Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes – A homogenous system for sequence-specific detection

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

YMCPR1105_proof ■ 29 December 2014 ■ 1/7

Molecular and Cellular Probes xxx (2014) 1e7

Contents lists available at ScienceDirect

Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr

Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection Q2

Rebecca L. Howard a, 1, David J. French a, 1, James A. Richardson b, Colette E. O'Neill c, Michael P. Andreou d, Tom Brown b, Duncan Clark d, Ian N. Clarke c, John W. Holloway c, Peter Marsh e, Paul G. Debenham a, * a

LGC, Queens Road, Teddington, TW11 0LY, UK University of Southampton School of Chemistry, Highfield, Southampton SO17 1BJ, UK c University of Southampton Faculty of Medicine, Clinical and Experimental Sciences, Southampton General Hospital, Southampton SO16 6YD, UK d OptiGene Ltd., Unit 5, Blatchford Road, Horsham, RH13 5QR, UK e Health Protection Agency, Southampton General Hospital, Southampton SO16 6YD, UK b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 25 November 2014 Accepted 17 December 2014 Available online xxx

Isothermal amplification is a rapid, simple alternative to PCR, with amplification commonly detected using fluorescently labelled oligonucleotide probes, intercalating dyes or increased turbidity as a result of magnesium pyrophosphate generation. SNP identification is possible but requires either allele-specific primers or multiple dye-labelled probes, but further downstream processing is often required for allelic identification. Here we demonstrate that modification of common isothermal amplification methods by the addition of HyBeacon probes permits homogeneous sequence detection and discrimination by melting or annealing curve analysis. Furthermore, we demonstrate that isothermal amplification and sequence discrimination is possible directly from a crude sample such as an expressed buccal swab. © 2014 Published by Elsevier Ltd.

Keywords: HyBeacons Isothermal amplification Probes LAMP SMAP CPA

1. Introduction In recent years isothermal amplification technologies have emerged as a potential alternative to PCR, and have been integrated into protocols on several commercial platforms e.g. transcription mediated amplification (TMA) [1] as used in the Aptima Combo 2 for CT/NG assay (Hologic), as used with the Panther automated system [2]. Isothermal amplification methods may be particularly suitable for simpler instrumentation with both lower power requirements than thermal cyclers, and also less sophisticated heat induction and dissipation engineering than is currently required for PCR. Many isothermal amplification technologies are currently available. These are generally capable of amplifying a specific target of interest, but often lack the ability to target multiple sequence variants simultaneously, making it difficult, for example, to

* Corresponding author. E-mail address: [email protected] (P.G. Debenham). 1 These authors contributed equally to this work.

incorporate a synthetic DNA template as an internal positive control (IPC) into a pathogen detection assay, or to detect more than one allele of a SNP target in a single reaction tube. Fluorescent oligonucleotide probes can be used to detect targets amplified with isothermal methods, such as Padlock probes with Rolling Circle Amplification (RCA), molecular beacons with Nucleic acid sequence based amplification (NASBA) and fluorescence energy transfer probes with Strand Displacement Amplification (SDA) [3e5]. Many isothermal amplification technologies, such as LoopMediated Isothermal Amplification (LAMP) [6,7], rely on 50 -30 exonuclease deficient polymerases so are not directly compatible with 50 nuclease assays. However, TaqMan probes have been used successfully with Helicase-Dependent Amplification (HDA) [8]. In this study we demonstrate that HyBeacon® probes can be successfully incorporated into isothermal reactions, and can be used to detect both alleles of a Single Nucleotide Polymorphism (SNP) or a pathogen and its corresponding IPC. HyBeacons are single-stranded oligonucleotides with one or more internal bases labelled with a fluorescent dye. They provide a simple means of sequence specific detection of amplified targets

http://dx.doi.org/10.1016/j.mcp.2014.12.001 0890-8508/© 2014 Published by Elsevier Ltd.

Please cite this article in press as: Howard RL, et al., Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.12.001

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YMCPR1105_proof ■ 29 December 2014 ■ 2/7

