- Email: [email protected]
Regulation of chick early B-cell factor-1 gene expression in feather development
Acta Histochemica 116 (2014) 577–582
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
Regulation of chick early B-cell factor-1 gene expression in feather development Mohammed Abu El-Magd a , Ahmed Sayed-Ahmed b,∗ , Ashraf Awad c , Mustafa Shukry d a
Department of Anatomy and Embryology, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt Department of Anatomy and Embryology, Faculty of Veterinary Medicine, Damanhour University, Egypt Department of Animal Wealth Development, Faculty of Veterinary Medicine, Zagazig University, Egypt d Department of Physiology, Faculty Veterinary Medicine, Kafrelsheikh University, Egypt b c
a r t i c l e
i n f o
Article history: Received 22 October 2013 Received in revised form 13 November 2013 Accepted 14 November 2013 Keywords: Early B-cell factor 1 Sonic Hedgehog Bone morphogenetic protein 4 Feathers Chick embryo
a b s t r a c t The chick Ebf1 (early B-cell factor-1) gene is a member of a novel family of helix loop helix transcription factors. The expression profile, regulation and significance of this gene have been extensively studied in lymphatic, nervous, adipose and muscular tissues. However, cEbf1 expression, regulation and function in the feather of chick embryo have not yet been investigated. cEbf1 expression was first detected throughout the mesenchymal core of some few feather placodes (D7–D7.5). After feathers became mature and grew distally (D9 and D10), the mesenchymal expression of cEbf1 became confined to the caudal margin of the proximal half of all formed feather buds. Because this dynamic pattern of expression resembles that of Sonic Hedgehog (Shh) protein and bone morphogenetic protein (Bmp4) plus the crucial role of these two major signals in feather development, we hypothesized that cEbf1 expression in the feather may be regulated by Shh and Bmp4. In a feather explant culture system, Shh signals are necessary to initiate and maintain cEbf1 expression in the posterior half of the feather bud, while Bmp4 is crucial for the initial cEbf1 expression in the anterior half of the feather bud. Inhibition of Shh, not only down-regulates cEbf1, but also changes the morphology of feather buds, which become irregular and fused. This is the first study to demonstrate that cEbf1 expression in the feather bud is under the control of Shh and Bmp4 signals and that expression may play a role in the normal development of feathers. © 2013 Elsevier GmbH. All rights reserved.
Introduction The skin consists of two morphologically homogenous tissue layers: the epidermis and the underlying dermis. The deeper hypodermis is a subcutaneous layer mainly composed of adipose tissue. The development of feather primordia relies upon a series of inductive and reciprocal signals between the epidermis and dermis layers (Jiang et al., 1999; Yu et al., 2002). The dermis derived signals induce thickening of the overlying ectoderm and this results in formation of the epidermal placode. The placode then signals to the dermis to initiate a dermal condensation, which forms a symmetrical feather bud. The coordinated outgrowth of this bud is regulated by reciprocal signaling between the epidermis and the dermis (Chuong, 1998; Jiang et al., 1999). Several key molecules controlling fundamental aspects of the interplay of epithelia and mesenchyme have been identified. Sonic Hedgehog (Shh) is a secreted protein expressed in the epidermis
∗ Corresponding author. E-mail address: afi[email protected] (A. Sayed-Ahmed). 0065-1281/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.acthis.2013.11.010
