Rapid detection of European orthobunyaviruses by reverse transcription loop-mediated isothermal amplification assays

Journal of Virological Methods 236 (2016) 252–257

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Rapid detection of European orthobunyaviruses by reverse transcription loop-mediated isothermal amplification assays Jeremy V. Camp a,∗ , Norbert Nowotny a,b a

Institute for Virology, University of Veterinary Medicine, Vienna, Austria Department of Basic Medical Sciences, College of Medicine, Mohammed Bin Rashid University of Medicine and Health Sciences, Dubai, United Arab Emirates b

a b s t r a c t Article history: Received 23 June 2016 Received in revised form 25 July 2016 Accepted 1 August 2016 Available online 1 August 2016 Keywords: Arbovirus Orthobunyavirus Bunyaviridae RT-LAMP Loop-mediated isothermal amplification Mosquito

The development of reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) assays are described herein for the detection of two orthobunyaviruses (Bunyaviridae), which represent the two main serogroups found in mosquitoes in Central Europe. The RT-LAMP assays were optimized for the ˇ virus (a California encephalitis group virus found in Aedes sp or Ochlerotatus sp detection of Tˇ ahyna ˇ mosquitoes) and Batai virus (also called Calovo virus, a Bunyamwera group virus found in Anopheles maculipennis s.l. mosquitoes) nucleic acid using endemic European virus isolates. The sensitivity of the RTLAMP assays was determined to be comparable to that of conventional tests, with a limit of detection < 0.1 pfu per reaction. The assays can be performed in 60 min under isothermal conditions using very simple equipment. Furthermore, it was possible to proceed with the assays without nucleic acid extraction, albeit at a 100-fold loss of sensitivity. The RT-LAMP assays are a sensitive, cost-efficient method for both arbovirus surveillance as well as diagnostic laboratories to detect the presence of these endemic orthobunyaviruses. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Viruses in the genus Orthobunyavirus (family Bunyaviridae) are minus-sense RNA viruses that are transmitted by mosquitoes and other arthropods (Schmaljohn and Nichol, 2007). Like all members of the Bunyaviridae, the viruses have three genomic segments – the small (S), medium (M), and large (L) segments – encoding approximately six gene products (Schmaljohn and Nichol, 2007). In Central Europe two orthobunyaviruses are frequently collected as part of ˇ virus (TAHV) and Batai routine adult mosquito surveillance, Tˇ ahyna virus (BATV), representing two major serogroups of these viruses (Hubálek, 2008; Hubálek et al., 2014). Other orthobunyaviruses, such as Inkoo virus, Snowshoe hare virus, Lednice virus, and Sedlec virus are found less frequently and have no reported medical or veterinary relevance (Bakonyi et al., 2013; Hubálek, 2008; Hubálek et al., 2014). ˇ virus (TAHV), a member of the California encephalitis Tˇ ahyna group viruses, was first isolated from a pool of female Ochlerota-

Abbreviations: RT-LAMP, reverse transcription loop-mediated isothermal amplification. ∗ Corresponding author: Veterinärplatz 1, 1210 Vienna, Austria. E-mail address: [email protected] (J.V. Camp). http://dx.doi.org/10.1016/j.jviromet.2016.08.001 0166-0934/© 2016 Elsevier B.V. All rights reserved.

tus caspius mosquitoes in the present-day Czech Republic (Bárdos and Danielová, 1959; Hubálek, 2008). TAHV has been isolated from flood-water mosquitoes species (genera Ochlerotatus and Aedes), and diverse species of mammals are implicated in the enzootic transmission cycle, including wild pigs and rabbits (Danielova et al., 1976; Halouzka et al., 2008; Hubálek, 2008; Rödl et al., 1987, 1979, 1978, 1977). Batai virus (BATV), a member of the Bunyamwera group, is another orthobunyavirus that is frequently identified from pools of Anopheles sp (especially Anopheles maculipennis s.l.) mosquitoes in Central Europe. Cattle appear to be the most important amplifying vertebrate host in the enzootic transmission cycle (Hofmann et al., 2015; Jöst et al., 2011; Lambert et al., 2014). These viruses are poorly studied, and their transmission cycles are not well defined. Moreover, their public health importance remains unclear. There is a high seropositivity to TAHV (up to 88%) in humans living near floodplains in Czech Republic and Austria, although confirmed cases typically present with mild flulike symptoms and less-frequently meningoencephalitis (Bárdos et al., 1975; Halouzka et al., 2008; Hubálek, 2008; Sonnleitner et al., ˇ 2014). Although Central European Batai virus (also called Calovo virus) has only been associated with a mild flu-like disease, reassortants of Batai virus were shown to cause severe hemorrhagic disease outbreak in East Africa (Briese et al., 2006; Gerrard et al., 2004). In Asia, another Batai virus isolate (Chittoor virus) caused

