Rapid detection of all known ebolavirus species by reverse transcription-loop-mediated isothermal amplification (RT-LAMP)

Accepted Manuscript Title: Rapid detection of all known ebolavirus species by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) Authors: Olamide K Oloniniyi, Yohei Kurosaki, Hiroko Miyamoto, Ayato Takada, Jiro Yasuda PII: DOI: Reference:

S0166-0934(16)30623-1 http://dx.doi.org/doi:10.1016/j.jviromet.2017.03.011 VIRMET 13226

To appear in:

Journal of Virological Methods

Received date: Revised date: Accepted date:

7-11-2016 22-3-2017 24-3-2017

Please cite this article as: Oloniniyi, Olamide K, Kurosaki, Yohei, Miyamoto, Hiroko, Takada, Ayato, Yasuda, Jiro, Rapid detection of all known ebolavirus species by reverse transcription-loop-mediated isothermal amplification (RT-LAMP).Journal of Virological Methods http://dx.doi.org/10.1016/j.jviromet.2017.03.011 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Rapid detection of all known ebolavirus species by reverse transcription-loop-mediated isothermal amplification (RT-LAMP)

Olamide K Oloniniyi1,2, Yohei Kurosaki1, Hiroko Miyamoto3, Ayato Takada3,4, Jiro Yasuda1,2*

1

Department of Emerging Infectious Diseases, Institute of Tropical Medicine (NEKKEN), Nagasaki University, Nagasaki, Japan.

2

Graduate School of Biomedical Sciences and Program for Nurturing Global Leaders in Tropical and Emerging Communicable Diseases,

Nagasaki University, Nagasaki, Japan. 3

Division of Global Epidemiology, Research Center for Zoonosis Control, Hokkaido University, Sapporo, Japan.

4

Global station for Zoonosis Control, Global Institution for Collaborative Research and Education, Hokkaido University, Sapporo,

Japan.

E-mail: O.K.O. o.olonini [email protected]

Y.K.

[email protected]

H.M. [email protected] J.Y.

A.T. [email protected]

[email protected]

*Corresponding author: Jiro Yasuda, Ph. D., D.V.M. Department of Emerging Infectious Diseases, Institute of Tropical Medicine, Nagasaki University 1-12-4 Sakamoto, Nagasaki 852-8523, Japan Phone: +81-95-819-7848

Fax: +81-95-819-7848

E-mail: [email protected]

Highlights

The RT-LAMP assays for each of the five species of Ebolavirus were developed. The assays were highly specific for each species of Ebolavirus. The sensitivity of each assay was comparable to that of the established RT-PCR assay. All detections occurred in less than 30 min with real-time monitoring.

Abstract Ebola virus disease (EVD), a highly virulent infectious disease caused by ebolaviruses, has a fatality rate of 25-90%. Without a licensed chemotherapeutic agent or vaccine for the treatment and prevention of EVD, control of outbreaks requires accurate and rapid diagnosis of cases. In this study, five sets of six oligonucleotide primers targeting the nucleoprotein gene were designed for specific identification of each of the five ebolavirus species using reverse transcription-loop mediated isothermal amplification (RT-LAMP) assay. The detection limits of the ebolavirus species-specific primer sets were evaluated using in vitro transcribed RNAs. The detection limit of species-specific RT-LAMP assays for Zaire ebolavirus, Sudan ebolavirus, Taï Forest ebolavirus, and Bundibugyo ebolavirus was 256 copies/reaction, while the detection limit for Reston ebolavirus was 64 copies/reaction, and the detection time for each of the RT-LAMP assays was 13.3 ± 3.0, 19.8 ± 4.6, 14.3 ± 0.6, 16.1 ± 4.7, and 19.8 ± 2.4 min (mean ± SD), respectively. The sensitivity of the species-specific RT-LAMP assays were similar to that of the established RT-PCR and quantitative RT-PCR assays for diagnosis of EVD and are suitable for field or point-of-care diagnosis. The RT-LAMP assays were specific for the detection of the respective species of ebolavirus with no cross reaction with other species of ebolavirus and other viral hemorrhagic fever viruses such as Marburg virus,

Lassa fever virus, and Dengue virus. The species-specific RT-LAMP assays developed in this study are rapid, sensitive, and specific and could be useful in case of an EVD outbreak.

Keywords: ebolavirus; Ebola virus disease; diagnosis; RT-LAMP

1. Introduction Ebola virus disease (EVD) is a lethal viral hemorrhagic fever caused by viruses in the genus Ebolavirus and has a case fatality rate ranging from 25-90%. The genus Ebolavirus comprises five species, Zaire ebolavirus, Sudan ebolavirus, Reston ebolavirus, Tai Forest ebolavirus, and Bundibugyo ebolavirus, represented by Ebola virus (EBOV), Sudan virus (SUDV), Reston virus (RESTV), Taï Forest virus (TAFV), and Bundibugyo virus (BDBV), with non-segmented negative sense RNA genomes [1]. All these ebolaviruses, except RESTV, cause pathogenic disease in humans [1].