2

R.L. Howard et al. / Molecular and Cellular Probes xxx (2014) 1e7

using melting curve analysis [9,10]. Annealing curve analysis, which records the gain in fluorescence caused by the annealing of a HyBeacon probe to its target, can also be used. HyBeacon probes can detect multiple variants of a given sequence and have also been effectively used in multiplexes of up to six colours [11]. HyBeacon probes are commonly used for sequence detection within a PCR reaction and have been demonstrated to be suitable for molecular diagnostics [12]. To demonstrate the suitability of HyBeacon probes for use with isothermal amplification technologies, we selected three such methods for evaluation. The three selected amplification methods, LAMP [6,7] (Eiken Chemical Co. Japan), SmartAmp [13] (SMAP, Riken, Japan) and Cross-Priming Amplification [14] (CPA, BioUstar, China) each utilise a strand displacement DNA polymerase in combination with four to six primers to achieve rapid, specific amplification. LAMP is commonly used as a turbidity assay, where amplification results in the generation of a magnesium pyrophosphate precipitate. LAMP and SMAP can also be carried out in the presence of an intercalating dye to generate ‘real-time’ curves as a product is amplified. Less commonly, melting curve analysis (MCA) is carried out to demonstrate amplification of a specific product. Dye-based LAMP assays have previously been used to specifically amplify high concentration pathogen species in as little as 10e30 min [15,16]. CPA uses up to eight primers, including fluorescently-labelled oligonucleotides that bind 30 to other amplification primers to achieve a greater level of detection specificity [17]. Two labelled reporter oligonucleotides are used to generate a fluorescent signal using FRET. This provides additional target-specificity compared with dye-based methods. Analysis of SNPs using these methods is more difficult to achieve. Allele-specific amplification is possible, as is separate downstream analysis such as enzymatic digestion of amplification products [18] but the development of a homogeneous isothermal genotyping system has not been widely considered. Tanner et al. [19] have reported that multiplex target detection could be achieved with LAMP by making use of a quencher incorporated into the inner priming oligonucleotide. A fluorescently-labelled oligonucleotide complementary to this primer was incorporated into the reaction. Amplification permitted the release of the fluorescentlylabelled oligonucleotide and resulted in a target-specific real-time signal. Although this technology provides great advantages over the currently-used system, the method would be dependent on accurate sequence specific priming and require a different probe colour for each SNP sequence variant. Such discrimination can instead be achieved using end-point analysis and a fluorescent oligonucleotide probe such as a HyBeacon. Melting or annealing curve analysis with a target-specific HyBeacon probe permits the rapid detection of multiple sequence variants with a single probe. We have selected two commonly-used diagnostic and pharmacogenetic targets, namely the Chlamydia trachomatis bacterium and the Vitamin K epoxide reductase 1 (VKORC1) 1639 G > A SNP (rs9923231), to demonstrate the capability of HyBeacon probes with isothermal amplification methods for clinical diagnostics. C. trachomatis is a particularly attractive target for diagnostics since it is the most common sexually transmitted bacterial pathogen (over 200,000 cases annually in the UK alone [20]) and is easily and cheaply treated using antibiotics. VKORC1 is also a common diagnostic target, since it is one of the genetic contributors dictating response to oral anticoagulants such as warfarin, acenocoumarol and phenprocoumon. The VKORC11639 SNP along with the CYP2C9*2 and CYP2C9*3 markers account for about 40% of the variability in response to coumarin dosing regimes [21]. It is essential that the correct dose of coumarin is prescribed as quickly as possible to minimise the possibility of both blood clots and excessive bleeding [22].

This paper describes the incorporation of HyBeacon probes into homogeneous reaction mixes for the LAMP, SMAP and CPA methods. The paper further demonstrates not only the discrimination of C. trachomatis DNA from a co-amplified synthetic control sequence, but also the simultaneous detection of both alleles of the 1639 G > A VKORC1 SNP target using the LAMP methodology. 2. Methods 2.1. C. trachomatis target sequences Sequence alignment of 24 strains of C. trachomatis was carried out using the MEGA V.5 software [23] to identify conserved sequences in the C. trachomatis genome. The genomic target selected (Supplementary Information) was completely conserved within all aligned C. trachomatis strains. The sequence was also distinct from those of other related organisms, e.g. Chlamydia pneumoniae, ensuring specific amplification of C. trachomatis. An IPC was designed for the C. trachomatis target sequence. The IPC was homologous to genuine C. trachomatis amplification targets but contained a single base mismatch under the probe target site (Supplementary Information). Clones of these sequences were ordered from GenScript (Piscataway, NJ, USA). IPCs are used to determine whether a negative reaction is due to the absence of C. trachomatis or caused by test failure. IPC targets can also be used to investigate test performance and carry-over of inhibitors with crude and extracted samples. 2.2. C. trachomatis elementary body preparation Mouse McCoy cell monolayers were prepared as previously described [24]. Confluent monolayers were inoculated with Elementary Bodies (EBs) of LGV serovar L2, and incubated at 37  C (5% CO2) for 2 h. The medium was then removed and replaced with fresh Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Paisley, UK) (Glutamax, no pyruvate) with 10% foetal bovine serum (FBS), containing 1 mg/ml cyclohexamide and 20 mg/ml gentamicin. Flasks were incubated at 37  C (5% CO2) for 48 h and checked daily for inclusions. Once inclusions were observed in around 90% of cells, EBs were harvested using cell scrapers, centrifuged at 2850 g for 10 min and re-suspended in 2 ml of sterile phosphate buffered saline (PBS). Cells were disrupted by vortexing in the presence of glass beads for 1 min. Cell debris was removed by centrifugation for 5 min at 230  g. The supernatant was mixed 1:1 with 4  sucrose phosphate buffer (4SP; 16 mM Na2HPO4 and 0.4 M sucrose) and stored at 70  C. 2.3. DNA preparation Crude DNA extracts were prepared by adding ammonia (0.88 sp. gr.) to 10% (v/v), and incubating at 95  C (lids open) in a heat block for 50 min, or until all liquid had evaporated. DNA was resuspended by addition of sterile, DNAse-free water equalling the original volume of EBs used. This DNA was then quantified using a qPCR assay targeting the omcB gene, as previously described [25]. 2.4. Samples 1 ng/ml aliquots of extracted Chlamydia DNA were stored at 20  C. Serial dilutions of 1 ng/ml DNA stocks were prepared with nuclease-free tissue culture water (Sigma Aldrich, Dorset, UK) and 500 ng/ml carrier RNA (Qiagen, UK) immediately before use. Synthesised IPC plasmid was quantified using a Nanodrop 1000 Spectrophotomer (Thermo Scientific, Asheville, NC) and serially