J.V. Camp, N. Nowotny / Journal of Virological Methods 236 (2016) 252–257

mild symptoms in sheep (Pavri and Singh, 1969). Other Bunyamwera group members are known to cause serious disease in both humans and ruminants (e.g., Cache Valley virus and Tensaw virus (Calisher et al., 1988; Campbell et al., 2006; Chung et al., 1990)). Thus, continued surveillance for these viruses is important, and methods with increased efficiency will ensure the surveillance is not prohibitively expensive in terms of cost and time. Loop-mediated isothermal amplification assay (LAMP) has been previously developed for many viruses, including arboviruses (Perera et al., 2009; Peyrefitte et al., 2008) and other viruses in the family Bunyaviridae (Hu et al., 2015; Osman et al., 2013). The LAMP assay uses 6 primers: two conventional primers (“forward” and “reverse”), two primers that are internal to the conventional primers, and two which are responsible for connecting the products to form a large chain of connected amplimers through the mechanism of a strand-displacing polymerase (Notomi et al., 2000). It is a single tube reaction, and the assay can be further simplified by eliminating cycling of temperatures, which is typical of PCR-based assays, by using an “isothermal” recombinant bacterial DNA polymerase (Bsm or Bst) combined with a reverse transcriptase (RT) (Notomi et al., 2000). The amplified product can be detected by an increase in turbidity caused by the addition of excess magnesium ions to the reaction mix, or by detection of the dsDNA products via gel electrophoresis and nucleic acid-binding dyes (e.g., SYBR green). Herein the development of an inexpensive and technically simple method for identifying putative positive pools of mosquitoes with TAHV and BATV is described. 2. Material and methods 2.1. Virus stock ˇ ˇ virus (TAHV) and Calovo Tˇ ahyna virus (CVOV) were obtained from Dr. Zdenek Hubálek and Dr. Ivo Rudolf (Czech Republic Academy of Sciences) as lyophilized mouse brain tissue stored at −20 ◦ C (Table 1). Both viruses have been previously characterized (Bárdos and Danielová, 1959; Bennett et al., 2011; Dufkova et al., 2014; Smetana et al., 1967). The lyophilized TAHV or CVOV samples (isolated from mosquito homogenate and recovered from passage in suckling mouse brain) were used to create virus working stocks in Vero cells, and Vero cell passage 1 was used for all reported steps. Virus stocks were sequenced using reported primers (Kuno, 1998; Kuno et al., 1996). Virus concentration was quantified with a plaque assay using Vero cells grown in Dulbecco’s MEM with 2% FBS under a 0.3% agarose semisolid media overlay for 3 days. Viral nucleic acids (vRNA) were extracted from 140 uL of viral working stock (cleared cell culture supernatant) or working stock dilution using QIAamp viral RNA kit, a silicon column-based nucleic acid-binding kit (Qiagen). 2.2. LAMP primer design The small genomic segment (S segment) was selected due to the conserved nature and its use in current established methods for virus identification (Kilian et al., 2010; Kuno et al., 1996). Complete sequences of TAHV and CVOV small (S) segments are available from GenBank (Table 1). The sequence was used in PrimerExplorer V4 (www.primerexplorer.jp) to design LAMP primers. Briefly, the calculated Gibb’s free energy (G) estimates of potential primers were evaluated to select an optimal primer set (Table 2) which favored 3 binding to template. 2.3. RT-LAMP The RT-LAMP reaction was optimized in 25 ␮L mixture using initial concentrations of reagents as suggested by others (Parida et al.,