Since the first outbreak in 1976, EVD has been characterized by sporadic outbreaks in several parts of Africa [2]. The recent outbreak in West Africa is the largest with 28,616 confirmed, probable, or suspected cases and 11,310 deaths [3]. The diagnosis of EVD based solely on clinical grounds is very difficult. This is due to the infrequency of hemorrhagic symptoms, the non-specific symptoms which usually mark the early onset of the disease, and the list of possible differential diagnoses such as malaria, Lassa fever, typhoid fever, leptospirosis, etc. [4]. Coupled with the absence of a licensed specific chemotherapeutic agent or vaccine for the treatment or prevention of EVD, controlling the spread of outbreaks relies on accurate diagnoses and quarantine of cases. According to case definition recommended by the World Health Organization (WHO), a laboratory-confirmed case of EVD during an outbreak requires the detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) or detection of IgM or IgG antibodies directed against the virus [5]. A rapid chromatographic immunoassay test kit was approved by the WHO during the recent EVD outbreak in West Africa [6]. The kit is designed for the qualitative detection of the VP40 antigen of EBOV, SUDV, and BDBV; and although it is capable of being used in a point-of-care (POC) setting, it is not approved for use in making a definitive diagnosis of EVD due to its lower sensitivity and specificity compared to a bench mark RT-PCR assay [6]. RT-PCR assays have been

shown to be sensitive and specific for the diagnosis of EVD [7]. A fully automated RT-PCR system with a turnaround time of 100 minutes from sample acquisition to test results was used during the recent outbreak [8]. However, it only detects EBOV belonging to one out of the 5 species of the genus Ebolavirus. While EBOV has been responsible for most recorded outbreaks, SUDV and BDBV have also caused EVD outbreaks [9, 10]. The potential for TAFV to cause an outbreak also remains unknown [11]. Coupled with the sporadic nature of EVD outbreaks, there is a need to detect all species of ebolaviruses with a rapid, cost-effective, and easy-to-use diagnostic test that is sensitive and specific for the detection of ebolaviruses. Reverse transcription-loop mediated isothermal amplification (RT-LAMP) is a nucleic acid amplification method that amplifies DNA reversed transcribed from RNA using strand displacement DNA polymerase under isothermal conditions [12]. Detection of specific RNA with a RT-LAMP assay usually occurs in less than 60 minutes and requires neither sophisticated technique nor expensive equipment. Due to the amplification of nucleic acid material under isothermal condition, LAMP can be carried out in a simple water bath and the addition of a fluorescent detection reagent to the assay results in positive amplification that can be judged by the naked eye under natural light or UV light [13]. LAMP can also be combined with lateral flow devices (LFDs) for easy visualization of positive

results [14]. RT-LAMP has been applied for the diagnosis of EVD [15-18]. However, these assays are specific only for the detection of EBOV. In this study, we developed and evaluated rapid and sensitive RT-LAMP assays for the specific detection of each of the known species of ebolaviruses (EBOV, SUDV, TAFV, RESTV, and BDBV).

2. Materials and Methods 2.1 Viral RNAs. Virus strains used in this study are described in Table 5. All filoviruses, Lassa virus RNAs were kindly provided by Dr. Heinz Feldmann, National Institute of Allergy and Infectious Diseases, USA.. Arboviral RNAs were kindly provided by Dr. Kouichi Morita, Department of Virology, Institute of Tropical Medicine, Nagasaki University, Nagasaki, Japan. Severe fever with thrombocytopenia virus and Vesicular stomatitis Indiana virus (SFTSV) were propagated in Vero (African green monkey kidney) cells. Influenza virus was propagated in Madin-Darby canine kidney (MDCK) cells. The infected culture supernatants were harvested at 2 days post-infection, and viral RNAs were extracted with QIAmp Viral RNA Mini Kit (Qiagen, Hilden, Germany).

2.2 Preparation of artificial Ebolavirus RNA Artificial RNA spanning the nucleoprotein (NP) was synthesized for all species of ebolavirus using conventional cloning techniques. For EBOV, SUDV, BDBV and RESTV, the entirety of NP coding sequence (cds) was amplified from complementary DNA (cDNA) of the respective species and inserted into a cloning vector with a T7 promoter region, pGEM3Zf(+) (Promega, Madison, U.S.A.), using designed PCR primers with restriction sites for EcoRI and BamHI added to the 5’ end of the forward and reverse primers respectively. Details of primers are shown in Table 1. For the amplification of the NP gene of Makona variant, primers Ze-F and ZeM-R were used.

PCR amplification was done using PrimeStar GXL DNA polymerase (Takara Bio, Shiga, Japan) according to the

manufacturer’s instructions. PCR amplification in 30 cycles of 98˚C at 10sec, 60˚C at 15sec, and 68˚C at 3min. TAFV NP cds was amplified separately in two segment and combined with overlap extension PCR using PrimeStar GXL DNA polymerase (Takara) as described above. The PCR products were purified after gel electrophoresis using 1% UltraPure Agarose (Life technologies) and extracted using QIAquick gel extraction kit (Qiagen, Hilden, Germany).

