology searches were carried out with the NCBI databases, using the BLAST network service (Altschul et al., 1990).
3. Results and discussion 3.1. Species-specific PCR In order to specifically detect and identify S. macedonicus, a PCR assay was developed using the forward species-specific primer 16MAC in combination with the universal reverse primer BSR534/18. As mentioned before, the S. macedonicus-specific primer 16MAC was selected according to the variability observed between the 16S rRNA gene sequence of
S. macedonicus and the respective genes of other phylogenetically closely related streptococcal species. Surprisingly, when the nucleotide sequences of the S. macedonicus and S. waius 16S rRNA gene (Z94012 and AF088900, respectively) were aligned, only one nucleotide substitution and one additional nucleotide were detected in the sequence of S. waius, while the rest of the gene was 100% identical between the two species. Both differences were located at the 5V-end of the 16S rRNA gene (positions 7 and 9), which indicates that they could be sequence analyses misreads. This finding strongly indicated the high phylogenetical relatedness between these two Streptococcus species, which was further confirmed in this study. A total of 24 strains were considered for establishment of the species-specific PCR procedure (Table 1). These included strains belonging to lactic acid bacteria species, the majority are found in dairy products. PCR amplifications with 16MAC, BSR534/18 primers are shown in Table 1. A single product of about 350 bp, which was in good accordance with the theoretical size of the 16S rRNA fragment expected (360 bp), was obtained only when DNA from various strains of S. macedonicus and the type strain of S. waius was used as target for the PCR. No amplification was observed with the type strains of Streptococcus thermophilus, Streptococcus salivarius, Streptococcus bovis, Streptococcus equinus, Streptococcus uberis, Streptococcus alactolyticus, Enterococcus faecalis, Enterococcus durans, Enterococcus hirae, Lactococcus lactis spp. lactis, Lactobacillus sakei spp. sakei and Lactobacillus farciminis. PCR with total DNA from Enterococcus faecium, Enterococcus galinarum, Lactobacillus fermentum and Lactobacillus bulgaricus yielded one or more products, however of larger size (2000, 2000, 1500, 1500 and 700 bp, respectively), easily distinguishable from the one obtained with S. macedonicus and S. waius (Table 1).
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
To further test the specificity of the method, we evaluated the ability to detect S. macedonicus in mixtures of bacterial chromosomal DNAs. For this purpose, species-specific PCR assays were performed using DNA mixtures of different lactic acid bacterial species, in the presence or absence of total DNA from S. macedonicus ACA-DC 206T. Mixtures contained DNA either from six Streptococcus spp. strains, or five Enterococcus spp. strains, or four Lactobacillus spp. strains and one Lactococcus spp. strain (Fig. 1). When S. macedonicus DNA was present in the PCR mixture, the expected product of about 350 bp was the only fragment amplified, indicating that the presence of a large amount of DNA from other bacteria had no inhibitory effect on the PCR. Moreover, the unspecific PCR products obtained from E. faecium, E. galinarum, L. fermentum and L. bulgaricus (Table 1) were no more amplified when DNA from S. macedonicus was present in the PCR mixture. These results indicate that when a variety of DNAs of other species was mixed, the method could reliably detect only DNA from S. macedonicus. In the absence of S. macedonicus DNA, no amplification of the 350 bp product was observed, and only the unspecific
235
PCR products, wherever these were expected, were amplified (Fig. 1). The sensitivity of S. macedonicus-specific PCR was studied by evaluating its detection limit. PCR method was assessed with serially diluted DNA from S. macedonicus ACA-DC 206T. It was shown that the PCR assay detected as little as 100 pg of S. macedonicus DNA (Fig. 2). However, this detection limit was higher comparatively to those determined for the PCR detection of S. salivarius, Streptococcus mutans and Streptococcus sobrinus (Igarashi et al., 1996, 2000, 2001). The PCR assay performed with cellular suspension of a single colony of each of the seven S. macedonicus strains, as well as the S. waius type strain, yielded a strong amplification product of the expected size of 350 bp (Fig. 3). Direct PCR on colonies can be advantageous in terms of time and labour costs comparatively to physiological and biochemical identification of bacteria. Similar results have been previously reported by Zapparoli and Torriani (1997) and Fortina et al. (2001). Finally, direct PCR detection of S. macedonicus in milk was also investigated. Results of the PCR assay with 16MAC-BSR534/18 primers using 1 Al of 10-
Fig. 1. Species-specific PCR assays with DNA mixtures from different lactic acid bacteria. Lane 1: S. macedonicus; lanes 2 and 3: S. thermophilus, S. salivarius, S. bovis, S. equinus, S. uberis, S. alactolyticus; lanes 4 and 5: E. faecalis, E. faecium, E. durans, E. hirae, E. gallinarum; lanes 6 and 7: L. lactis spp. lactis, L. sakei spp. sakei, L. farciminis, L. fermentum, L. bulgaricus. In the case of lanes 2, 4 and 6, DNA from S. macedonicus ACA-DC 206T was also present in the PCR mixture. Strain numbers are listed in Table 1. Lane M, DNA molecular weights marker 50 bp.
