Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification

G Model

ARTICLE IN PRESS

VIRMET 12618 1–6

Journal of Virological Methods xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification

1

2

3

Q1

4 5 6

Zhixun Guo a,∗ , Di Zhang a,b , Hongling Ma a , Youlu Su a , Juan Feng a , Liwen Xu a a Key Laboratory of Aquatic Product Processing, Ministry of Agriculture, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, China b College of Fisheries and Life Sciences, Shanghai Ocean University, Shanghai 201306, China

7

a b s t r a c t

19 8 9 10 11 12 13

Article history: Received 30 January 2014 Received in revised form 17 August 2014 Accepted 19 August 2014 Available online xxx

14

18

Keywords: Scylla paramamosain Mud crab dicistrovirus-1 Loop-mediated isothermal amplification

20

1. Introduction

15 16 17

Mud crab dicistrovirus-1 (MCDV-1) was isolated from the mud crab (Scylla paramamosain), resulting in mass mortality and widespread economic loss in China. In this study, a detection method for MCDV-1 using loop-mediated isothermal amplification was developed. Two pairs of primers targeting the VP2 gene were designed. These primers were the outer primers F3 and B3, and the inner primers FIP and BIP. Optimal amplification was carried out using 0.2 ␮mol/L F3/B3, 1.6 ␮mol/L FIP/BIP, 6 mmol/L Mg2+ , 0.8 mmol/L dNTPs, and 0.8 mol/L betaine, and completed in 1 h at 62 ◦ C. The products demonstrated a ladder pattern on agarose gel electrophoresis and could also be detected visually according to turbidity, or by adding SYBR Green I and observing a color change from orange to green. The proposed method could specifically amplify MCDV-1 gene fragments. Sensitivity assay revealed that six copies of the viral genome could be detected by this method, which was 1000-fold more sensitive than that of conventional PCR using constructed plasmid as amplification template. At clinical sample level, sensitivity of LAMP was 100-fold higher than that of conventional PCR. © 2014 Published by Elsevier B.V.

The mud crab (Scylla paramamosain), previously identified as Scylla serrata (Lin et al., 2007), is widely cultivated along the coast 22 in South China, with a production that exceeded 128 thousand tons 23 in 2012 (China Fishery Statistical Yearbook, 2013). However, with 24 the expansion of intensive culture, various diseases have occurred 25 frequently and severely affected production. Among the causes 26 27Q3 of these diseases, mud crab dicistrovirus-1 (MCDV-1) possesses a linear positive-sense ssRNA genome with a length of 10,415 28 nucleotides excluding the 3 poly(A) tail; MCDV-1 has been offi29 cially named mud crab virus (MCV) in 2012 by the International 30 Committee on Taxonomy of Viruses (Adams and Carstens (2012)). 31 This virus usually accompanies the mud crab reovirus (MCRV) in 32 mud crabs, and can cause 100% mortality alone under artificial 33 infection. Mud crabs seriously infected by the virus show clinical 34 signs similar to diseased crabs in ponds, such as lack of appetite, 35 no response to touch using a stick, and staying in the surface 36 of sand during daytime (Guo et al., 2012). Accurate and efficient 37 21Q2

∗ Corresponding author at: South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, China. Tel.: +86 20 89022636. E-mail address: [email protected] (Z. Guo).

detection of pathogens is essential for forecasting and controlling their spread. As of this writing, reports on detection methods for MCDV-1 are limited. An ELISA method has been used to detect the existence of MCDV-1 (Zhang et al., 2010), whereas RT-PCR has been used for MCDV-1 gene detection (Guo et al., 2012; Zhang et al., 2013). However, the ELISA method has complex operation steps and a long test cycle. PCR has several intrinsic disadvantages, such as the requirement of rapid thermal cycling, insufficient specificity, limited sensitivity, and time consuming. A much more rapid, specific, and sensitive method of virus detection, namely, loopmediated isothermal amplification (LAMP), is currently extensively used in research (Kono et al., 2004; Curtis et al., 2008; Chen et al., 2011; Fan et al., 2012). LAMP technology emerged in 2000 as an in vitro amplification of specific DNA fragments (Notomi et al., 2000). By combining reverse transcription reactions, this technology can also be used with RNA templates, such as RNA virus (Notomi et al., 2000). The LAMP reaction can be conducted under isothermal conditions around 63 ◦ C. The single reaction temperature and low reaction time of less than 1 h make this method simple. A set of two specially designed inner and outer primers that recognize six distinct sequences on the target gene guarantees its specificity. Continuous amplification without thermal cycling produces large amounts of stem-loop DNAs with several inverted repeats of the target gene, which

http://dx.doi.org/10.1016/j.jviromet.2014.08.014 0166-0934/© 2014 Published by Elsevier B.V.