The purified PCR products were ligated with vector pGEM-3Zf (+) (Promega, Madison, WI) using Ligation high version 2 (Toyobo, Osaka, Japan) according to the manufacturer’s instructions and then transformed into Escherichia coli DH5α competent cells. The artificial NP gene RNA (2,220 nucleotides) for each species of ebolavirus was synthesized using the T7 Ribomax Express Large Scale RNA Production System (Promega) according to the manufacturer’s instructions. The transcripts were purified using the RNeasy Plus Mini kit (Qiagen, Hilden, Germany) and resuspended in 40 µl of RNase-free water. The concentrations of in vitro transcribed RNAs were determined using a Quant-IT Ribogreen RNA kit (Invitrogen, Carlsbad, CA).

2.3 Primer design Five sets of species-specific primers for each species of ebolavirus were designed from the NP gene. The NP amino acid sequences of each species of ebolavirus, available in the GenBank database, were aligned using sequence analysis software (GENETYX, Tokyo, Japan) to identify a conserved region among the genus Ebolavirus. The coding sequences for 20-410 amino acids in the N-terminal of NP, which are highly conserved in the genus, were determined as the potential target region. Consensus sequences

based on all the available sequences of each species of ebolavirus and spanning the potential target region identified were then used in the LAMP primer design support software program PrimerExplorer v4 (Net Laboratory, Tokyo, Japan; http://primerexplorer.jp/e/). The five primer sets for each species were located in the equivalent NP region of each species. RESTV-specific primers were first confirmed to show efficient amplification. The other four species-specific primers were designed based on the RESTV-specific primers by modifications with nucleotides complementary to each species’ sequence. The RT-LAMP assay required a set of six primers: two outer primers (F3 and B3), a forward inner primer (FIP), a reverse inner primer (BIP), a forward loop primer (LF), and a reverse loop primer (LB). FIP consisted of F1c complementary to the F1 sequence, a TTTT spacer, and the F2 sequence. BIP consisted of B1c complementary to the B1 sequence, a TTTT spacer, and the B2 sequence. The sequences of the oligonucleotide primers are shown in Table 2.

2.4 RT-LAMP RT-LAMP was performed with a real-time fluorescence detection platform (Genie III; OptiGene, West Sussex, UK). The

real-time fluorescence detection was carried out in a total volume of 25 µl using Isothermal Master Mix reagent (Nippon Gene, Tokyo, Japan) by mixing 4 µl of primer mix (containing of 20 pmol of FIP and BIP, 5 pmol of F3 and B3, and 10 pmol of LF and LB), 15 µl of Isothermal Master Mix (containing GspSSD DNA polymerase and an intercalator dye), 1 µl of avian myeloblastosis virus reverse transcriptase (0.15 U; Life technologies, Carlsbad, CA), and 1µl of RNA sample. LAMP amplification was carried out at 63°C for 30 min with fluorescence detection in the Genie III followed by melt curve analysis from 90–70°C at 0.05°C/s. For the specificity studies, 1 x 106 copies of the different viruses listed in Table 5 were used with the same conditions as stated above.

2.5 Conventional and quantitative RT-PCR Conventional RT-PCR and quantitative RT-PCR (qRT-PCR) were performed for comparison of sensitivities with the species-specific RT-LAMP assays. A RT-PCR assay using the primers NP-Fe and NP-Re was performed as described by Ogawa et al. [19]. The primers target the NP gene and are specific for the detection of all ebolavirus species. The qRT-PCR assay was performed as described by Huang et al. using enp-F, enp-R, enp-Probe primers targeting the NP gene and a SmartCycler 2 system (Cepheid, Sunnyvale, CA) [20].

2.6 Sequence analysis Viral RNA was extracted from human oral swab samples using QIAmp viral RNA minikit (Qiagen, Hilden, Germany) obtained during our previous study carried out in Guinea [18, 21]. One microliter of RNA was reverse transcribed using a PrimeScript II 1st strand cDNA synthesis kit (Takarabio, Shiga, Japan) and the primer 3185-GIN-rgZ-seq-23f designed by Hoenen et al. [22]. Subsequently, 2 µl of cDNA was amplified in overlapping fragments using primer sets designed by Hoenen et al. and Primescript GXL DNA polymerase (Takarabio). Sanger’s method was used to read the sequence using 5 µl of purified PCR product with a BigDye Terminator v3.1 sequencing kit (Life Technologies) followed by purification of products using ethanol precipitation. Fragments were analyzed using 3130xl Genetic Analyzer (Applied Biosystems, Forster, CA). Sequences were assembled using Genetyx ver. 11 software (Genetyx, Tokyo, Japan) with fragment ends trimmed to exclude primer sequences and submitted to GenBank as Ebola virus/H. sapiens-wt/GIN/2015/Makona-CON4234 (Accession number LC152433).