253

2005, 2004). Optimal reaction conditions (temperature, time) and reagent concentrations (MgSO4 , dNTP, avian myoblastoma virus (AMV) reverse transcriptase) were determined empirically using extracted vRNA. The optimized reagent mixture was determined to contain 8 mM MgSO4 , 1 mM dNTP, 0.8 M Betaine, 8 U Bsm DNA polymerase (NEB), and 5 U AMV reverse transcriptase (Promega) in 1X isothermal polymerase buffer. Reactions mixtures were mixed with template and incubated at 56 ◦ C for 1 h. After 1 h, the amplification products were detected in three ways: (1) presence of cloudy precipitate was noted by visual inspection; (2) 10X SYBR green gel stain was added per tube and tubes were visualized for fluorescence under a UV light; and (3) reaction mixtures were analyzed by gel electrophoresis using a 1.5% agarose gel in Tris-acetate-EDTA buffer, and gels were visualized under UV light after GelRed nucleic acid staining (Biotium). 2.4. RT-PCR Random hexamers were used to prime cDNA synthesis from extracted RNA using a modified reverse transcriptase (Maxima Hminus RT, Thermo Scientific), and this served as a template for PCR. Orthobunyavirus S segment-specific primers (BCS82C,BSC332V) were used to detect the virus via a Taq DNA polymerase chain reaction as previously described (Table 2) (Kuno, 1998; Kuno et al., 1996). Reaction mixtures were visualized using gel electrophoresis in Tris-acetate-EDTA buffer on a 1.2% agarose gel to determine the presence of amplicons. Similar reaction conditions (primers and cycling conditions) were used for a quantitative real-time PCR assay using PowerUp SYBR Green 2 x Mastermix (Thermo). The assay was measured with an Applied Biosystems 7300 fast real-time PCR system, and the threshold was set automatically by the software. 2.5. Sensitivity assay Primers complementary to the conserved 5 and 3 ends of the S segment of each virus were used to amplify the complete segment by Taq DNA polymerase PCR (TAHV5pcl, TAHV3pcl, BATV5pcl, BATV3pcl; Table 2). After confirming the correct amplicon size by agarose gel electrophoresis, the products were then directly inserted by ligation into a pGEM vector using a TA cloning system (Promega). Clones containing the insert were grown on Ampicillin selection media, and selected using IPTG-induced betagalactosidase colorimetric change. The plasmids were purified using alkaline lysis, and the presence of the insert was confirmed by outside-in sequencing using M13 vector primers (Microsynth AG, Switzerland). The plasmid was used in quantitative real-time PCR, and the copy number was calculated using the exact molecular weight of oligonucleotides. Using a standard dilution series of the plasmid, the sensitivities of the assays (RT-PCR and RT-LAMP) were tested on extracted vRNA from virus stock that had been serially-diluted in PBS with 4% BSA. 2.6. Virus-spiked mosquito homogenate To test the robustness of the assay under practical conditions, mosquitoes were collected from a floodplain habitat along the Danube river (Nationalpark Donau-auen near Orth an der Donau, 48◦ 7.739 N, 16◦ 42.461 E) with CDC Light traps (J.W. Hock Co.) baited with a florescent tube light and dry ice. A pool of 50 adult female Aedes (Aedimorphus) vexans (Meigen, 1830) and a pool of 50 adult female Coquillettidia (Coquillettidia) richiardii (Ficalbi, 1889) were homogenized in ice-cold 1.5 mL phosphate buffered saline with 4% v/v bovine serum albumin (Fraction V, Thermo). After confirming the pools were negative for orthobunyaviruses by RT-PCR (described above), stock TAHV virus was added to the homogenized Aedes vexans pool and stock BATV was added to the homogenized

254

J.V. Camp, N. Nowotny / Journal of Virological Methods 236 (2016) 252–257

Table 1 European orthobunyviruses used to develop reverse transcription loop-mediated isothermal amplification assays. Virus

Strain/Isolate

History

S Segment

Reference

Passage history

ˇ virus Tˇ ahyna

Prototype, “Bardos 92”

HM036211

(Bárdos and Danielová, 1959; Bennett et al., 2011)

SMBa = 5, Vero = 1

Batai virus

ˇ Calovo virus, strain 134

1958, Czech Republic, mosquito pool 1963, Czech Republic, mosquito pool

KJ542624

(Dufkova et al., 2014; Smetana et al., 1967)

SMB = 2, Vero = 1

a

SMB = suckling mouse brain.

Table 2 List of primers. Application

Primer name

Sequence

Reference

RT-PCR

BCS82C BCS332V TAHVS5pcl TAHVS3pcl BATVS5pcl BATVS3pcl TAHVSF3 TAHVSR3 TAHVSFIP TAHVSRIP TAHVSLoopF TAHVSLoopR BATVSF3 BATVSR3 BATVSFIP BATVSRIP BATVSLoopR