Please cite this article in press as: Guo, Z., et al., Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2014.08.014

38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61

G Model

ARTICLE IN PRESS

VIRMET 12618 1–6

Z. Guo et al. / Journal of Virological Methods xxx (2014) xxx–xxx

2

Fig. 1. Optimization of the LAMP reaction for MCDV-1 detection. (A) Temperature: lanes 1–12, 54 ◦ C, 54.7 ◦ C, 55.4 ◦ C, 56.8 ◦ C, 58.4 ◦ C, 60.1 ◦ C, 61.8 ◦ C, 63.5 ◦ C, 65.2 ◦ C, 66.6 ◦ C, 67.3 ◦ C, 68 ◦ C, and 69 ◦ C, respectively; (B) primer ratio: lanes 1–9, ratio of outer to inner primers was 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, and 1:9, respectively; (C) Mg2+ concentration: lanes 1–9, LAMP reaction system contained 2, 4, 6, 8, 10, 12, 14, and 16 mM Mg2+ , respectively; (D) dNTP concentrations: lanes 1–8, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, and 1.6 mM dNTPs, respectively; (E) betaine concentration: lanes 1–8, LAMP reaction system contained 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, and 1.4 M betaine, respectively; (F) reaction time: lanes 1–7, 30, 40, 50, 60, 70, 80, and 90 min, respectively. Table 1 Nucleotide sequence of primers used for LAMP detection.

62 63 64 65 66 67 68 69 70 71

Primer names

Targeted gene

Length

Primer sequence (5 –3 )

F3 B3 FIP BIP

VP2 region VP2 region VP2 region VP2 region

20 20 46 50

TCCTCTTTTATTGCCTCCAA GCTTAACAGATCTTGAGTCG CCAAAGCAAGAGAAGACCCTGAAGA-ATGCGTTGCGATTATGAGTTG TCCTCAATTACTGAACACCTTCGCT-GATTGCATATTAAGTGTGACACCAG

demonstrate a ladder pattern during agarose gel electrophoresis. The by-product of LAMP amplification, magnesium pyrophosphate, enables simple visual judgment of the reaction by a color change of a mixture with fluorescent dye (Iwamoto et al., 2003) or a white turbidity of the by-product (Mori et al., 2001). This study aimed to develop a highly sensitive and rapid method for MCDV-1 detection in mud crab. This research designed four primers according to the conserved VP2 genes of MCDV-1 (Zhang et al., 2011), and evaluated the sensitivity, specificity, and applicability of this MCDV-1 detection method.

72

2. Materials and methods

73

2.1. Primer design

74 75

Two pairs of primers were designed using Primer ExplorerV4 (Eiken Chemical, Japan, http://www.primerexplorer.jp/e/)

according to the nucleotide sequence of the capsid protein 2 (VP2) gene of MCDV-1 (GenBank accession no. HM777507.1). All primers are summarized in Table 1. 2.2. RNA extraction and cDNA synthesis The diseased mud crabs collected from a farm in Yangjiang City (Guangdong Province, China) were detected to be MCDV1 positive by RT-PCR. These crabs were then stored at −80 ◦ C until use. Total RNA was extracted from the gill of mud crabs infected by MCDV-1 using RNAisoTM Plus (Takara Bio Inc., Otsu, Japan), according to the manufacturer’s instructions. The extracted RNA was maintained at −80 ◦ C until use.cDNA synthesis was performed using an M-MLV reverse transcriptase system (Promega, Madison, WI, USA) following the manufacturer’s instructions.