3 Results 3.1 Detection limits of the assays Five sets of primers targeting a conserved region on the NP gene of the ebolavirus RNA genome were designed for the specific amplification of each of the ebolavirus species (Table 2). To determine the detection limits of each species-specific RT-LAMP assay, we examined the assays using 1 to 4,096 copies of in vitro transcribed RNA containing the cds of NP from each species of ebolaviruses. The reactions were monitored using Genie III with real-time fluorescence detection. The detection limits for each species-specific RT-LAMP assay were 256 copies per reaction for EBOV, SUDV, TAFV, and BDBV, while 64 copies per reaction was the detection limit of the RESTV species-specific RT-LAMP assay. The corresponding detection times (measured in minutes and given as a mean ± standard deviation of three independent experiments) for the aforementioned detection limits of the species-specific RT-LAMP assays were 13.3 ± 3.0, 19.8 ± 4.6, 14.3 ± 0.6, 16.1 ± 4.7 and 19.8 ± 2.4 for EBOV, SUDV, TAFV, BDBV, and RESTV, respectively (Table 3). There was also no inhibition of the assays at high concentrations of RNA (106 copies, data not shown). The melt curve analysis of RT-LAMP product of EBOV, SUDV, TAFV, BDBV, and RESTV were 87.12°C ± 0.08, 86.18°C ± 0.08, 87.10°C ± 0.07, 86.93°C ± 0.10, 87.40°C ±

0.04 (mean ± standard deviation of three independent experiments) The EBOV species specific primer set was designed using the consensus sequence derived from available sequences in GenBank. This was before the EVD outbreak in West Africa. Therefore, we examined the mismatch in the target sites of the primer set on several EBOV strains and EBOV Makona variants which are responsible for the EVD outbreak in West Africa. Some mismatches were found in the target regions of the EBOV primer sets (Table 4). In vitro transcribed RNA based on the coding sequence of the NP gene of the Ebola virus/H. sapiens-wt/GIN/2015/Makona-CON4234 isolate, which contains 5 mismatches in the primer target sites, were prepared to test if the mutations noted in the target sites of the primers would affect the detection limits of the primer set. The detection limit of the EBOV species-specific RT-LAMP assay for in vitro transcribed RNA from the Makona variant was 256 copies per reaction (Figure 1).

3.2 Specificity of the assays To assess the specificity of the developed RT-LAMP assays, a variety of viruses including Marburg virus, Lassa fever virus,

Dengue virus, severe fever with thrombocytopenia syndrome virus, Yellow fever virus, and Rift Valley fever virus were examined (Table 5). These viruses can either cause similar symptomatology as ebolaviruses or could be possible differential diagnoses for EVD. Each of the ebolavirus species-specific RT-LAMP assays was specific for the detection of the viruses in the corresponding ebolavirus species.

3.3 Comparative detection with RT-LAMP and RT-PCR Sensitivity of each ebolavirus species-specific RT-LAMP assay was compared using two RT-PCR assays: a conventional RT-PCR assay able to detect all species of ebolaviruses and a quantitative RT-PCR assay for the detection of EBOV. Three variants of EBOV (Mayinga, Kikwit, and Makona) and one variant from each of SUDV, TAFV, RESTV, and BDBV were used for this purpose. To compare the sensitivities of the RT-LAMP and RT-PCR assays, equal volumes of 10-fold serial dilutions of viral RNA, extracted from each virus were used in the assays. For the EBOV variants, the RT-LAMP assay had the same sensitivity as the qRT-PCR and RT-PCR assays in the detection of the Makona variant, while it was less sensitive than either the qRT-PCR or RT-PCR assays in the detection of the Mayinga and Kikwit variants. For the detection of other ebolavirus species, both the RT-LAMP and real time RT-PCR assays had

similar sensitivities for SUDV detection, while the RT-LAMP assay was less sensitive than the RT-PCR assay for the detection of TAFV, BDBV, and RESTV (Table 6).

4 Discussion The recent outbreak of EVD in West Africa, which started in Guinea, demonstrates the need for a diagnostic test that can detect a broad spectrum of filovirus species even in countries without previous filovirus infection outbreaks. Prior to the recent outbreak of EVD in West Africa, the geographical distribution of EVD outbreaks was confined to Central and East Africa. Thus, ebolaviruses were not thought to be endemic in West Africa although TAFV was detected in a single case in Cote d’Ivoire[11]. While TAFV has not caused an outbreak yet since its discovery in 1994, this remains a possibility. Furthermore, given the wide geographical ranges of fruit bats, which have been proposed as the reservoir of filoviruses, and the commencement of epidemics following a single introductory event into the human population and subsequent human-to-human transmission, any species of ebolaviruses pathogenic to humans could cause an outbreak in any of the diverse locations where the reservoir is found [23, 24]. Having a diagnostic test able to detect all ebolavirus