and implicated in mitogenic and morphogenetic processes throughout feather development from bud induction to feather filament shaping (Harris et al., 2002; Ting-Berreth and Chuong, 1996a,b; Yu et al., 2002). Suppression of Shh by cyclopamine results in dispersion of such activity. Furthermore, Shh signaling is necessary for the formation and proper differentiation of a barb ridge during feather development that it is mediated by bone morphogenetic protein (Bmp) signaling (Harris et al., 2002). Previous studies have also shown that Bmp2, which is expressed in the epidermis and dermis, and Bmp4 (which is expressed in the dermis) control the size and distribution of feather buds via a lateral inhibition mechanism (Jung et al., 1998; Jiang et al., 1999; Noramly et al., 1999). In addition, antagonistic balance between Noggin and Bmp4 play a critical role in feather branching, with Bmp4 promoting rachis formation and barb fusion, and Noggin enhancing rachis and barb branching (Noramly et al., 1999). The early B cell factor 1 (Ebf1) and closely related genes (e.g. Ebf2 and Ebf3) constitute a novel transcription factor family in mammals. In general, EBF proteins are composed of five domains: (1) the highly conserved DNA binding domain (DBD); (2) immunoglobulinlike plexins transcription factor domain (IPT); (3) the conserved
578
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
atypical helix-loop-helix domain (HLH) that mediate dimerization in the absence of DNA; (4) transactivation I domain (TSI) and (5) transactivation II domain (TSII) (Hagman et al., 1993, 1995; Crozatier et al., 1996). Ebf1 has been proposed to play a role in B cell lymphopoiesis (Hagman and Lukin, 2005) and neuronal differentiation (Garel et al., 1999). Expression of the Ebf1 gene is not limited to B cells and developing forebrain, but has also been detected in adipocytes, osteoblasts (Hesslein et al., 2009), somites (El-Magd, 2011) and limb buds (Mella et al., 2004). The expression of Ebf1 in multiple tissues suggests that cooperation with other tissue-restricted factors is required for its lineage specific effect. Our previous studies have shown that Ebf genes are expressed in somites under the control of Shh and Bmp4 from the notochord and the lateral mesoderm, respectively (El-Magd, 2011; El-Magd et al., 2013) So far, there is no information about the expression or regulation of chick Ebf1 in feather development. Therefore, we endeavored to investigate the expression profile of the cEbf1 gene during feather morphogenesis and to investigate the suggested regulatory effect of Shh and Bmp4 on this expression. Material and methods Explant cultures of chick skin Explant cultures were carried out as previously described by Jung et al. (1998). Briefly, dorsal skin from stage HH28-33 Faiomy chicken embryos (staged according to Hamburger and Hamilton, 1951) was dissected in phosphate buffered saline (PBS) and pinned dorsal side up onto nitrocellulose membranes (Millipore, Billerica, MA, USA). The anterior–posterior axis of the explant was identified by applying Nile blue stain to label the posterior end. Membranes were then placed on a solid 1% agarose in Dulbecco’s modified Eagle’s medium (DMEM-Gibco/BRL, Life Technologies, Grand Island, NY, USA) base, which was supplemented with growth media – DMEM containing 10% fetal calf serum and 2% chick serum (Gibco/BRL). Explants were grown at the air-media interface at 37 ◦ C in an incubator containing 100% humidity and an atmosphere of 95% air: 5% CO2 . Notably, this system allows addition of compounds (i.e. cyclopamine, Bmp4, or DMSO) directly to the media supplementing the culture. Application of cyclopamine (Toronto Research Chemicals, North York, ON, Canada) and recombinant human Bmp4 (R&D Systems, Minneapolis, MN, USA) to chick skin explant cultures was achieved by supplementation of the growth media. Cyclopamine and Bmp4 was dissolved in DMSO and added to a final concentration of 12.5 M and 50 g/ml, respectively. The apparent effect of cyclopamine and Bmp4 treatment was noticeably clear after 12–24 h of incubation. Therefore, the changes in cEbf1 expression by whole-mount in situ hybridization were detected after 12 h and 24 h incubation. Control cultures were supplemented with an equivalent volume of DMSO. Whole-mount in situ hybridization Samples were washed in PBS and fixed overnight in 4% paraformaldehyde in PBS containing 0.1% Triton. Whole-mount in situ hybridization was performed as described by Nieto et al. (1996). The genes of chick EbF1-3 were cloned by RT-PCR for preparing the RNA probes in brief; total RNA was isolated from 3day old whole chick embryos using Trizol (Invitrogen, Carlsbad, CA, USA) and was then reverse transcribed using M-MLV reverse transcriptase as described by the manufacturer (Qiagen Sciences, Germantown, MD, USA). RNA was replaced by water for a negative control during the RT reaction. Chick Ebf1-3 genes were then cloned