Please cite this article in press as: Howard RL, et al., Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.12.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YMCPR1105_proof ■ 29 December 2014 ■ 3/7

R.L. Howard et al. / Molecular and Cellular Probes xxx (2014) 1e7

diluted to 105 copies/ml in nuclease-free water and 500 ng/ml carrier RNA. Buccal swab samples were provided by donors whose VKORC1 genotypes had been previously determined using a PCR-based HyBeacon method [12]. Appropriate consent was obtained and studies carried out in accordance with the Data Protection Act 1998. Donors provided buccal samples using Steriswabs (Medical Wire & Equipment Co., Corsham, UK). For the analysis of unpurified samples, swabs were vortexed briefly at high speed in 500 ml of tissue culture water to release buccal cells. Extracted human genomic DNA samples were obtained from the ECACC Human Random Control DNA panel (HRC-5) plate (Sigma Aldrich, Dorset, UK). 2.5. Isothermal amplification Primers were supplied by Eurofins Genomics (Ebersberg, Germany) and HyBeacon probes were synthesised by ATDBio (Southampton, UK) as previously described [11]. Oligonucleotide sequences and concentrations for LAMP, SMAP and CPA methods are detailed in Table 1. LAMP reaction volumes were 25 ml containing 2 ml sample, 1  Isothermal Master Mix (No Dye) (Optigene Ltd., Horsham, West Sussex) and two additional units of Geobacillus sp. enzyme (OptiGene Ltd., Horsham, West Sussex). LAMP reactions contained six primers and one probe. SMAP and CPA reaction volumes were 25 ml containing 2 ml extracted C. trachomatis DNA and 1  Isothermal Master Mix (No Dye) (Optigene Ltd., Horsham, West Sussex). Five primers and one probe were used per reaction. Isothermal amplification using the three methods was carried out at 65  C for 30e75 min. Both Melting and Annealing Curve Analysis were used for sequence detection. Melting Curve Analysis is the more commonly-used technique, but Annealing Curve Analysis does not require rapid cooling, and is therefore more suitable for use with instruments specifically designed for isothermal use. Annealing curve analysis using a CFX96 Real-Time PCR Detection System (Bio-Rad, Hemel Hempstead, UK) was from 95  C to 35  C using 0.5  C increments and hold step durations of 5 s. Melting curve analysis was from 35  C to 70  C using 0.5  C increments with hold step durations of 5 s. Fluorescence detection was carried out at each hold step. Melting and annealing peaks

3

were constructed using the CFX software by plotting the negative derivative of fluorescence with respect to temperature (-d(RFU)/dT on the y-axis) against temperature (x-axis). 3. Results and discussion 3.1. Isothermal detection of C. trachomatis HyBeacon probes are commonly used to detect the amplified target sequence between the two primers of a PCR reaction. In order to convert the isothermal amplification technologies for use with HyBeacon probes, a similar target region towards the centre of each amplicon was selected avoiding the positions of isothermal primers (primer and probe sequences are listed in Table 1). A fluorescein-labelled probe was designed to be fully complementary to the selected C. trachomatis target sequence. In the case of the LAMP (Fig. 1A) and SMAP (Fig. 1B) reactions, the HyBeacon probe was positioned between the two innermost primers. In the CPA method, the extending and non-extending reporter oligonucleotides were replaced with a standard primer and HyBeacon probe respectively (Fig. 1C). Amplification speed and specificity were each initially determined using EvaGreen intercalating dye (Biotium Inc., Hayward, CA). Sensitivity experiments suggested that amplification using SMAP and CPA methods was less efficient than that of LAMP, where a dilution series of 1 ng/ml to 1 pg/ml C. trachomatis DNA (approximate test input of 1.8  105e1.8  102 genomic copies) required an amplification time of 75 min for SMAP and CPA to reliably detect the lowest concentration input. LAMP reactions were demonstrated to be capable of detecting all sample dilutions after a 30-min amplification. Following optimisation of amplification methods, HyBeacon probes were incorporated into SMAP, CPA and LAMP reactions. Amplification was followed immediately by annealing curve analysis to permit target detection and identification using the HyBeacon probe. The C. trachomatis IPC demonstrated the ability of HyBeacon probes to discriminate single nucleotide sequence differences within target sequences amplified by isothermal methods. A singlebase mismatch between the probe and IPC target resulted in a lower peak melting temperature (Tm) and annealing temperature (Ta) when compared with a fully-hybridised probe, allowing