species in a single run represents an ideal situation. In this study, we developed RT-LAMP assays for the detection of each species of ebolaviruses using 5 different primer sets. LAMP primers require a long span of nucleotide sequence for primer design, and while the conserved region across the NP gene was found by aligning the amino acid sequences, it was difficult to find a span of conserved region across the corresponding nucleotide sequences that could be used for designing one set of primers that could possibly detect all species of ebolavirus in a single test. An advantage of having 5 different RT-LAMP assays as opposed to one pan-ebolavirus assay is the ability to determine the particular species of ebolavirus. The RT-LAMP assays developed had a detection limit that ranged from 64-256 copies/reaction, and all detections occurred in less than 30 min with real-time monitoring. The RESTV RT-LAMP assay appears more sensitive than the other developed assays and this might be due to the other primer sets being designed based on RESTV primer set. While we have tried to keep the nucleotide sequences in the same position as those of RESTV primer set, we have had to remove a nucleotide or more in some of the primers due to consideration for the melting temperature of the primer and the binding at the terminal regions of the primers. This might explain why the RESTV assay appears more sensitive than the other developed assays.

Furthermore, the expected temperature for the melt curve analysis of our designed RT-LAMP assays’ products ranged from 86.18°C ± 0.08 to 87.40°C ± 0.04. The melting temperature can be used to exclude non-specific amplification by comparing that of positive control, but this is not mandatory in RT-LAMP assay. The RT-LAMP assays also showed similar sensitivity to conventional and qRT-PCR assays in the detection of SUDV and Makona variant of EBOV while it was less sensitive in the detection of other species of ebolavirus. However, during the acute phase of EVD, viraemia is usually very high [1] which could mean that RT-LAMP assays can be useful in diagnosis of EVD during this period. Moreover, due to the portable detection equipment, RT-LAMP assay can be performed in remote areas, are suitable for POC diagnosis, and can be used as an adjunct to RT-PCR assays. As with any diagnostic method that relies on the identification of genetic materials, there is a possibility of mutations in the target sites causing a reduction in the sensitivity of diagnostic method. The number of mutations found in the target site of the EBOV RT-LAMP primers for different variants ranged from 1 to 6 (Table 4). The EBOV variants used for this analysis included Mayinga, which was responsible for the first recorded outbreak of EVD, and Makona from the recent West Africa outbreak. Despite the mutations noted in the target sites of the EBOV NP primers, there was no significant reduction in the detection limits of the EBOV species-specific RT-LAMP assay when in vitro transcribed RNA from the

Mayinga or Makona were used as templates. This could be due to the location of most of the mutations in the 5'-terminal region of the different primers used for ebolavirus species-specific RT-LAMP assays (Supplementary Figure 1). While there were two mutations in the 3'-terminal region of B1, B1 is joined to B2 by a TTTT spacer to form the BIP primer, and the effect of these mutations on the functioning of said primer might not be pronounced. Therefore, the use of multiple primers in RT-LAMP assay targeting different regions could offset the effects of mutation in any particular primer. The RT-LAMP assays for all ebolavirus species were as sensitive as RT-PCR assays and were specific with detection occurring in less than 30 minutes. While detection by our developed RT-LAMP assays occurs at a faster time compared to RT-PCR assays, the preceding procedures of sample collection and RNA extraction are the same. Shortening the time taken for these steps coupled with the RT-LAMP assays could significantly improve diagnosis of EVD during outbreaks. At the outset of an outbreak, quick identification of the causative organism is paramount. This is particularly important for EVD outbreaks, when different species might be responsible for the outbreak. In the BDBV outbreak in Uganda in 2007, RT-PCR assays that were specific for either EBOV or SUDV were unable to detect the causative agent [9]. Our new RT-LAMP assays could be useful for the diagnosis of EVD, especially at the start of an outbreak

for triage of patients.

Acknowledgements We thank Dr. Kouichi Morita, Department of Virology, Institute of Tropical Medicine, Nagasaki University, for the kind provision of some of the arboviral RNAs used for specificity studies.

Funding statement This work was funded by the Ministry of Health, Labor, and Welfare of Japan, and the Japan Agency for Medical Research and Development (AMED) (15fk-0108039h0002). publish, or preparation of the manuscript.

References

The funders had no role in study design, data collection and analysis, decision to

1.

Feldmann, H.S., A.; Geisbert, T.W. , Filoviridae: Marburg and Ebola Viruses. In Fields virology; Knipe, D. M., Howley, P. M., Eds. Lippincott Williams and Wilkins: Philadelphia, PA,

USA, 2013. 1(6th edition): p. 923-952. 2.

Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62.

3.

WHO, Situation report: Ebola virus disease, June 10, 2016. 2016.

4.

Nkoghe, D., et al., Cutaneous manifestations of filovirus infections. Int J Dermatol, 2012. 51(9): p. 1037-43.

5.

WHO, Case definition recommendations for Ebola or Marburg Virus Diseases. 2014.

6.

WHO, WHO emergency use assessment and listing for Ebola virus disease IVDs. Public report. Product: ReEBOV™ Antigen Rapid

Test Kit. 7.