ATGTCTGATTTGGTTTTTTATGATGTCGC TGTTCCTGTTYCCAGGAAAAT AGTAGTGTACTCCACTTGAATACTTTGA AGTAGTGTGCTCCACTGAATAC AGTAGTGTACTCCACACTAAAAACTTGC AGTAGTGTGCTCCACCTAAAACTT CAATAATCATTTTCCTGGAAACAG TTCTGCTCCATTGTCCCA CCATCTAGCCAAATACCCTGACATTTTAACAACCCAATTGATAACAACG CAGTTCAAAGAAAATGAAGACGCAGTTTTTGATCCCATTAGACTCAGCT GCCGGTGGATGGTAAGAT CAAAGGGAGTTGATTAAAACAACCG GTCAGATGGAGAAGAGGTT TGAACTTCATTCAATTTGCTGA AATTGCCAGGGGATAAAATCTGATTTTCTCTCATTCTTCCCAGGGT GCAAAGGAAAGAGATGGAGCCATTTTTGTCCAAGTTGATGCTTCC AGTATCTGGAGAAGACCATGCGTCA

(Kuno et al., 1996) (Kuno et al., 1996)

Cloning

TAHV RT-LAMP

BATV RT-LAMP

Coquillettidia richiardii pool. The spiked viruses were 10-fold diluted three times (to 1:1000) in mosquito homogenate and processed for the RT-LAMP assay as described above. 3. Results 3.1. RT-LAMP assay design and optimization The S segment of both TAHV and European BATV is genetically conserved in mosquito isolates over several decades (Dufkova et al., 2014; Sonnleitner et al., 2014). Therefore this segment was selected for LAMP assay primer design. Using default settings of the PrimerExplorer version 4 software, multiple potential primer sets (≥ 5) were generated over the length of the entire S segment. The stability of the 5 ends of the outer primers was evaluated, and those sets with estimated G < −4.0 kcal/mol were selected for further evaluation. Of those sets, loop primers were selected using the software such that the calculated stability (G) of the 3 end of the loop primers was ≤ −4.0 kcal/mol. The final software-generated primer sets are listed in Table 2. Only one loop primer passed evaluation conditions, and therefore only one is given below. Other assay conditions were optimized using cDNA synthesized with random primers from virus working stock (i.e., Vero cell passage 1). Specifically, temperature was tested over a linear gradient from 50 ◦ C–63 ◦ C, and two concentrations each of dNTP and AMV-RT were tested at the optimal temperature (data not shown). The efficiency of these conditions was evaluated by the lowest time to detectable product, measured in 15 min intervals (data not shown). 3.2. Sensitivity of RT-LAMP for detection of orthobunyaviruses Nucleic acid was extracted from serial 10-fold dilutions of the virus working stock using a commercial kit (Qiagen). The RT-LAMP reaction included 1 ␮L of the extract as a template to test the

sensitivity of the newly developed RT-LAMP assay. After 1 h incubation at 56 ◦ C, the reaction tubes were inspected for amplicons. Positive tubes had a cloudy appearance (turbidity not shown), and addition of SYBR green fluoresced product under UV light (Fig. 1). Furthermore, agarose gel electrophoresis displayed the heavilybanded appearance typical of LAMP assays (not shown). In this way, TAHV was detected from a solution containing 2.3 pfu (0.04 pfu per assay) by all three methods. Similarly, CVOV was detected from a solution containing 5.2 pfu (0.09 pfu per assay) by gel electrophoresis, however a 10-fold lower dilution was detected using SYBR green and turbidity by eye. A quantitative PCR was performed with cDNA made by random primers of the exact same dilution series, and cycle threshold (Ct) values were compared to a standard curve made from diluted plasmid DNA containing a cloned insert of the S segment. The limit of detection for the TAHV RT-LAMP assay was therefore ≥ 180 copies of template; and the limit of detection for the CVOV RT-LAMP assay was calculated to be ≥ 389 copies of template (Fig. 2). This coincided directly with limit of detection assays based on conventional RT-PCR (Fig. 3). As final tests of the assays under practical conditions, a small dilution series (1:10, 1:100, and 1:1000) of each stock virus was spiked into virus-negative mosquito homogenate and RNA was extracted. The RT-LAMP assays detected virus in each dilution up to a lower limit of approximately 1.6 pfu TAHV and 3.7 pfu BATV per assay (more dilute virus preparations were not tested). The results of the RT-LAMP display the characteristic ladder-like appearance after agarose gel electrophoresis (Fig. 4). Additionally, the ability to detect virus in unextracted samples was tested using serial 10fold dilutions of virus stock. Diluted virus (1 ␮L) was added to 10 x isothermal polymerase buffer and heated to 80 ◦ C for 10 min, then the rest of the RT-LAMP reaction mixture was added and incubated at 56 ◦ C for 1 h. Increased turbidity and fluorescence after SYBR green addition was detected in reaction tubes containing at least 16.4 pfu virus stock (not shown).