Table 1 Oligonucleotide sequences of primers and probes used for LAMP, SMAP and CPA, where F, 3 and 5 are fluorescein dT, 30 propanol and 50 trimethoxystilbene, respectively. Oligonucleotide concentrations are presented in mM for each isothermal formulation. The Chlamydia trachomatis and VKORC1 oligonucleotides have “S” and “VK” prefixes, respectively. Name

Sequence

SMAP

CPA

LAMP

S-B3 S-BIP S-F3 S-FIP S-FPF S-LB S-LF S-CPF S-CPR S-IP S-OF S-OR S-HYB VK-FIP VK-BIP VK-F3 VK-B3 VK-LF VK-LB VK-HYB

TCGTGTTCTCCAAGAGTCT GCCTATTGTAGTGCGGAAGAGAATCGGTCTAAGCTTCCTAATTC GTTCACCTCTTTCAACGGT TTGCAGCTCCTTCTCTTGTTCCGTGGAGCAAGCCTTCTTAA CTGCACGTGGGACGTGCAGGTGGAGCAAGCCTTCTTAA AGGCTGTGGAGCAGTTAATC GTATGGCTAAGGAGATTCGCT GATTAACTGCTCCACAGCCTCGGAACAAGAGAAGGAGCTGCAA GGAACAAGAGAAGGAGCTGCAAGATTAACTGCTCCACAGCCTC TCTCTTCCGCACTACAATAGGC AGCGAATCTCCTTAGCCATAC ATCGGTCTAAGCTTCCTAATTC 5GAGCCCCTCTAFAGAAGTFGCTATTG3 CAGGTCTTCTCTTGCTTGACTTCCCCAGAGGAAGAGAGTTCCCAGAAG GCTCACGCCTATAATCCTAGCATTCTTGTCTTAAACTCCTGACCTCAAGT GCCAGCAGGAGAGGGAAATATC GGTTTCACCATGTTGGCCAG CAGAGGGATCCCTTACTGTTGC GAGGCCGAGGTGGGTGGA 5CATFGGCCAGGFGCGGT3

0.2 0.8 0.2 N/A 0.8 0.4 N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A

N/A N/A N/A N/A N/A N/A N/A 0.8 0.8 0.8 0.2 0.2 0.15 N/A N/A N/A N/A N/A N/A N/A

0.8 1.2 0.4 0.8 N/A 0.8 0.4 N/A N/A N/A N/A N/A N/A 1.2 1.6 0.8 0.8 0.8 0.8 0.3

Please cite this article in press as: Howard RL, et al., Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.12.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YMCPR1105_proof ■ 29 December 2014 ■ 4/7

4

R.L. Howard et al. / Molecular and Cellular Probes xxx (2014) 1e7

Fig. 1. Probe Positions. Image depicting the position of the HyBeacon probe as incorporated in A) LAMP, B) SMAP and C) CPA amplification reactions. In each case the probe is located towards the centre of the amplicon. Only the primers adjacent to the HyBeacon probe target are depicted.

discrimination between genuine C. trachomatis and IPC sequence (see Supplementary information). Amplification was carried out using LAMP, SMAP and CPA to detect both C. trachomatis DNA and the IPC targets. Distinct annealing curves and peak derivatives were generated using each of the three methods, with C. trachomatis annealing peaks observed at 60e62  C and IPC targets detected at 54e56  C (Fig. 2). Comparable results were generated with melting curve analysis (data not shown). HyBeacon probes confer a greater degree of assay specificity compared with detection using intercalating dye or allele-specific labelled/quenched priming oligonucleotides. HyBeacon probes target the specific sequence of the correctly amplified product but do not detect non-specific amplification or primer dimers. This is especially important in clinical diagnostics, where it is essential that only the sequence of interest is detected and reported. Incorporation of HyBeacons into LAMP, SMAP and CPA using 1 ng of C. trachomatis DNA generated highly-specific annealing curves and derivative peaks with all three methods. Extracted C. pneumoniae DNA (Strain CWL-029, ATCC, LGC Standards, Teddington, UK) present at equal concentration was not detected using these methods (Fig. 2). An investigation of detection sensitivity for each isothermal method was performed using HyBeacon probe annealing curve analysis. A summary of assay sensitivity is presented in Table 2. SMAP and CPA amplification carried out for 75 min detected the C. trachomatis target efficiently when input was at a sufficiently high concentration. Target detection for CPA was reliable with a