by PCR using primers based on conserved regions in HLH and DBD of mouse mEbf1-3 as described by (Garcia-Dominguez et al., 2003; Mella et al., 2004). cEbf1 forward primer was 5 AGAAGGTTATCCCCCGGCAC 3 and the reverse was 5 CATGGGGGGAACAATCATGC 3 ; cEbf2 forward primer was 5 TCAGGACTGAACAGGATCTG 3 and the reverse was 5 GGTTATTGTGGACGAACAG 3 ; and cEbf3 forward primer was 5 CGCCTCATAGACT-CCATGAC 3 and the reverse was 5 TGTATCACTCACTCCAGAC 3 . PCR was performed with the following cycling parameters: 95 ◦ C for 5 min for initial denaturation, followed by 40 cycles with 94 ◦ C for 30 s, annealing temperature 60 ◦ C (cEbf1 and cEbf2), 58 ◦ C (cEbf3) for 1 min, 72 ◦ C for 2 min, and final extension at 72 ◦ C for 10 min. cDNA was replaced by water for a negative control during the PCR and to rule out the possibility of amplifying genomic DNA. In some experiments PCR was carried out without prior RT of the RNA. PCR products were analyzed by 1% gel electrophoresis, and products of the correct size (696 bp for cEbf1, 405 bp for cEbf2 and 504 bp for cEbf3) purified and ligated into pGEM-T Easy vector. Cloning procedure was as described by the manufacturer (Promega, Madison, WI, USA). Plasmid DNA was linearized using Nco1 (cEbf1) and Sac II (cEbf2 and cEbf3) restriction enzymes. RNA probes were transcribed from 1 g linearized plasmid DNA in a total reaction volume of 20 l containing the following constituent parts: 1 g of purified linear DNA, 1 l RNase inhibitor, 4 l 5× transcription buffer, 2 l 10× digoxygenin labeling mix, 2 l of SP6 RNA polymerase enzyme and a calculated amount of RNase-free water to make the volume up to 20 l. The reaction was incubated at 37 ◦ C for 2 h. The probe was precipitated by adding 2.5 l 4 M LiCl and 75 l prechilled 100% ethanol to the RNA and incubated for at least 1 h at −70 ◦ C followed by centrifugation at 13,000 rpm for 10 min. Following a prechilled 70% ethanol rinse and 2 min spin, all liquid was removed by inverting the tube; the pellet was briefly air-dried and finally resuspended in 100 l TE, giving an approximate concentration of 0.1 g/l. 5 l of the probe was analyzed by gel electrophoresis to gauge the quality and quantity of probe. Cryo-sectioning and photography Embryo wings were frozen in tissue embedding medium (O.C.T., Tissue-Tek® , Sakura Finetek) and cryo-sectioned at 30 m. Sections were mounted on Tespa coated slides (Sigma-Aldrich) and the slides were then mounted using HydromountTM (National Diagnostics, Atlanta, GA, USA) coverslipped and left to dry overnight before photographing. Sections were photographed using a Leica DMRA2 microscope and DC300 camera system (Leica Microsystems, Nussloch, Germany). Whole mounted embryos and skin explants were photographed using a Nikon E990 digital camera mounted on a Nikon dissecting microscope with both lateral and transillumination. Scanning electron microscopy To check whether equally dramatic morphological effects accompanied the loss of Shh signals and disturbance of Ebf1 expression. Chick skin explants from control and cyclopamine treated samples were rinsed in PBS and fixed for 4 h in a mixture of paraformaldehyde 2.5% and glutaraldehydehyde 2.5% solution in 0.1 M phosphate buffer at 4 ◦ C. Tissues were then rinsed in phosphate buffer and postfixed in 1% osmium tetroxide (OsO4 ) for 1 h. Samples were then dehydrated through ascending ethanol series, with displacement of alcohol accomplished by three changes of acetone. Samples were then CO2 critical point dried, gold sputter coated and examined with Jeol JSM 5300 scanning electron microscope (Faculty of Medicine, Tanta University, Egypt).