Please cite this article in press as: Guo, Z., et al., Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2014.08.014

76 77 78

79

80 81 82 83 84 85 86 87 88 89

G Model VIRMET 12618 1–6

ARTICLE IN PRESS Z. Guo et al. / Journal of Virological Methods xxx (2014) xxx–xxx

90

2.3. Positive control DNA preparation

100

Plasmids containing the target region of the VP2 gene were constructed for sensitivity assessment and positive control in the LAMP reaction. The target DNA sequence was amplified with primers F3 and B3 using PCR with a PCR mix (Dongsheng, Guangzhou, China), and cloned into the pMD-18T vector (Takara, Otsu, Japan) according to the manufacturer’s instructions. Plasmid DNA purification was performed using a High Purity Plasmid Miniprep Kit (Dongsheng, Guangzhou, China). The nucleotide sequences were sequenced by Invitrogen, and blasted in GenBank to confirm that the target sequences were correct.

101

2.4. Optimization of the LAMP assay

91 92 93 94 95 96 97 98 99

102 103 104 105 106 107 108 109 110 111 112 113 114 115

116

The amplification reaction mixture contained inner primers, outer primers, dNTPs (Dongsheng, Guangzhou, China), and Bst polymerase (New England Biolabs, Ipswich, MA, USA), together with the supplied buffer, distilled water, betaine, MgSO4 , and cDNA or distilled water (blank control) at a final volume of 25 ␮L. The mixture was incubated at 65 ◦ C for 1 h, and terminated by heating at 80 ◦ C for 10 min. For optimization of LAMP amplification, the following parameters were evaluated: ratios of outer and inner primers (1:1–1:9); Mg2+ concentration (2–16 mM, including 2 mM Mg2+ in the buffer); dNTP concentration (0.2–1.6 mM); betaine concentration (0–1.4 M); temperature (54 ◦ C–69 ◦ C), and reaction time (30–90 min). The LAMP products were resolved by electrophoresis in 1.5% agarose gel. 2.5. Observation of the LAMP products

127

The LAMP products were detected by both visual inspection and agarose gel electrophoresis. Approximately 1 ␮L of 1:10 diluted SYBR Green I (10,000×) in DMSO (Invitrogen, Carlsbad, CA, USA) was added into a reaction tube. Visually, a color change from orange to green indicated a positive reaction, whereas any remaining orange color indicated a negative reaction. The color change could be observed by the naked eye under natural light. After amplification, 5 ␮L of amplified product was electrophoresed in 1.5% agarose gel in Tris borate–EDTA buffer (0.09 M Tris borate, 2 mM EDTA), and stained with ethidium bromide. The positive reaction mixtures showed a characteristic ladder of multiple bands.

128

2.6. Specificity assay

117 118 119 120 121 122 123 124 125 126

136

The specificity of LAMP primers was examined using seven other viruses, namely, abalone shriveling syndrome-associated virus (AbSV), acute virus necrobiotic virus (AVNV), infectious hypodermal and hematopoietic necrosis virus (IHHNV), fish nervous necrosis virus (NNV), turbot viral reddish body iridovirus (TRBIV), white spot syndrome virus (WSSV), and MCRV. All the templates, including the MCDV-1 positive and negative templates, were verified by PCR.

137

2.7. Sensitivity assay

129 130 131 132 133 134 135

138 139 140 141 142 143 144 145 146

Tenfold serial dilutions of recombinant plasmid (pMD-18T-dic) or cDNA from clinical tissue samples were used as templates for LAMP and routine PCR to determine their sensitivity. The LAMP results were detected by both agarose gel electrophoresis and SYBR Green I addition. Routine PCR was carried out using outer primer F3/B3 in 20 ␮L reaction volumes that contained 8.0 ␮L of PCR Mix (0.1 U/␮L Taq DNA polymerase, 2× PCR buffer, 0.4 mM dNTPs, 3 mM MgCl2 , 0.02% bromophenol blue) (Dongsheng, Guangzhou, China), 0.5 ␮L of each

3

Table 2 Optimized profile for MCDV-1 LAMP at 62 ◦ C for 60 min. Component

Final concentration

Distilled water 10× ThermoPol reaction buffer 50 mM MgSO4 5 M betaine 10 mM dNTPs 10 ␮M F3 10 ␮M B3 10 ␮M FIP 10 ␮M BIP Bst DNA polymerase 8 U/l cDNA Total

– 1× Thermo Pol reaction buffer 6 mM 0.8 M 0.8 mM 0.2 ␮M 0.2 ␮M 1.6 ␮M 1.6 ␮M 8U

a

≥detect limits –

Volume (␮l) 2.5 2.5 2a 4 2 0.5 0.5 4 4 1 2 25

The reaction buffer contains an additional 2 mM MgSO4 to the final.