Fig. 2. Specificity of isothermal detection. HyBeacon annealing peaks derived from amplification of Chlamydia genomic DNA and synthetic IPC targets. Input was approximately 105 copies of Chlamydia trachomatis DNA (red), lPC (blue) and Chlamydia pneumoniae (purple) using A) LAMP B) SMAP and C) CPA with the conditions described in the Methods section. In all three cases specific detection of Chlamydia trachomatis and IPC was achieved. Chlamydia pneumoniae was not detected by the HyBeacon indicating that the isothermal methods are specific for targets of interest. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Table 2 Results of studies to determine the sensitivity of isothermal amplification methods used in combination with HyBeacon probes. Each DNA concentration was replicated six times and tested using the LAMP, SMAP and CPA assays. The number of positive results for each method is listed with the mean height of CFX annealing peaks presented in parentheses. DNA concentration Target copies LAMP

SMAP

CPA

1 ng/ml 100 pg/ml 10 pg/ml 1 pg/ml 100 fg/ml 10 fg/ml

6/6 (947.69) 6/6 (1058.59) 5/6 (740.27) 0/6 0/6 0/6

6/6 (2252.61) 4/6 (1335.10) 1/6 (1824.99) 0/6 0/6 0/6

1.8 1.8 1.8 1.8 18 1.8

   

105 104 103 102

6/6 6/6 6/6 6/6 6/6 0/6

(1890.98) (1949.96) (1963.34) (1924.07) (1923.55)

Please cite this article in press as: Howard RL, et al., Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.12.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YMCPR1105_proof ■ 29 December 2014 ■ 5/7

R.L. Howard et al. / Molecular and Cellular Probes xxx (2014) 1e7

2 ng input of DNA (1.8  105 genomic copies) and SMAP with 200 pg DNA (1.8  104 genomic copies), but detection at lower concentrations was sporadic. Detection using LAMP, using 30 min of amplification, was reproducible with 200 fg DNA (approximately 18 genomic copies) (Table 2). These LAMP results therefore indicate a sensitivity only one order of magnitude below that commonly achievable using PCR. By using multiple different coloured HyBeacon probes [11], additional diagnostic targets can be simultaneously amplified [26], permitting detection of multiple organisms or multiple sites within an organism if necessary. 3.2. Isothermal analysis of SNPs The combination of isothermal amplification and HyBeacon probes provides a method to detect multiple sequence variants within a single tube. A single HyBeacon probe can be used to identify multiple alleles of a target sequence [12] as well as for more complex applications such as determining the length of Short Tandem Repeats (STRs) [27]. To demonstrate that HyBeacon probes are able to generate equivalent data in an isothermal system, LAMP primers were designed around a probe targeting the VKORC1-1639 SNP (Table 1). The VKORC1 LAMP assay was evaluated with extracted DNA samples and an unextracted buccal swab. The buccal swab was expressed in water (see Methods section) and 2 ml added directly to a LAMP reaction as described above. Amplification was carried out with 10, 15, 20, 25 or 30 min incubation at 65  C followed by melting curve analysis between 35 and 70  C. A homozygous G/G buccal swab and heterozygous G/A extracted DNA sample were tested with each LAMP duration (Fig. 3). The VKORC1 probe is fully complementary to the A allele and generates melting peaks at approximately 57  C, whereas the mismatched G allele generates melting peaks at approximately 47  C. Homozygous A/A and G/G samples generate only 57  C or 47  C peaks, respectively. Heterozygous G/A samples yield both 57  C and 47  C peaks [12], while no template controls (NTCs) generate neither peak. High quality peaks were also generated using annealing curve analysis (data not shown). The buccal swab and extracted DNA samples were genotyped correctly using the LAMP method (Fig. 3). The success of the LAMP genotyping method depended on the duration of isothermal amplification. No melting peaks were observed with 10 min of amplification. VKORC1 targets were

Fig. 3. VKORC1 data. Melting peaks derived from LAMP amplification of the VKORC11639 SNP target. A heterozygous extracted DNA sample (red) generates melting peaks at 47  C and 57  C with G and A alleles, respectively. A homozygous G/G buccal swab (blue) generates only the 47  C peak. A No Template Control reaction is presented for comparison (black). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