236
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
faecium or E. gallinarum milk cultures containing about 104 cells per reaction tube. This PCR detection limit was higher than that estimated for Lactobacillus helveticus grown in skim milk, which varied from 1 to 10 cells per reaction tube (Fortina et al., 2001). It should be stressed here that S. macedonicus species-specific PCR experiments could not differentiate S. waius from S. macedonicus (Table 1). Moreover, when the S. waius species-specific primer pair 16WAI/Y1, previously designed according to its 16S rRNA gene (Flint et al., 1999), was used in PCR assays with total DNA from each of the seven S. macedonicus strains and the type strain of S. waius, in all cases, the same product of about 190 bp was amplified (Table 1). Fig. 2. Sensitivity of species-specific PCR with genomic DNA purified from S. macedonicus ACA-DC 206T. Amount of the target genomic DNA in the reaction mixture. Lane 1: 100 ng; lane 2: 10 ng; lane 3: 1 ng; lane 4: 100 pg; lane 5: 10 pg; lane 6: 1 pg; lane M: DNA molecular weights marker 50 bp.
fold serial dilutions of S. macedonicus ACA-DC 206T log-phase milk culture are shown in Fig. 4. The PCR assay successfully enabled us to detect as low as 103 cells of S. macedonicus per reaction tube, while no amplification was observed with L. fermentum or E.
3.2. Species-specific DNA hybridisation Two species-specific probes for S. macedonicus were previously designed for 16S and 23S rRNA gene targets (Tsakalidou et al., 1998). In particular, ACADC206/81 probe targeted against the 74– 93 bp region of the 16S rRNA gene (Z94012) and ACA-DC206/ 274 targeted against the 298– 315 bp region of the 23S rRNA gene (Z94013) of S. macedonicus ACADC 206T. The specificity of these probes was pre-
Fig. 3. S. macedonicus species-specific PCR directly on single colonies of each of the seven S. macedonicus strains studied, as well as the S. waius type strain. S. macedonicus strain numbers. Lane 1: ACA-DC 206T; lane 2: ACA-DC 186; lane 3: ACA-DC 191; lane 4: ACA-DC 192; lane 5: ACA-DC193; lane 6: ACA-DC 198; lane 7: S. waius type strain NZRCC 20100T; lane M: DNA molecular weights marker 50 bp.
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
237
Fig. 4. S. macedonicus species-specific PCR in skim milk and subsequent 10-fold serial dilutions. S. macedonicus ACA-DC 206T cells per reaction tube. Lane 1: 104; lane 2: 103; lane 3: 102; lane 4: E. faecium LMG 11423T, 104 cells; lane 5: E. gallinarum LMG 13129T, 104 cells; lane 6: L. fermentum LMG 6902T, 104 cells; lane 7: sterile skim milk; lane M: DNA molecular weights marker 50 bp.