J.V. Camp, N. Nowotny / Journal of Virological Methods 236 (2016) 252–257

255

Fig. 1. Limit of detection of cultured virus by RT-LAMP. RNA was extracted from serial 10-fold dilutions of Tahyna virus (TAHV) and Batai virus (BATV) cell culture stock and used in an RT-LAMP assay. The products were visualized by adding 10 x SYBR green gel stain to the reaction and photographed under UV light. Decreasing concentration of virus stock (beginning with a 1:10 dilution of TAHV and undiluted BATV) are indicated with a decreasing bar height, and uninfected Vero cell culture supernatant (“C”) control reaction tube was also included.

Fig. 2. Quantitative real-time PCR to determine limit of detection. Tahyna virus (TAHV) and Batai virus (BATV) S segment was cloned in entirety into a pGEM vector using TA PCR cloning. The purified plasmid DNA was used as a standard curve in a real time reverse transcriptase PCR assay to determine the amount of viral nucleic acid in dilutions (1:10000 or 1:100000) of stock cultures. The log10 copy number is shown as a function of the cycle threshold value from the real time PCR assay. This quantification was used to calculate the approximate limit of detection of an RT-LAMP assay.

4. Discussion One goal of routine surveillance of captured mosquitoes or sentinels for the presence of arboviruses is to provide early warning

of potential viral threats to public health. However, the process of meaningful mosquito surveillance – including sampling the population, accurate identification of mosquitoes, preparing mosquitoes for virus analysis, and identification of virus in the mosquitoes – is costly in terms of time and money. In practice there exists a gap between the time of increased virus transmission in the environment and the identification of viruses in pools of mosquitoes captured during surveillance. Loop-mediated isothermal amplification is a quick and relatively simple assay with high sensitivity, and therefore can increase the efficiency of virus surveillance efforts. Herein we demonstrate two RT-LAMP assays that can quickly determine the presence of two European orthobunyaviruses. These two viruses are well-suited for a RT-LAMP assay since they have potential veterinary and medical importance, and they are poorly studied. Efforts to increase the efficiency of identification will aid in clinical diagnosis and future scientific investigations. Moreover, these viruses have been demonstrated to be relatively stable over time genetically, and it is expected that the assays will maintain robustness over time despite genetic drift. Although the specificity between related viruses was not evaluated, it is expected that there is little risk of false positivity due to the 6 specific primers required by the assay. The abilities of the respective assays to detect the Asian lineage of TAHV (Kilian et al., 2013; Lu et al., 2009) or the Afro-Asian lineage of BATV (Dufkova et al., 2014; Liu et al., 2014; Yadav et al., 2012) were not evaluated. It was noted that the BATV RT-LAMP assay tolerated single point mutations in the amplified

256

J.V. Camp, N. Nowotny / Journal of Virological Methods 236 (2016) 252–257

Fig. 3. Limit of detection by RT-PCR. Serial 10-fold dilutions of Tahyna virus (TAHV) and Batai virus (BATV) cell culture stock were used in a reverse transcription-polymerase chain reaction to detect the viral S segments. The products were visualized as a 250 bp band using 1.5% agarose gel electrophoresis. Decreasing concentration of stock virus, beginning with undiluted supernatant, is shown by decreasing bar height above gel. For both viruses, the limit of detection was a 1:10000 dilution which corresponded to 2.3 pfu stock TAHV and 5.2 pfu stock BATV, or less than 0.1 pfu per PCR reaction. Other lanes shown include molecular weight ladder (“M”) and uninfected Vero cell culture supernatant (“C”).

Fig. 4. Virus detected in spiked mosquito homogenate. Dilutions of Tahyna virus (TAHV) and Batai virus (BATV) in cell culture supernatant were spiked into homogenate from pools of wild-caught female Aedes vexans and Coquillettidia richiardii mosquitoes, respectively. The virus was detected by RT-LAMP assay, and the characteristic banding patterns are visualized after electrophoresis on a 2.0% agarose gel. Shown are the mosquito homogenates (“H”), three 10-fold dilutions of virus spiked into mosquito homogenate beginning at 1:10 (“1”, “2”, “3”), a control without template (“−”), and a plasmid-based positive control (“+”) for each virus. The molecular weight ladder (“M”) is shown for reference.