primer (10 mM), 9 ␮L of distilled water, and 2.0 ␮L of cDNA. The amplification program was as follows: 5 min at 94 ◦ C, followed by 30 cycles of 94 ◦ C for 40 s, 55 ◦ C for 30 s, and 72 ◦ C for 2 min, and final extension for 10 min at 72 ◦ C. The routine PCR products were electrophoresed in 1.5% agarose gel to visualize the specific products. 2.8. Detection of MCDV-1 from clinical samples According to the optimized reaction protocol, the LAMP assay was used to detect MCDV-1 in mud crabs. Seven diseased and one healthy mud crab samples were collected from Guangdong, China. Total RNA was extracted from the gill of these crabs and reverse transcribed into cDNA. The plasmid (pMD-18T-dic) was used as a positive control, whereas distilled water was used as a negative control.

147 148 149 150 151 152

153

154 155 156 157 158 159 160

3. Results

161

3.1. Optimization of the LAMP assay protocol

162

To obtain the optimal temperature, the reactions were carried out from 54 ◦ C to 69 ◦ C for 60 min in a thermo cycler. LAMP products were detected at 54.7 ◦ C, 55.4 ◦ C, 56.8 ◦ C, 58.4 ◦ C, 60.1 ◦ C, 61.8 ◦ C, 63.5 ◦ C, and 65.2 ◦ C. The amount of products amplified at 61.8 ◦ C was slightly larger than that at other temperatures (Fig. 1A). The effect of the ratio of outer to inner primers on the LAMP reaction was determined. As shown in Fig. 1B, the cDNA target was amplified with primer ratios ranging from 1:3 to 1:9. The amplification efficiencies of primer ratios 1:8 and 1:9 were almost equal and higher than those of the other ratios. Thus, the ratio of 1:8 was used in the following analysis. The LAMP reaction was tested in the presence of various concentrations of Mg2+ . LAMP products were detected when the Mg2+ concentration ranged from 2 mM to 14 mM. A concentration of 6 mM resulted in the maximum amplification efficiency (Fig. 1C). The effect of 0.2–1.6 mM dNTPs on the LAMP reaction was studied. LAMP products were detected for dNTP concentrations of 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, and 1.4 mM. However, 0.8 mM dNTPs resulted in optimal amplification (Fig. 1D). When the effect of different concentrations of betaine was tested in LAMP amplification, the reaction took place at all the tested concentrations. However, 0.8 M provided the most defined results (Fig. 1E) and was used for subsequent experiments to detect MCDV-1. In the reaction time test, LAMP products were observed for 40, 50, 60, 70, 80, and 90 min. Similar amounts of products were amplified when the reaction times were equal to or longer than 60 min (Fig. 1F). The parameters and optimal final reagent concentrations of MCDV-1 LAMP protocol are listed in Table 2.

Please cite this article in press as: Guo, Z., et al., Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2014.08.014

163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189

G Model VIRMET 12618 1–6

ARTICLE IN PRESS Z. Guo et al. / Journal of Virological Methods xxx (2014) xxx–xxx

4

Q6 Fig. 2. LAMP products detected by electrophoresis analysis (A) and visual observation (B). M: DNA marker 2000; Lane (tube) 1, positive control; Lane (tube), N: negative control. (For interpretation of the references to color in the text of this figure citation, the reader is referred to the web version of this article.)

Fig. 3. Specificity assay of LAMP. M: DNA marker DL 2000; Lane 1, positive control; Lane 2, negative control (healthy crab); Line 3: AbSV; Lane 4: IHNNV; Lane 5: MCRV; Lane 6: NNV; Lane 7: TRBIV; Lane 8: WSSV; Lane 9: AVNV; N: blank control.

190

3.2. Visualization of the LAMP products

195

The LAMP products detected by gel electrophoresis demonstrated ladder-like multiple bands (Fig. 2A). The positive LAMP reaction was also observed by visualization of a color change (from orange to green) following the addition of diluted SYBR Green I dye (Fig. 2B).