viously evaluated against only four species, namely S. bovis, S. equinus, S. salivarius and L. lactis (Tsakalidou et al., 1998). In the present study, the specificity of the ACA-DC206/81-specific probe was further evaluated using the 24 strains listed in Table 1, against
the in vitro amplified partial 16S rRNA gene. More specifically, the BSF8/20– BSR534/18 universal primer pair was used in a PCR assay with total bacterial DNA as target and amplified a region of about 530 bp of the 16S rRNA gene (Fig. 5A). Southern hybrid-
Fig. 5. Southern hybridisation with the S. macedonicus species-specific probe ACA-DC 206/81. (A) PCR assays with BSF8/20, BSR534/18 primers using total DNA from different microbial strains. Lane 1: S. bovis; lane 2: S. equinus; lane 3: S. salivarius; lane 4: S. thermophilus; lane 5: S. uberis; lane 6: S. alactolyticus; lane 7: E. faecalis; lane 8: E. faecium; lane 9: E. hirae; lane 10: E. gallinarum; lane 11: E. durans; lane 12: L. fermentum; lane 13: L. farciminis; lane 14: S. waius; lane 15: L. sakei spp. sakei; lane 16: L. bulgaricus; lane 17: L. lactis spp. lactis; lanes 18 – 24: S. macedonicus strains listed in Table 1; lanes M: DNA molecular weights marker 50 bp. (B) Southern hybridisation of agarose gels A with the ACA-DC 206/81 probe.
238
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239
isation of these PCR products using the ACA-DC206/ 81-specific oligonucleotide probe gave positive result only in the case of the seven S. macedonicus strains and S. waius type strain, while no hybridisation signal was obtained with the PCR products amplified from total DNA of the rest strains (Fig. 5B). Moreover, when this probe was used in dot-blot hybridisations with total bacterial DNA, the same specificity was observed (data not shown). 3.3. 16S – 23S rRNA intergenic region As already shown, neither S. macedonicus nor S. waius species-specific PCR nor DNA hybridisation experiments could differentiate these two species. This was expected from the identity between the two 16S rRNA genes (Z94012 and AF088900, respectively). The identity of the two species was further confirmed by the comparison of the 16S – 23S rRNA spacer region. The 16S –23S rRNA spacer region of S. macedonicus ACA-DC 206T was amplified using the 16INT and 23INT set of primers (Table 2). A fragment of the expected size (about 270 bp) was obtained and sequenced. This new sequence data appears in the GenBank Nucleotide Sequence Database under accession number AY078992. BLAST analysis of this nucleotide sequence revealed 100% identity with the respective intergenic region from S. waius (AF088899), while lower homology (91 – 94%) was revealed with the intergenic region from Streptococcus agalactiae (AF291417), Streptococcus difficile (AF064441) and S. salivarius (AB051016). S. waius was recently isolated from pasteurized skimmed milk in New Zealand and described as a novel Streptococcus species based on phenotypic observations, restriction endonuclease analysis, ribotyping, random amplified polymorphic DNA analysis, DNA – DNA hybridisation, G + C contents and comparison of the sequences of the 16S rRNA gene, and the 16S – 23S intergenic spacer region (Flint et al., 1999). However, the authors did not include S. macedonicus in the phylogenetic analyses. Based on the overall results of the present study, it is clearly demonstrated that the two Streptococcus species are phylogenetically identical. In conclusion, the species-specific primer pair designed and the PCR conditions developed in this study allowed the clear-cut discrimination of S. mace-
donicus from most lactic acid bacteria species usually occurring in dairy products. The presence of competing DNA did not affect the efficiency of the method, while its detection limit was rather low. Furthermore, the assay developed was successfully applied to whole cells from a single colony and in the real food matrix (milk). Therefore, this specific and rapid PCR-based technique is an attractive alternative to the conventional methods of identification. Furthermore, the successful evaluation of the S. macedonicus-specific probe allows the application of DNA hybridisation as an additional identification tool. Finally, this study clearly demonstrates that S. waius, recently described as a novel Streptococcus species, is phylogenetically identical to S. macedonicus.