region (variants in the viral quasispecies were revealed by cloning efforts), however the decreased sensitivity of the BATV RT-LAMP assay compared to the TAHV RT-LAMP assay is potentially due to the single loop primer compared to the two loop primers in the TAHV RT-LAMP assay. Thus, the observed reduced efficiency of the amplification in this case may support the claim that off-target or non-specific binding of the primers would not increase the false positive rate, but would rather reduce the efficiency of the reaction as a whole; however this has not been evaluated. These assays are designed with the intended purpose of screening large numbers of mosquitoes quickly; and any putative positive results must be secondarily confirmed by other conventional methods. We confirmed the assays will detect virus in RNA extracted from mosquito homogenate using three pools of 15 female Anopheles maculipennis s.l. from Austria that were confirmed BATV-positive by RT-PCR (Kolodziejek et al.; manuscript in preparation). Furthermore, we tested the assays using a dilution series of virus spiked into mosquito homogenates. We conclude the mosquito genetic material present in the homogenate does not interfere with the assay. Finally, although we report detection without nucleic acid extraction, further evaluation of the assay should include detection directly from pooled mosquito homogenate in field trials.

5. Conclusions Two RT-LAMP assays were developed and characterized to idenˇ virus and tify two endemic European orthobunyaviruses, Tˇ ahyna ˇ Batai (Calovo) virus. The assays reported herein have limits of detection that are directly comparable to conventional methods of virus detection (RT-PCR). The RT-LAMP assay is an attractive platform to increase the efficiency of efforts to detect arboviruses during mosquito surveillance.

Acknowledgements The authors wish to acknowledge the helpful advice of Dr. Tamás Bakonyi and support of Dr. Jolanta Kolodziejek in the development of the assays reported herein. We are indebted to Dr. Zdenek Hubálek and Dr. Ivo Rudolf from the Czech Academy of Sciences for ˇ ˇ virus and Calovo virus. kindly providing isolates of Tˇ ahyna

References ˇ virus – a virus isolated from mosquitoes Bárdos, V., Danielová, V., 1959. The Tˇ ahyna in Czechoslovakia. J. Hyg. Epidemiol. Microbiol. Immunol. 3, 264–276.