5

detected after 15 and 20 min with extracted DNA (1 ng input) and buccal swab samples, respectively. However, at least 25 min of LAMP amplification was required to clearly identify the heterozygous genotype of the extracted DNA sample and generate an equal balance of allele melting peaks (Fig. 4). The unextracted buccal swab sample required 30 min incubation at 65  C to reliably amplify the VKORC1 target. It is anticipated that direct detection of isothermal amplification using HyBeacons could be extended to a wide variety of sample types, since isothermal enzymes have been demonstrated to be less sensitive to inhibitors than those used in PCR. LAMP has been demonstrated to be compatible with direct amplification from a wide variety of samples including detection of herpes virus variants from both human serum [28,29]. Analysis of 1 ng of human genomic DNA (containing approximately 152 copies of each VKORC1 allele) requires at least 25 min of isothermal amplification. This is comparable to the test speeds achievable with PCR [10]. Analysis of 250 pg of human genomic DNA (containing approximately 38 copies of each VKORC1 allele) was less robust, with allele drop-out observed with the heterozygous sample (Fig. 4). Whilst LAMP is an extremely rapid method for the detection of abundant targets, with detection possible within 10e15 min, amplification is delayed with samples containing less than 103 target copies. Nixon et al. [30] demonstrate the delayed and variable detection times below 103 copies using a quantitative LAMP assay designed to detect human cytomegalovirus. Buccal swabs expressed in 500 ml of water have been found to contain the equivalent of approximately 1 ng/ml DNA in real-time PCR studies (see Supplementary information). With LAMP amplification, however, the same buccal swab appears to be detected less efficiently than the 250 pg extracted DNA. The hot start and cycling denature steps used by PCR (heating to at least 95  C) could assist the analysis of unextracted samples, by possibly lysing the buccal cells and increasing the availability of template DNA. 4. Conclusions HyBeacon probes are readily compatible with the LAMP, SMAP and CPA isothermal amplification methods and it is expected that the incorporation of HyBeacon probes would extend to other isothermal nucleic acid amplification methods. Furthermore, HyBeacons confer an additional advantage, for the isothermal systems tested here, over current detection methods using intercalating dye, turbidity and allele-specific priming since probes permit analysis of polymorphic target sequences with single colour discrimination of multiple sequence variants. As with PCR, isothermal amplification efficiency and target detection is not limited by the HyBeacon probes, but by both the amplification method and original target concentration. Detection of high copy numbers of target DNA (i.e. 105 copies) can be achieved in 10e15 min using the LAMP method [31] but lower concentration samples and test multiplexing require longer amplification protocols before detection can be achieved. These findings concur with previous observations which also suggest that LAMP detection is slower with low concentration samples and that the isothermal method is less sensitive than PCR [29,30,32,33]. PCR is typically robust and reliable down to the 1e10 copy input level, while the sensitivity with LAMP appears to be an order of magnitude lower. In combination with appropriate sampling and rapid amplification methods, HyBeacon probes provide a rapid testing method for many diagnostic applications including point-of-care patient genotyping and disease diagnosis. Whilst probe based isothermal assays have been reported for target detection [3e5,8], HyBeacon probes are capable of simultaneously detecting multiple sequence

Please cite this article in press as: Howard RL, et al., Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.12.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YMCPR1105_proof ■ 29 December 2014 ■ 6/7

6

R.L. Howard et al. / Molecular and Cellular Probes xxx (2014) 1e7

Fig. 4. Variation in amplification time. Detection of LAMP-amplified VKORC1 targets using A) 15 min, B) 20 min, C) 25 min and D) 30 min of amplification at 65  C. Detection of 1 ng extracted DNA (red) is achieved after 15 min of amplification, but 25 min is required to assign a heterozygous genotype. Analysis of 250 pg extracted DNA (green) results in allele drop-out and imbalanced melting peaks with 25e30 min of amplification. An expressed and unextracted buccal swab (blue) requires 20e25 min of isothermal amplification to achieve target detection but needs 30 min to generate suitable melting peaks for interrogation of the VKORC1 polymorphism. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

variants, providing the potential for homogeneous SNP genotyping. Isothermal analysis could be further multiplexed using probes labelled with different dye-labels (for example JOE, Texas Red and Cy5 [11]) to allow the detection of two or more targets. A single reaction tube might therefore be capable of not only detecting the C. trachomatis target described, but also Neisseria gonorrhoea (a common co-infecting organism, which most commercial molecular diagnostic assays now routinely multiplex with C. trachomatis) and other sexually transmitted infections along with appropriate internal positive controls. LAMP is reported to be more resistant to selected inhibitors than PCR, for example ethanol, untreated biological samples (stool and urine) and plant and soil derived inhibitors [34e37]. However, LAMP is less tolerant to other inhibitors, such as Potassium EDTA, than PCR [30]. Isothermal amplification could improve detection with some unextracted sample types assuming they contain a sufficient number of target copies. Incorporating a HyBeacon probe into an isothermal amplification reaction would provide a costeffective solution for clinical diagnostics, especially where expensive real-time PCR instrumentation is prohibitive. Author contributions Rebecca L Howard, David J French, James A Richardson and Colette E O'Neill designed and conducted the experiments and authored the manuscript. Michael P Andreou, Tom Brown, Duncan Clark, Ian N Clarke, John W Holloway and Peter Marsh designed the experiments and reviewed the manuscript. Paul G Debenham managed the project, designed the experiments and reviewed the manuscript.