196

3.3. Specificity

191 192 193 194

Fig. 4. Sensitivity of conventional PCR (A) and LAMP (B and C) for MCDV-1 detection. Ten-fold dilutions of pMD-18T-dic plasmid ranging from 6 × 106 to 6 × 10−1 copies; M: DNA marker 2000; N: blank control.

conventional PCR were obtained ranging from 100 to 10−2 dilutions of the clinical sample cDNA. The sensitivity of LAMP assay was 100fold higher than that of conventional PCR at clinical sample cDNA level. 3.5. Detection of MCDV-1 from clinical samples

201

Different viruses, including AbSV, AVNV, IHHNV, NNV, TRBIV, WSSV, and MCRV, were used to assess LAMP specificity. DNA or cDNA obtained from control viruses did not result in MCDV-1 gene amplification (Fig. 3), which demonstrates the high level of LAMP specificity.

202

3.4. Sensitivity

197 198 199 200

Seven clinical cases with suspected MCDV-1 infections were submitted to our laboratory and tested with the LAMP assay. Four of the samples were positive for MCDV-1, whereas three of them were negative. Similar results were obtained by the addition of SYBR Green I dye (Fig. 6A and B). 4. Discussion

203 204 205 206 207 208 209 210 211 212 213 214 215

To evaluate the relative sensitivity of the assay, LAMP and PCR were carried out using a series of 10-fold dilutions of plasmid (pMD-18T-dic) ranging from 6 × 106 to 6 copies. Positive LAMP amplifications were observed up to dilutions to six copies per reaction, as detected by both gel electrophoresis and SYBR Green I staining (Fig. 4B and C). PCR provided positive results up to dilutions to 6 × 104 copies per reaction, as indicated by the presence of an expected amplicon (233 bp) after gel electrophoresis (Fig. 4A). Thus, the sensitivity of LAMP assay was 1000 times higher than that of conventional PCR for MCDV-1 detection at constructed plasmid level. As for clinical samples, positive results by LAMP amplifications were observed ranging from 100 to 10−4 dilutions of the clinical sample cDNA (Fig. 5A and B), whereas positive results by

MCDV-1 is pathogenic to mud crabs, and is a major threat to mud crab farming. The virus should be accurately detected as early as possible for disease control. Sensitive and specific detection methods, such as RT-PCR, have been established (Guo et al., 2012; Zhang et al., 2013). However, in practical applications, conventional PCR method is not easy and fast enough. The requirements of PCR instruments, electrophoresis apparatus, imaging system, and long detection time (usually 3–4 h) for MCDV-1 detection are not convenient. By contrast, the LAMP detection method requires only an isothermal environment (typically 60 ◦ C–65 ◦ C) provided by a water bathing or heating plate at a constant temperature, and the reaction can be quickly and easily completed in less than 1 h.

Please cite this article in press as: Guo, Z., et al., Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2014.08.014

216 217 218 219

220

221 222 223 224 225

226

227 228 229 230 231 232 233 234 235 236 237 238

G Model VIRMET 12618 1–6

ARTICLE IN PRESS Z. Guo et al. / Journal of Virological Methods xxx (2014) xxx–xxx

5

Fig. 6. LAMP assay for MCDV-1 detection in clinical samples by electrophoresis analysis (A) and visual observation (B). M: DNA marker DL 2000; lane (tube) H: healthy samples; lane (tube) P: positive control; lanes (tubes) 1–7: test samples; lane (tube) N: negative control.

Fig. 5. Sensitivity of LAMP (A and B) and conventional PCR (C) for clinical MCDV-1 detection. cDNA from clinical tissue sample was 10-fold diluted from 100 to 10−5 as detection template for LAMP and conventional PCR. M: DNA marker DL 2000; N: negative control (cDNA from MCDV-1 free crab tissue).

239 240 241 242 243 244 245 246 247 248 249 250 251 252

Moreover, LAMP reagents stored at 25 ◦ C, 37 ◦ C, or −20 ◦ C will not affect the detection sensitivity (Oriel et al., 2009), thereby providing favorable security for its application in primary diagnosis. No MCDV-1 LAMP detection method has been reported, so this method was developed in this study. To establish a sensitive and specific MCDV-1 LAMP detection method, the primers were designed from the conserved region of the MCDV-1 VP2 gene, which could amplify both the recombinant plasmid and clinical samples. To obtain optimal LAMP amplification efficiency, the concentrations of Mg2+ , dNTPs, and betaine; primer ratio; reaction temperature; and reaction time were optimized. The optimal LAMP amplification was carried out using 0.2 ␮mol/L F3/B3, 1.6 ␮mol/L FIP/BIP, 6 mmol/L Mg2+ , 0.8 mmol/L dNTPs, and 0.8 mol/L betaine, and completed in 1 h at 62 ◦ C. The optimized