Wang, Y.P., X.E. Zhang, and H.P. Wei, Laboratory detection and diagnosis of filoviruses. Virol Sin, 2011. 26(2): p. 73-80.

8.

Semper, A.E., et al., Performance of the GeneXpert Ebola Assay for Diagnosis of Ebola Virus Disease in Sierra Leone: A Field

Evaluation Study. PLoS Med, 2016. 13(3): p. e1001980. 9.

Towner, J.S., et al., Newly discovered ebola virus associated with hemorrhagic fever outbreak in Uganda. PLoS Pathog, 2008. 4(11): p. e1000212.

10.

WHO, Ebola haemorrhagic fever in Sudan, 1976. Report of a WHO/International Study Team. Bull World Health Organ, 1978. 56(2): p. 247-70.

11.

Formenty, P., et al., Human infection due to Ebola virus, subtype Cote d'Ivoire: clinical and biologic presentation. The Journal of infectious diseases, 1999. 179 Suppl 1: p. S48-53.

12.

Notomi, T., et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 2000. 28(12): p. E63.

13.

Xu, H., et al., Establishment of a novel one-step reverse transcription loop-mediated isothermal amplification assay for rapid

identification of RNA from the severe fever with thrombocytopenia syndrome virus. J Virol Methods, 2013. 194(1-2): p. 21-5. 14.

Cao, Z., et al., Visual Detection of West Nile Virus Using Reverse Transcription Loop-Mediated Isothermal Amplification Combined

with a Vertical Flow Visualization Strip. Front Microbiol, 2016. 7: p. 554.

15.

Kurosaki, Y., et al., Rapid and simple detection of Ebola virus by reverse transcription-loop-mediated isothermal amplification. J Virol Methods, 2007. 141(1): p. 78-83.

16.

Li, H., et al., Survey and Visual Detection of Zaire ebolavirus in Clinical Samples Targeting the Nucleoprotein Gene in Sierra Leone. Front Microbiol, 2015. 6: p. 1332.

17.

Xu, C., et al., Visual detection of Ebola virus using reverse transcription loop-mediated isothermal amplification combined with nucleic

acid strip detection. Arch Virol, 2016. 161(5): p. 1125-33. 18.

Kurosaki, Y., et al., Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay

Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea. PLoS Negl Trop Dis, 2016. 10(2): p. e0004472. 19.

Ogawa, H., et al., Detection of all known filovirus species by reverse transcription-polymerase chain reaction using a primer set specific

for the viral nucleoprotein gene. J Virol Methods, 2011. 171(1): p. 310-3. 20.

Huang, Y., et al., Rapid detection of filoviruses by real-time TaqMan polymerase chain reaction assays. Virol Sin, 2012. 27(5): p. 273-7.

21.

Kurosaki, Y., et al., Deployment of a Reverse Transcription Loop-Mediated Isothermal Amplification Test for Ebola Virus Surveillance

in Remote Areas in Guinea. J Infect Dis, 2016. 22.

Hoenen, T., et al., Virology. Mutation rate and genotype variation of Ebola virus from Mali case sequences. Science, 2015. 348(6230): p. 117-9.

23.

Olival, K.J. and D.T. Hayman, Filoviruses in bats: current knowledge and future directions. Viruses, 2014. 6(4): p. 1759-88.

24.

Baize, S., et al., Emergence of Zaire Ebola Virus Disease in Guinea - Preliminary Report. N Engl J Med, 2014.

Table 1. Primer sets designed for amplification of NP gene. Species

Variant/Strain* Position

EBOV

Mayinga

2667-2689 Ze-F

CTTAAGAATTCTCACTGATGATGTTGCAGGATTG

Mayinga

470-493

Ze-R

CTTAAGGATCCATGGATTCTCGTCCTCAGAAAATC

Makona

470-493

ZeM-R

CTTAAGGATCCATGGATTCTCGTCCTCAGAAAGTC

Boniface

2651-2674 Se-F

CTTAAGAATTCTCAGTCATGTTGAAGAACGGCAAG

458-480

CTTAAGGATCCATGGATAAACGGGTGAGAGGTTC

SUDV

BDBV

TAFV

Butalya

Pauléoula

Name

Se-R

Sequences (5'-3')

2658-2677 Be-F

CTTAAGAATTCTCACCTGTGATGCTGGAGGA

458-477

Be-R

CTTAAGGATCCATGGATCCTCGTCCAATCAG

464-481

TAFV1A-F

ACTATAGGGCGAATTCATGGAGAGTCGGGCCCAC

1299-1333 TAFV1A-R ATGTTGTGCTAGCGAGCTAAGGGCAGCCTTAAAGG 1304-1339 TAFV1B-F

AAGGCTGCCCTTAGCTCGCTAGCACAACATGGAGAG

2664-2683 TAFV1B-R CGACTCTAGAGGATCCTTACTTGTGGTGCTGAAGG RESTV Pennyslvania

2661-2683 Re-F

CTTAAGAATTCTTACTGATGGTGCTGCAAGTTGC

464-483

CTTAAGGATCCATGGATCGTGGGACCAGAAG

Re-R

*Accession number of respective viruses are AF086833 for Mayinga, FJ968794 for Boniface, FJ217161 for Butalya, FJ217162 for Pauléoula, and NC_004161 for Pennyslvania.