Acknowledgements This research was funded in part by the UK Technology Strategy Q1 Board and the EPSRC via grant ref: TS/I000666/1. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.mcp.2014.12.001. References [1] Goessens WH, Mouton JW, van der Meijden WI, Deelen S, van Rijsoort-Vos TH, Lemmens-den Toom N, et al. Comparison of three commercially available amplification assays, AMP CT, LCx, and COBAS AMPLICOR, for detection of Chlamydia trachomatis in first-void urine. J Clin Microbiol 1997 Oct;35(10): 2628e33. [2] Golparian D, Tabrizi SN, Unemo M. Analytical specificity and sensitivity of the APTIMA Combo 2 and APTIMA GC assays for detection of commensal Neisseria species and Neisseria gonorrhoeae on the Gen-Probe Panther instrument. Sex Transm Dis 2013 Feb;40(2):175e8. r J, Nilsson M, Mendel-Hartvig M, Landegren U. Signal amplification of [3] Bane padlock probes by rolling circle replication. Nucleic Acids Res 1998;26: 5073e8. [4] Leone G, van Schijndel H, van Gemen B, Kramer FR, Schoen CD. Molecular beacon probes combined with amplification by NASBA enable homogeneous, real-time detection of RNA. Nucleic Acids Res 1998 May 1;26(9):2150e5. [5] Little MC, Andrews J, Moore R, Bustos S, Jones L, Embres C, et al. Strand displacement amplification and homogeneous real-time detection incorporated in a second-generation DNA probe system, BDProbeTecET. Clin Chem 1999 Jun;45(6 Pt 1):777e84. [6] Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000 Jun 15;28(12):E63. [7] Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes 2002 Jun;16(3):223e9.

Please cite this article in press as: Howard RL, et al., Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.12.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

YMCPR1105_proof ■ 29 December 2014 ■ 7/7

R.L. Howard et al. / Molecular and Cellular Probes xxx (2014) 1e7 [8] Tong Y, Tang W, Kim HJ, Pan X, Ranalli T, Kong H. Development of isothermal TaqMan assays for detection of biothreat organisms. Biotechniques 2008 Nov;45(5):543e57. http://dx.doi.org/10.2144/000112959. [9] French DJ, Archard CL, Brown T, McDowell DG. HyBeacon probes: a new tool for DNA sequence detection and allele discrimination. Mol Cell Probes 2001 Dec;15(6):363e74. [10] French DJ, Archard CL, Andersen MT, McDowell DG. Ultra-rapid DNA analysis using HyBeacon probes and direct PCR amplification from saliva. Mol Cell Probes 2002 Oct;16(5):319e26. [11] Richardson JA, Gerowska M, Shelbourne M, French D, Brown T. Six-colour HyBeacon probes for multiplex genetic analysis. ChemBioChem 2010 Dec 10;11(18):2530e3. http://dx.doi.org/10.1002/cbic.201000623. [12] Howard R, Leathart JB, French DJ, Krishan E, Kohnke H, Wadelius M, et al. Genotyping for CYP2C9 and VKORC1 alleles by a novel point of care assay with HyBeacon® probes. Clin Chim Acta 2011 Nov 20;412(23e24):2063e9. http://dx.doi.org/10.1016/j.cca.2011.07.013 [Epub 2011 Jul 29]. [13] Lezhava A, Hayashizaki Y. Detection of SNP by the isothermal smart amplification method. Methods Mol Biol 2009;578:437e51. http://dx.doi.org/ 10.1007/978-1-60327-411-1_28. [14] Xu G, Hu L, Zhong H, Wang H, Yusa S, Weiss TC, et al. Cross priming amplification: mechanism and optimization for isothermal DNA amplification. Sci Rep 2012;2:246. http://dx.doi.org/10.1038/srep00246 [Epub 2012 Feb 3]. [15] Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M. Loop-mediated isothermal amplification for the rapid detection of Salmonella. FEMS Microbiol Lett 2005 Dec 1;253(1):155e61 [Epub 2005 Oct 7]. [16] Dukes JP, King DP, Alexandersen S. Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch Virol 2006 Jun;151(6):1093e106 [Epub 2006 Feb 2]. [17] Fang R, Li X, Hu L, You Q, Li J, Wu J, et al. Cross-priming amplification for rapid detection of Mycobacterium tuberculosis in sputum specimens. J Clin Microbiol 2009 Mar;47(3):845e7. http://dx.doi.org/10.1128/JCM.01528-08 [Epub 2008 Dec 30]. [18] Yoshida N, Fujino M, Ota Y, Notomi T, Nakayama T. Simple differentiation method of mumps Hoshino vaccine strain from wild strains by reverse transcription loop-mediated isothermal amplification (RT-LAMP). Vaccine 2007 Jan 26;25(7):1281e6 [Epub 2006 Oct 18]. [19] Tanner NA, Zhang Y, Evans Jr TC. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques 2012 Aug;53(2):81e9. http://dx.doi.org/10.2144/0000113902. [20] UK Health Protection Agency, http://www.hpa.org.uk/webc/HPAwebFile/ HPAweb_C/1317132033760. [21] Sconce EA, Khan TI, Wynne HA, Avery P, Monkhouse L, King BP, et al. The impact of CYP2C9 and VKORC1 genetic polymorphism and patient characteristics upon warfarin dose requirements: proposal for a new dosing regimen. Blood 2005 Oct 1;106(7):2329e33 [Epub 2005 Jun 9]. [22] Pirmohamed M, Burnside G, Eriksson N, Jorgensen AL, Toh CH, Nicholson T, et al., EU-PACT Group. A randomized trial of genotype-guided dosing of warfarin. N Engl J Med 2013 Dec 12;369(24):2294e303. http://dx.doi.org/ 10.1056/NEJMoa1311386 [Epub 2013 Nov 19. PubMed PMID: 24251363]. [23] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011 Oct;28(10):2731e9. http://dx.doi.org/10.1093/molbev/msr121 [Epub 2011 May 4]. [24] O'Neill CE, Seth-Smith HM, Van Der Pol B, Harris SR, Thomson NR, Cutcliffe LT, et al. Chlamydia trachomatis clinical isolates identified as tetracycline resistant do not exhibit resistance in vitro: whole-genome sequencing reveals a