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
579
cEbf1 was expressed throughout the feather placodes, but became confined to the proximal half of the feather buds at the posterior border of the wing (blue arrowhead, Fig. 1D). Transverse sections through the wing revealed that the expression is localized only in the mesenchymal core of the proximal feather buds at the posterior margin as clearly noticed in the longest and moderate buds (blue arrowhead, Fig. 1E). However, in the smallest feather buds the expression distributed throughout the mesenchymal core (Fig. 1E). Unlike cEbf1, cEbf2 and cEbf3 expression was not noticed in any feather bud in the whole examined stages from D7 to D10 (Fig. 1F and G). Regulation of cEbf1 in feather buds by Shh and Bmp4
Fig. 1. Whole mount in situ hybridization analysis of cEbf1-3 expression profile in the feather buds during HHD7-D10. (A and C) Lateral view, (B and D) dorsal view and (E) transverse section. The anterior–posterior direction for all photos was shown in (A). (A) At D7, the initial feather placodal expression of cEbf1 was in the tail (red arrowhead) and thigh (green arrowhead). (B) At D7.5, cEbf1 expression became apparent in some feather placodes in the back and the neck (white arrowheads). (C) AT D9, cEbf1 expression became evident in the majority of the feather placodes, but not yet in the wing dorsum. (D) At D10, cEbf1 labeling was detected in the dorsum of the wing. It was expressed in the entire feather placodes and the proximal half of the feather buds at the caudal edge of the wing (blue arrowhead). Blue dashed lines mark the level of (E). (E) Transverse sections through the wing at the marked level in (D). In young feather buds cEbf1 was noticed throughout the mesenchymal core however in older (longer) buds the mesenchymal expression became confined to the posterior border of the bud proximal half (blue arrowhead). (F and G) No cEbf2 (F) or cEbf3 (G) expression was detected in the feathers as was represented here in the wing of D9 chick embryo (arrowheads). Abbreviations: A, anterior; D, distal half of feather bud; Ec, ectoderm; F1, short feather bud; F2, moderate length feather bud; F3, long feather bud; Fb, feather buds; Fp, feather placodes; Ms, mesenchymal core; P, posterior; Pr, proximal half of feather bud. Scale bars; A and D = 500 m; B, C, F and G = 400 m; E = 200 m. (For interpretation of the references to color in this legend, the reader is referred to the web version of the article.)
Results Expression of cEbf1-3 genes in feathers Formation of the feather buds are normally preceded by the appearance of localized thickened cutaneous regions known as feather placodes. cEbf1 was first detected in three pairs of tail (red arrowhead, Fig. 1A) and thigh (green arrowhead, Fig. 3A) feather placodes at day 7 (D7). By D7.5, it appeared in the posterior half of few individual placodes in the back and the neck (white arrowheads, Fig. 1B). AT D9, cEbf1 expression extended throughout all the feather placodes (e.g. in the rest of tail, dorsum, and lateral aspect of thigh, shoulder, pectoral regions and posterior border of wings) (Fig. 1C). By D10, the feather placodes grew distally to form distinct feather buds. Dorsal view to the wing of D10 embryo showed that
To check this possibility, the Shh inhibitor, cyclopamine, was applied to chick skin explant cultures at an optimized concentration of 12.5 M. After 12 h, this treatment resulted in a complete downregulation of cEbf1 from the posterior domain of feather placode (magenta arrowhead, Fig. 2A, n = 5/5). However, the expression in anterior domain remained normal (green arrowhead, Fig. 2A). In contrast, the DMSO-treated control embryo displayed a unique cEbf1 expression pattern in both the anterior (green arrowhead, Fig. 2B, n = 3/3) and posterior domain (magenta arrowhead, Fig. 2B). Subsequently, cyclopamine treated explants at 24 h resulted in almost entire down-regulation of cEbf1 expression in the feather placode (arrowheads, Fig. 2C, n = 5/5), unlike the control explant which showed normal cEbf1 expression in the posterior domain (magenta arrowhead, Fig. 2D, n = 3/3). This means that Shh signals are necessary to initiate and maintain cEbf1 expression in the posterior half of the feather bud. On the other hand, at 12 h, 100 ng/ml Bmp4 protein treated skin explant revealed an initial strong upregulation of cEbf1 expression in the anterior domain of the feather placode in comparison with either the posterior domain in the same placode (compare green to magenta arrowheads, Fig. 2E, n = 5/5) or to the anterior half of the control (green arrowhead, Fig. 2F, n = 3/3). After 24 h, cEbf1 expression was expanded to the anterior domain (green arrowhead, Fig. 2G, n = 