J.V. Camp, N. Nowotny / Journal of Virological Methods 236 (2016) 252–257 Bárdos, V., Medek, M., Kama, V., Hubálek, Z., 1975. Isolation of Tahyna virus from the blood of sick children. Acta Virol. 19, 447. Bakonyi, T., Kolodziejek, J., Rudolf, I., Berˇciˇc, R., Nowotny, N., Hubálek, Z., 2013. Partial genetic characterization of Sedlec virus (Orthobunyavirus, Bunyaviridae). Infect. Genet. Evol. 19, 244–249, http://dx.doi.org/10.1016/j. meegid.2013.07.025. Bennett, R.S., Gresko, A.K., Murphy, B.R., Whitehead, S.S., 2011. Tahyna virus genetics, infectivity, and immunogenicity in mice and monkeys. Virol. J. 8, 135, http://dx.doi.org/10.1186/1743-422X-8-135. Briese, T., Bird, B., Kapoor, V., Nichol, S.T., Lipkin, W.I., 2006. Batai and Ngari viruses: M segment reassortment and association with severe febrile disease outbreaks in East Africa. J. Virol. 80, 5627–5630, http://dx.doi.org/10.1128/JVI.02448-05. Calisher, C.H., Lazuick, J.S., Lieb, S., Monath, T.P., Castro, K.G., 1988. Human infections with Tensaw virus in south Florida: evidence that Tensaw virus subtypes stimulate the production of antibodies reactive with closely related Bunyamwera serogroup viruses. Am. J. Trop. Med. Hyg. 39, 117–122. Campbell, G.L., Mataczynski, J.D., Reisdorf, E.S., Powell, J.W., Martin, D.A., Lambert, A.J., Haupt, T.E., Davis, J.P., Lanciotti, R.S., 2006. Second human case of Cache Valley virus disease. Emerg. Infect. Dis. 12, 854–856, http://dx.doi.org/10.3201/ eid1205.051625. Chung, S.I., Livingston, C.W., Edwards, J.F., Crandell, R.W., Shope, R.E., Shelton, M.J., Collisson, E.W., 1990. Evidence that Cache Valley virus induces congenital malformations in sheep. Vet. Microbiol. 21, 297–307. Danielova, V., Malkova, D., Minar, J., Ryba, J., 1976. Dynamics of the natural focus of Tahyna virus in southern Moravia and species succession of its vectors, the mosquitoes of the genus Aedes. Folia Parasit 23, 243–249. ´ T., Danielová, V., Ruˇ ˚ zek, D., Dufkova, L., Pachler, K., Kilian, P., Chrudimsky, ˇ Nowotny, N., 2014. Full-length genome analysis of Calovo strains of Batai orthobunyavirus (Bunyamwera serogroup): implications to taxonomy. Infect. Genet. Evol. 27, 96–104, http://dx.doi.org/10.1016/j.meegid.2014.07.005. Gerrard, S.R., Li, L., Barrett, A.D., Nichol, S.T., 2004. Ngari virus is a Bunyamwera virus reassortant that can be associated with large outbreaks of hemorrhagic fever in Africa. J. Virol. 78, 8922–8926, http://dx.doi.org/10.1128/JVI.78.16. 8922-8926.2004. Halouzka, J., Juˇricová, Z., Janková, J., Hubálek, Z., 2008. Serologic survey of wild boars for mosquito-borne viruses in South Moravia (Czech Republic). Vet. Med. 53. Hofmann, M., Wiethölter, A., Blaha, I., Jöst, H., Heinemann, P., Lehmann, M., Miller, T., Cadar, D., Yanase, T., Kley, N., Eiden, M., Groschup, M., Schmidt-Chanasit, J., 2015. Surveillance of Batai virus in bovines from Germany. Clin. Vaccine Immunol. 22, 672–673, http://dx.doi.org/10.1128/CVI.00082-15. Hu, D., Hao, L., Zhang, J., Yao, P., Zhang, Q., Lv, H., Gong, X., Pan, X., Cao, M., Zhu, J., Zhang, Y., Feng, Y., Wang, C., 2015. Development of reverse transcription loop-mediated isothermal amplification assays to detect Hantaan virus and Seoul virus. J. Virol. Methods 221, 68–73, http://dx.doi.org/10.1016/j.jviromet. 2015.04.017. Hubálek, Z., Rudolf, I., Nowotny, N., 2014. Arboviruses pathogenic for domestic and wild animals, In: Murphy, K.M. and F.A. (Ed.), Adv. Virus Res. pp. 201–275. Hubálek, Z., 2008. Mosquito-borne viruses in Europe. Parasitol. Res. 103, 29–43, http://dx.doi.org/10.1007/s00436-008-1064-7. Jöst, H., Bialonski, A., Schmetz, C., Günther, S., Becker, N., Schmidt-Chanasit, J., 2011. Isolation and phylogenetic analysis of Batai virus. Germany. Am. J. Trop. Med. Hyg. 84, 241–243, http://dx.doi.org/10.4269/ajtmh.2011.10-0483. ˚ zek, D., Danielová, V., Hypˇsa, V., Grubhoffer, L., 2010. Nucleotide Kilian, P., Ruˇ ˇ virus (Bunyaviridae, Orthobunyavirus) small (S) and variability of Tˇ ahyna medium (M) genomic segments in field strains differing in biological properties. Virus Res. 149, 119–123, http://dx.doi.org/10.1016/j.virusres.2010. 01.005. ´ T., Ruˇ ˚ zek, D., 2013. The Kilian, P., Valdes, J.J., Lecina-Casas, D., Chrudimsky, ˇ orthobunyavirus and an variability of the large genomic segment of Tˇ ahyna all-atom exploration of its anti-viral drug resistance. Infect. Genet. Evol. 20, 304–311, http://dx.doi.org/10.1016/j.meegid.2013.09.023. Kuno, G., Mitchell, C.J., Chang, G.J., Smith, G.C., 1996. Detecting bunyaviruses of the Bunyamwera and California serogroups by a PCR technique. J. Clin. Microbiol. 34, 1184–1188. Kuno, G., 1998. Universal diagnostic RT-PCR protocol for arboviruses. J. Virol. Methods 72, 27–41, http://dx.doi.org/10.1016/S0166-0934(98)00003-2.