Table 2. Ebolavirus species specific RT-LAMP primer sets. Species* EBOV

Position

Ze-F3

GGAGATTACAAACTTTTCTTGG

909-925

Ze-B3

GGAGAGAAACTGACCGG

Ze-FIP

CGCTTCACTCCATCACGCTTCTTTTGTGGCGCAGTCAAGTATTTGG

796-816 833-852, 884-903

Ze-BIP CCAGCAGTATCTAGTGGAAATTTTGCTTCAGTTGTCTCCTCTTC

769-793

Ze-LF

GACTTCAAAACGGAACCCGTGCCCT

865-880

Ze-LB

GAACACTTGCTGCCATG

710-730

Se-F3

GGAGATCATAGGCTCTTCCTC

896-913

Se-B3

GGATAAAAACTGACCAGC

Se-FIP

CGGTGCACATTCTCCTTTTCTCTTTTGTGATGCAGTTCAATACTTAG

Se-BIP

CCCAATGTCACCGGTGGAAATTTTGCTTCTGTTGTCTCCTCTTC

758-781

Se-LF

GACCTCAAACCTGAAACCATGGCC

853-868

Se-LB

GAACATTGGCTGCAATG

710-731

Be-F3

GGGGATTATAAACAATTTTTGG

896-913

Be-B3

TGAAAGAAATTGTCCAGC

735-755, 783-804 821-840, 872-891

BDBV

Sequences (5'-3')

722-743 747-767,

SUDV

Name

735-755, 784-804

Be-FIP

CGCTTGACACCTTCCTTTTTCTTTTTGTAATGCGGTAAAATACCTTG

821-840, 872-891

TAFV

CCTGCTGCCTCGAGTGGAAATTTTGCTTCTGTTGTTTCCTCCTC

758-781

Be-LF

CATCTCAAAACGGAATCCATGACC

853-869

Be-LB

GAACATTGGCTGCAATGC

716-737

Te-F3

GGTGACTACAAGCAATTCTTGG

902-919

Te-B3

AGAGAGGAACTGTCCGGC

Te-FIP

CGCTTGACTCCTTCCTTTTTCCTTTTGCAATGCAGTCAAGTACCTTG

741-761, 789-810 827-846, 878-897

RESTV

Be-BIP

Te-BIP CCTGCTGCATCCAGTGGCAATTTTGCTTCTGTTGTCTCCTCTTC

763-787

Te-LF

GACCTCAAAGCGAAAGCCATGACCC

859-874

Te-LB

GAACACTGGCTGCAATG

716-739

Re-F3

GGTGACTATAAATTGTTCTTGGAG

902-919

Re-B3

TGAGAGAAATTGCCCTGC

Re-FIP

CGATTGACACCGTCCTTCTTCCTTTTGCAATGCTGTACAGTATTTGG

741-761, 789-810 827-846, 878-897

Re-BIP CCTGCTGCAACGAGTGGAAATTTTGCTTCTGTAGTCTCCTCTTC

763-787

Re-LF

GAGCTCAAATTTGAATCCATGACCT

858-873

Re-LB

CGTACGTTGGCCGCACT

*Accession number of strains of EBOV, SUDV, BDBV, TAFV, and RESTV which the primer positions are mapped to are AF086833,

FJ968794, FJ217161, FJ217162, and NC_004161, respectively.

Table 3. Detection limits of Ebolavirus species-specific RT-LAMP assays

Copies/ul 4,096 1,024 256 64 16 4 1

EBOV

SUDV

10.8 ± 1.3 11.4 ± 1.0 13.3 ± 3.0

14.5 ± 0.4 14.7 ± 1.3 19.8 ± 4.6

₋

₋

₋ ₋ ₋

₋ ₋ ₋

Tp (min)/pos TAFV

BDBV

RESTV

12.5 ± 0.4 13.1 ± 1.0 14.3 ± 0.6

12.3 ± 0.3 15.4 ± 2.6 16.1 ± 4.7

₋

₋

13.8 ± 0.1 15.8 ± 2.8 17.5 ± 3.0 19.8 ± 2.4

₋ ₋ ₋

₋ ₋ ₋

₋ ₋ ₋

* Initial concentration of in vitro RNAs used were 4,096 copies/µl for all species of Ebolavirus and the concentration of the other templates generated by serial dilution by a factor of 4. Time of detection (Tp) is given as the mean of 3 independent experiments with standard deviation.

Table 4. Sequence identities between EBOV RT-LAMP primers and EBOV variant sequences.