conditions in this study slightly differed from those in other studies (Chen et al., 2011; Kono et al., 2004; Tsai et al., 2012; Li et al., 2012). Thus, even with the same technology, the optimal amplification conditions differed because of the different primers and templates used. No cross-reactivity was observed with AbSV, AVNV, IHHNV, NNV, TRBIV, WSSV, and MCRV, which were positive according to PCR. This result indicates that the LAMP detection method could specifically amplify the MCDV-1 template. Sensitivity assay revealed that six copies of the viral genome could be detected by this method at constructed plasmid level, which was at least 1000-fold more sensitive than conventional PCR (6.0 × 104 copies) for the detection of MCDV-1, and similar to nested PCR (Zhang et al., 2013). The detection limitation was consistent with other reported LAMP assays (Li et al., 2012; Fan et al., 2012), and similar to the sensitivity of real-time PCR for the detection of some other pathogens (Pepin et al., 2008; Jiang et al., 2012). At clinical sample cDNA level, the sensitivity of LAMP assay was 100-fold higher than that of conventional PCR. In contrast to the constructed plasmid, total cDNAs from tissue sample are more complex, which maybe influence the relative sensitivity of LAMP assay, compared with that of conventional PCR. Given the high sensitivity of the proposed method, the environment may be contaminated easily when opening the tube cover for detecting reaction products. Testing the usual products by electrophoresis and turbidity meter requires a tube opening. The dye was added in the reaction system previously or a real-time LAMP turbidity meter was adopted to reduce the rate of false-positive results in LAMP assay (Nie et al., 2010; Li et al., 2012). This study aimed to establish a simple and efficient detection method for MCDV-1 for use in wild fields. The LAMP reaction produces large amounts of by-product pyrophosphate, which forms white precipitate of magnesium pyrophosphate and results in macroscopic turbidity. However, turbidity amplifies error possibility to identify products only by naked eyes. Adding the dye into the product could amplify color change and reduce the error brought by observations with the naked eye. SYBR Green (Li et al., 2012), hydroxy naphthol blue (HNB) (Nie et al., 2010), picogreen (Curtis et al., 2008), calcein (Motoki et al., 2009) dye, and propidium iodide (Hill et al., 2008) have been used in LAMP product detection. In the present study, the results of adding SYBR Green I dye were consistent with the electrophoresis results in terms of the detection

Please cite this article in press as: Guo, Z., et al., Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2014.08.014

253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294

G Model VIRMET 12618 1–6

ARTICLE IN PRESS Z. Guo et al. / Journal of Virological Methods xxx (2014) xxx–xxx

6

303

assay or sensitivity assay of clinical samples. This finding indicates that detecting LAMP products by adding dye was practical. Nie et al. (2010) also presented a practical example of dye method in LAMP assay using HNB. In conclusion, the LAMP detection method established in this study was specific, sensitive, efficient, and fast. It could be used in the clinical diagnosis and host range survey of MCDV-1. This method will play a facilitating role on Scylla disease prevention in the future.

Q4 304

Uncited references

295 296 297 298 299 300 301 302

305

306

Q5 307 308 309 310 311

312

313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328

Goto et al. (2009) and Thekisoe et al. (2009). Acknowledgements This research was supported by Special Scientific Research Funds for Central Non-profit Institutes (South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences) under Grant No. 2012TS06, and the Science and Technology Program of Guangdong Province under Grant No. 2011A020102002. References Adams, M.J., Carstens, E.B., 2012. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses. Arch. Virol. 157, 1411–1422. Chen, J.G., Xiong, J., Cui, B.J., Yang, J.F., Mao, Z.J., Li, W.C., Chen, X.X., Zheng, X.J., 2011. Rapid and sensitive detection of mud crab Scylla serrata reovirus by a reverse transcription loop-mediated isothermal amplification assay. J. Virol. Methods 178, 153–160. Curtis, K.A., Rudolph, D.L., Owen, S.M., 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 51, 264–270. Fan, Q., Xie, Z.X., Xie, L.J., Liu, J.B., Pang, Y.S., Deng, X.W., Xie, Z.Q., Peng, Y., Wang, X.Q., 2012. A reverse transcription loop-mediated isothermal amplification method for rapid detection of bovine viral diarrhea virus. J. Virol. Methods 186, 43–48. Goto, M., Honda, E., Oqura, A., Nomoto, A., Hanaki, K., 2009. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 46, 167–172. Guo, Z.X., He, J.G., Xu, H.D., Weng, S.P., 2012. Pathogenicity and complete genome sequence analysis of the mud crab dicistrovirus-1. Virus Res. 171, 8–14.