257

Lambert, A.J., Huhtamo, E., Di Fatta, T., De Andrea, M., Borella, A., Vapalahti, O., Kosoy, O., Ravanini, P., 2014. Serological evidence of Batai virus infections, bovines, Northern Italy, 2011. Vector-Borne Zoonotic Dis. 14, 688–689, http:// dx.doi.org/10.1089/vbz.2014.1596. Liu, H., Shao, X., Hu, B., Zhao, J., Zhang, L., Zhang, H., Bai, X., Zhang, R., Niu, D., Sun, Y., Yan, X., 2014. Isolation and complete nucleotide sequence of a Batai virus strain in Inner Mongolia, China. Virol. J. 11, 138, http://dx.doi.org/10.1186/ 1743-422X-11-138. Lu, Z., Lu, X.-J., Fu, S.H., Zhang, S., Li, Z.X., Yao, X.H., Feng, Y.P., Lambert, A.J., Ni, D.X., Wang, F.T., Tong, S.X., Nasci, R.S., Feng, Y., Dong, Q., Zhai, Y.G., Gao, X.Y., Wang, H.Y., Tang, Q., Liang, G.D., 2009. Tahyna virus and human infection, China. Emerg. Infect. Dis. 15, 306–309. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63. Osman, H.A.M., Eltom, K.H., Musa, N.O., Bilal, N.M., Elbashir, M.I., Aradaib, I.E., 2013. Development and evaluation of loop-mediated isothermal amplification assay for detection of Crimean Congo hemorrhagic fever virus in Sudan. J. Virol. Methods 190, 4–10, http://dx.doi.org/10.1016/j.jviromet.2013.03.004. Parida, M., Posadas, G., Inoue, S., Hasebe, F., Morita, K., 2004. Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42, 257–263. Parida, M., Horioke, K., Ishida, H., Dash, P.K., Saxena, P., Jana, A.M., Islam, M.A., Inoue, S., Hosaka, N., Morita, K., 2005. Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J. Clin. Microbiol. 43, 2895–2903, http://dx.doi. org/10.1128/JCM.43.6.2895-2903.2005. Pavri, K.M., Singh, K.R.P., 1969. Activity of the Chittoor virus in India. In: Arboviruses of the California Complex and the Bunyamwera Group., Symposium Held at Smolenice, October 18–21, 1966. Slovak Academy of Sciences Bratislava, pp. 191–197. Perera, N., Aonuma, H., Yoshimura, A., Teramoto, T., Iseki, H., Nelson, B., Igarashi, I., Yagi, T., Fukumoto, S., Kanuka, H., 2009. Rapid identification of virus-carrying mosquitoes using reverse transcription-loop-mediated isothermal amplification. J. Virol. Methods 156, 32–36, http://dx.doi.org/10.1016/j. jviromet.2008.10.023. Peyrefitte, C.N., Boubis, L., Coudrier, D., Bouloy, M., Grandadam, M., Tolou, H.J., Plumet, S., 2008. Real-time reverse-transcription loop-mediated isothermal amplification for rapid detection of Rift valley fever virus. J. Clin. Microbiol. 46, 3653–3659, http://dx.doi.org/10.1128/JCM.01188-08. Rödl, P., Bárdos, V., Hubálek, Z., Juricová, Z., 1977. Experimental infection of foxes with Tahyna virus. Folia Parasitol. (Praha) 24, 373–376. Rödl, P., Bárdos, V., Hubálek, Z., 1978. Experimental infection of Putorius eversmanni polecats and Martes foina martens with Tahyna virus. Acta Virol. 22, 502–505. Rödl, P., Bárdos, V., Ryba, J., 1979. Experimental transmission of Tahyna virus (California group) to wild rabbits (Oryctolagus cuniculus) by mosquitoes. Folia Parasitol. (Praha) 26, 61–64. Rödl, P., Bárdos, V., Hubálek, Z., 1987. Experimental infeciton of the squirrel (Sciurus vulgaris) and the muskrat (Ondatra zibethica) with Tahyna virus (California group, Bunyaviridae). Folia Parasitol. (Praha) 34, 189–191. Schmaljohn, C.S., Nichol, S.T., 2007. Bunyaviridae. In: Fields Virology. Lippincott Williams & Wilkins, Philadelphia, pp. 1741–1790. Smetana, A., Danielová, V., Kolman, J.M., Málková, D., Minar, J., 1967. The isolation of the Calovo virus from the mosquitoes of the group Anopheles maculipennis in Southern Moravia. J. Hyg. Epidemiol. Microbiol. Immunol. 11, 55–59. Sonnleitner, S.T., Lundström, J., Baumgartner, R., Simeoni, J., Schennach, H., Zelger, R., Prader, A., Schmutzhard, E., Nowotny, N., Walder, G., 2014. Investigations on California serogroup orthobunyaviruses in the Tyrols: first description of Tahyna virus in the Alps. Vector Borne Zoonotic Dis. 14, 272–277, http://dx.doi. org/10.1089/vbz.2013.1360. Yadav, P.D., Sudeep, A.B., Mishra, A.C., Mourya, D.T., 2012. Molecular characterization of Chittoor (Batai) virus isolates from India. Indian J. Med. Res. 136, 792–798.