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

7

mutation in porB but no evidence for tetracycline resistance genes. Microbiology 2013 Apr;159(Pt 4):748e56. http://dx.doi.org/10.1099/mic.0.065391-0. Pickett MA, Everson JS, Pead PJ, Clarke IN. The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents. Microbiology 2005 Mar;151(Pt 3):893e903. Howard R, Andreou M, Brown T, Clark D, Clarke I, French D, Holloway J, Marsh P, O'Neill C, Richardson J and Debenham P. Comparison of isothermal amplification methods using HyBeacon™ probes for point-of-care detection of Chlamydia trachomatis. Poster Presentation, molecular diagnostics Europe, 10th-11th may 2012, London, UK. French DJ, Howard RL, Gale N, Brown T, McDowell DG, Debenham PG. Interrogation of short tandem repeats using fluorescent probes and melting curve analysis: a step towards rapid DNA identity screening. Forensic Sci Int Genet 2008 Sep;2(4):333e9. http://dx.doi.org/10.1016/j.fsigen.2008.04.007 [Epub 2008 Jun 10]. Yoshikawa T, Matsuo T, Kawamura Y, Ohashi M, Yonekawa T, Kanda H, et al. Direct detection of human herpesvirus 6B by the LAMP method using newly developed dry-reagents. J Virol Methods 2014. http://dx.doi.org/10.1016/ j.jviromet.2014.02.017. Wo zniakowski G, Samorek-Salamonowicz E. Direct detection of Marek's disease virus in poultry dust by loop-mediated isothermal amplification. Arch Virol 2014;159:3083e7. Nixon G, Garson JA, Grant P, Nastouli E, Foy CA, Huggett JF. Comparative study of sensitivity, linearity, and resistance to inhibition of digital and nondigital polymerase chain reaction and loop mediated isothermal amplification assays for quantification of human cytomegalovirus. Anal Chem 2014;86:4387e94. Bühlmann A, Pothier JF, Rezzonico F, Smits TH, Andreou M, Boonham N, et al. Erwinia amylovora loop-mediated isothermal amplification (LAMP) assay for rapid pathogen detection and on-site diagnosis of fire blight. J Microbiol Methods 2013 Mar;92(3):332e9. Ou SC, Giambrone JJ, Macklin KS. Comparison of a TaqMan real-time polymerase chain reaction assay with a loop-mediated isothermal amplification assay for detection of Gallid herpesvirus 1. J Vet Diagn Invest 2012 Jan;24(1): 138e41. http://dx.doi.org/10.1177/1040638711427578 [Epub 2011 Dec 6]. Yang BC, Wang FX, Zhang SQ, Song N, Li JX, Yang ZQ, et al. Comparative evaluation of conventional polymerase chain reaction (PCR), with loopmediated isothermal amplification and SYBR green I-based real-time PCR for the quantitation of porcine circovirus-1 DNA in contaminated samples destined for vaccine production. J Virol Methods 2013 Jul;191(1):1e8. http:// dx.doi.org/10.1016/j.jviromet.2013.03.014 [Epub 2013 Mar 26]. Kiddle G, Hardinge P, Buttigieg N, Gandelman O, Pereira C, McElgunn CJ, et al. GMO detection using a bioluminescent real time reporter (BART) of loop mediated isothermal amplification (LAMP) suitable for field use. BMC Biotechnol 2012 Apr 30;12:15. http://dx.doi.org/10.1186/1472-6750-12-15. Francois P, Tangomo M, Hibbs J, Bonetti EJ, Boehme CC, Notomi T, et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunol Med Microbiol 2011 Jun;62(1):41e8. http://dx.doi.org/10.1111/j.1574-695X.2011.00785.x [Epub 2011 Mar 16]. Peng J, Zhang H, Chen F, Zhang X, Xie Y, Hou X, et al. Rapid and quantitative detection of Fusarium oxysporum f. sp. cubense race 4 in soil by real-time fluorescence loop-mediated isothermal amplification. J Appl Microbiol 2014 Sep 9. http://dx.doi.org/10.1111/jam.12645. Kaneko H, Kawana T, Fukushima E, Suzutani T. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J Biochem Biophys Methods 2007 Apr 10;70(3):499e501 [Epub 2006 Aug 30].

Please cite this article in press as: Howard RL, et al., Rapid detection of diagnostic targets using isothermal amplification and HyBeacon probes e A homogenous system for sequence-specific detection, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/j.mcp.2014.12.001

48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94