EBOV variant*

mismatch numbers (nucleotides) Identity (%)

EBOV/COD/76/Mayinga

0

100

EBOV/COD/95/Kikwit EBOV/COD/76/deRoover EBOV/COD/02/Ilembe EBOV/GAB/96/1Ikot EBOV/COD/07/Luebo EBOV/COD/77/Bonduni EBOV/GAB/96/1Eko

0 0 6 1 2 0 1

100 100 96.3 99.4 98.8 100 99.4

EBOV/COD/14/Lomela-Lokolia19 EBOV/GIN/14/Mak-Gueckedou C05 EBOV/GIN/14/Mak-WPG C15 EBOV/GIN/14/Mak-Kissidogou C15 EBOV/SLE/14/Mak-201403164 EBOV/LBR/14/MaK- DOE1 EBOV/GIN/15/MaK-CON4234

2 4 4 4 5 5 5

98.8 97.5 97.5 97.5 96.9 96.9 96.9

EBOV/MLI/14/Mak- DPR1

6

96.3

*Accession numbers of respective viruses, in descending order, are AF086833, KR867676, KC242801, KC242800, KC242798, KC242785, KC242791, KC242793, KP271020, KJ660348, KP096422, KJ660346, KT589390, KR074996, and KP260799.

Table 5. Specificity of Ebolavirus species specific RT-LAMP assays.

Viruses

variant/strain

EBOV

Mayinga Kikwit

+ +

₋ ₋

₋ ₋

₋ ₋

₋ ₋

Makona Boniface Pauléoula Pennsylvania Butalya Ravn Ozolin

+

₋ +

₋ ₋ +

₋ ₋ ₋ +

₋ ₋ ₋ ₋ +

Musoke Angola Pinneo Josiah

₋ ₋ ₋ ₋

₋ ₋ ₋ ₋

₋ ₋ ₋ ₋

₋ ₋ ₋ ₋

₋ ₋ ₋ ₋

₋

₋

₋

₋

₋

₋

₋

₋

₋

₋

₋ ₋ ₋

₋ ₋ ₋

₋ ₋ ₋

₋ ₋ ₋

₋ ₋ ₋

SUDV TAFV RESTV BDBV Ravn virus Marburg virus

Lassa virus Rift Valley fever virus SFTSV* Dengue virus

MP12 YG-1 serotype1 serotype2 serotype3

EBOV

RT-LAMP SUDV TAFV RESTV

₋ ₋ ₋ ₋ ₋ ₋

₋ ₋ ₋ ₋ ₋

₋ ₋ ₋ ₋

₋ ₋ ₋

BDBV

₋ ₋

₋ ₋

₋ ₋

₋ ₋

₋ ₋

₋ ₋

₋

₋

₋

₋

₋

Influenza virus

A/PR/8/34 (H1N1)

₋

₋

₋

₋

₋

Chikungunya virus

S27

₋

₋

₋

₋

₋

Yellow fever virus Vesicular stomatitis Indiana virus

serotype4 17D

*SFTSV: Severe fever with thrombocytopenia syndrome virus

Table 6. Comparison of Ebolavirus species specific RT-LAMP assays with RT-PCR assays. 10-fold serial dilutions RT-LAMP

Species (Viruses) Variant

qRTPCR

RTPCR

EBOV

EBOV

Mayinga

10-2

10-2

10-1

10-2 10-3 NT NT NT NT

10-2 10-3 10-1 10-3 10-2 10-3

10-1 10-3

SUDV TAFV RESTV BDBV

Kikwit Makona Boniface Pauléoula Pennsylvania. Butalya

SUDV

TAFV

RESTV BDBV

10-1 10-2 10-1 10-2

Detection limits of 10-fold serial dilutions of viral RNAs of Ebolavirus species using qRT-PCR, conventional RT-PCR, and RT-LAMP assays were compared. NT: not tested.

Figure legends Figure 1. Detection of in vitro transcribed RNA encoding the sequences of the Makona variant. (A) The assay was performed using an EBOV species-specific primer set at a temperature of 63°C for 30 min. The initial concentration of in vitro transcribed RNA used was 4,096 copies/µl, and the concentrations of the other templates were generated through serial dilutions by a factor of 4. (B) Annealed derivatives following amplification in (A). Melt curve analysis was performed at 90–70°C at 0.05°C/s for 5 min.

Supplementary Figure 1. Alignment of different isolates of EBOV with positions of the primers developed for the EBOV RT-LAMP assay. Accession numbers of the respective isolates, in descending order, are AF086833, KR867676, KC242801, KC242800, KC242798, KC242785, KC242791, KC242793, KP271020, KJ660348, KP096422, KJ660346, KT589390, KR074996, and KP260799.

(A) 12 4,096 1,024 256

4

Fluorescence (×10 )

10 8

64 16 4 1 DDW

6 4 2

0

-2

0

5

10

15

Time (min) 8

4

cence derivative (×10 )

(B)

6

4

2

4,096 1,024 256 64 16 4 1 DDW

20

25

30