References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. Journal of Molecular Biology 215, 403 – 410. Chagnaud, P., Machinis, K., Coutte, L.A., Marecat, A., Mercenier, A., 2001. Rapid PCR-based procedure to identify lactic acid bacteria: application to six common Lactobacillus species. Journal of Food Microbiology 44, 139 – 148. Deasy, B.M., Rea, M.C., Fitzgerald, G.F., Cogan, T.M., Beresford, T.P., 2000. A rapid PCR method to distinguish between Lactococcus and Enterococcus. Systematic and Applied Microbiology 23, 510 – 522. Flint, S.H., Lawrence, J.H., Brooks, J.D., 1999. Streptococcus waius sp. nov.: a thermophilic streptococcus from a biofilm. International Journal of Systematic Bacteriology 49, 759 – 767. Fortina, M.G., Ricci, G., Mora, D., Parini, C., Manachini, P.L., 2001. Specific identification of Lactobacillus helveticus by PCR with pepC, pepN and htrA targeted primers. FEMS Microbiology Letters 198, 85 – 89. Igarashi, T., Yamamoto, A., Goto, N., 1996. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction. Oral Microbiology and Immunology 11, 294 – 298. Igarashi, T., Yamamoto, A., Goto, N., 2000. Polymerase chain reaction for detection and identification of Streptococcus sobrinus. Journal of Medical Microbiology 49, 1069 – 1074. Igarashi, T., Yano, Y., Yamamoto, A., Sasa, R., Goto, N., 2001. Identification of Streptococcus salivarius by PCR and DNA probe. Letters in Applied Microbiology 32, 394 – 397. Leenhouts, K.J., Kok, J., Venema, G., 1990. Stability of integrated plasmids in the chromosome of Lactobacillus lactis. Applied and Environmental Microbiology 56, 2726 – 2735. Marteau, P., Rambaud, J.-C., 1993. Potential of using lactic acid bacteria for therapy and immunomodulation in man. FEMS Microbiology Reviews 12, 207 – 220. Pot, B., Ludwig, W., Kersters, K., Schleifer, K.-H., 1994. Taxonomy
M. Papadelli et al. / International Journal of Food Microbiology 81 (2003) 231–239 of lactic acid bacteria. In: De Vuyst, L., Vandamme, E.J. (Eds.), Bacteriocins of Lactic Acid Bacteria. Blackie Academic & Professional, Glasgow, pp. 13 – 90. Stiles, M.E., 1996. Biopreservation by lactic acid bacteria. Antonie Leeuwenhoek 70, 331 – 345. Tannock, G.W., 1997. Probiotic properties of lactic-acid bacteria: plenty of scope for fundamental R&D. Trends in Biotechnology 15, 270 – 274. Tsakalidou, E., Zoidou, E., Pot, B., Wassil, L., Ludwig, W., Devriese, L.A., Kalantzopoulos, G., Schleifer, K.H., Kersters, K., 1998. Identification of streptococci from Greek Kasseri cheese and description of Streptococcus macedonicus sp. nov. International Journal of Systematic Bacteriology 48, 519 – 527. Vandamme, P., Pot, B., Gillis, M., De Vos, P., Kersters, K., Swings,
239
J., 1996. Polyphasic taxonomy: a consensus approach to bacterial systematics. Microbiological Reviews 60, 407 – 438. Ward, L.J., Brown, J.C., Davey, G.P., 1998. Two methods for the genetic differentiation of Lactococcus lactis ssp. lactis and cremoris based on differences in the 16S rRNA gene sequence. FEMS Microbiology Letters 166, 15 – 20. Young, J.P.W., Downer, H.J., Eardly, B.D., 1991. Phylogeny of the prototrophic Rhizobium strain BTAi1 by polymerase chain reaction-based sequencing of a 16S rRNA gene segment. Journal of Bacteriology 143, 2271 – 2277. Zapparoli, G., Torriani, S., 1997. Rapid identification and detection of Lactobacillus sanfrancisco in sourdough by species-specific PCR with 16S rRNA-targeted primers. Systematic and Applied Microbiology 20, 640 – 644.