Hill, J., Beriwal, S., Chandra, I., Paul, V.K., Kapil, A., Singh, T., Wasowsky, R.M., Singh, V., Goyal, A., Jahnukainen, T., Johnson, J.R., Tarr, P.I., Vats, A., 2008. Loopmediated isothermal amplification assay for rapid detection of common strains of Escherichia coli. J. Clin. Microbiol. 46, 2800–2804. Iwamoto, T., Sonobe, T., Hayashi, K., 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples. J. Virol. Methods 41, 2616–2622. Jiang, J.Z., Zhu, Z.N., Zhang, H., Liang, Y.Y., Guo, Z.X., Liu, G.F., Su, Y.L., Wang, J.Y., 2012. Quantitative PCR detection for abalone shriveling syndrome-associated virus. J. Virol. Methods 184, 15–20. Kono, T., Savan, R., Sakai, M., Itami, T., 2004. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplification. J. Virol. Methods 115, 59–65. Li, B., Ma, J.J., Xiao, S.B., Zhang, X.H., Wen, L.B., Mao, L., Ni, Y.X., Guo, R.L., Zhou, J.M., Lv, L.X., He, K.W., 2012. Development of a loop-mediated isothermal amplification method for rapid detection of porcine boca-like virus. J. Virol. Methods 179, 390–395. Lin, Q., Li, S.J., Li, Z.B., Wang, G.Z., 2007. Species composition in genus Scylla from the coast of southeast China. J. Fish. China 31, 211–219. Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophy. Res. Commun. 289, 150–154. Nie, K., Wang, D.Y., Qin, M., Gao, R.B., Wang, M., Zou, S.M., Han, F., Zhao, X., Li, X.Y., Shu, Y.L., Ma, X.J., 2010. Colorimetric detection of human influenza A H1N1 virus by reverse transcription loop mediated isothermal amplification. Chin. J. Virol. 26, 81–87. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. Pepin, J.F., Riou, A., Renault, T., 2008. Rapid and sensitive detection of ostreid herpesvirus 1 in oyster samples by real-time PCR. J. Virol. Methods 149, 269–276. Thekisoe, O.M., Bazie, R.S., Coronel-Servian, A.M., Suqimoto, C., Kawazu, S., Inoue, N., Oriel, M.M.T., Raoul, S.B.B., Andrea, M.C.S., 2009. Stability of loop-mediated isothermal amplification (LAMP) reagents and its amplification efficiency on crude trypanosome DNA templates. J. Vet. Med. Sci. 71, 471–475. Tsai, S.M., Liu, H.J., Shien, J.H., Lee, L.H., Chang, P.C., Wang, C.Y., 2012. Rapid and sensitive detection of infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 181, 117–124. Zhang, R., He, J.G., Su, H.J., Dong, C.F., Guo, Z.X., Weng, S.P., 2010. Monoclonal antibodies produced against VP3 of a novel mud crab dicistrovirus. Hybridoma 29, 437–440. Zhang, R., He, J.G., Su, H.J., Dong, C.F., Guo, Z.X., Ou, Y.J., Deng, X., Weng, S.P., 2011. Identification of the structural proteins of VP1 and VP2 of a novel mud crab dicistrovirus. J. Virol. Methods 171, 323–328. Zhang, D., Yang, K., Su, Y.L., Feng, J., Guo, Z.X., 2013. A duplex nested-PCR assay for detection of mud crab reovirus and mud crab dicistrovirus-1. J. Fish. Sci. China 20, 1–8.

Please cite this article in press as: Guo, Z., et al., Rapid detection of mud crab dicistrovirus-1 using loop-mediated isothermal amplification. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2014.08.014

329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376