5/5), which normally lacks any labeling at this stage as shown in the control (green arrowhead, Fig. 2H, n = 3/3). These findings indicate that Bmp4 is crucial for the initial cEbf1 expression in the anterior half of the feather bud. Taken together, both Shh and Bmp4 signals are required for keeping the anterior posterior identity of cEbf1 within the developed feather, whereby Shh is responsible for the permanent posterior identity and Bmp4 for the early transient anterior identity. Effect of loss of Shh and disturbance of its downstream target cEbf1on morphology of feathers (SEM) In control HH30 embryo, SEM showed the normal progression of bud development from 12 to 48 h where it appeared as small regularly spaced swellings at 12 h (arrowhead, Fig. 3A), developed into distinct and prominent feather buds at 24 h (arrowhead, Fig. 3B), becoming increasingly prominent and well defined at 48 h (arrowhead, Fig. 3C). In cyclopamine treated cultures, little difference could be detected at 12 h and 24 h (Fig. 3D and E), however by 48 h the buds became less prominent and displayed irregular distribution pattern). In control day 4 (stage HH33) embryo, electron microscopy examination of skin explant after 48 h incubation showed normal feathers buds, which became wider anteriorly and narrower posteriorly (Fig. 3G). In contrast, a major morphological abnormality could be observed 48 h after application of cyclopamine, when the fused buds became distinct and resulted in elongated buds without distinct anterior or posterior ends (Fig. 3H). The above results revealed that the morphology of the feather buds was indeed affected by the presence of cyclopamine. Thus, the
580
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
Fig. 2. Whole mount in situ hybridization of chick skin explant cultures showed effect of Shh inhibition and Bmp4 supplementation on cEbf1 expression. (A) After 12 h of cyclopamine application (12.5 M), cEbf1 expression was completely down-regulated from the posterior (post) domain of feather placode (magenta arrowhead), but remained normal in the anterior (ant) domain (green arrowhead) as compared to the control embryo (B) which displayed a unique cEbf1 expression pattern in both the anterior (green arrowhead) and posterior domain (magenta arrowhead). (C) At 24 h, cyclopamine treated explants resulted in almost entire down-regulation of cEbf1 expression in the feather (arrowhead), unlike the control explant (D) which showed normal cEbf1 expression in the posterior domain (arrowhead). (E) Application of 100 ng/ml Bmp4 for 12 h caused up-regulation of cEbf1 expression in the anterior domain of the feather placode as compared to either the posterior domain in the same placode (compare green to magenta arrowhead) or to the anterior half of the control (F, arrowhead). (G) After 24 h, cEbf1 expression was expanded to the anterior domain (arrowhead), which normally lacks any labeling at this stage as shown in the control (H, arrowhead). (Scale bar = 100 m). (For interpretation of the references to color in this legend, the reader is referred to the web version of the article.)
abnormalities of feather development observed at the molecular level are mirrored morphologically, with an apparent loss of feather pattern. This was manifest as an expansion of feather domains that results in a loss of distinct buds and fusion of existing buds. Discussion In this study, we describe the expression of cEbf1 during the development of feathers and study the effect of Shh inhibition and Bmp4 supplementation on this expression. Both Shh and Bmp4 signals are necessary for maintenance of the permanent posterior identity and early transient anterior identity, respectively, of cEbf1 within the developed feather. In the present study, we showed for the first time that the cEbf1gene was expressed in the feather bud. Studies on Ebf1 have concentrated on nervous, lymphatic and adipose tissues (reviewed
by Dubois and Vincent, 2001; Liberg et al., 2002). For example, mouse Ebf1 gene is expressed in the neural tube from the level of the mesencephalon to the end of the spinal cord (Wang et al., 1997, 2002) and at specific sites in the embryonic prosencephalon including; the lateral ganglionic eminence (Garel et al., 1997, 2002), the basal ganglia (Lobo et al., 2006), and the facial branchiomotor neurons (Garel et al., 2000). Ebf1 is the only member of Ebf genes expressed in B cells of mice, human and chick (Akerblad and Sigvardsson, 1999; Gisler et al., 2000; Hagman and Lukin, 2005; Lin and Grosschedl, 1995; Nieminen et al., 2000) where the collaboration with other transcription factors and cofactors allows Ebf1 to direct the ultimate transcription state of target genes throughout B cell differentiation (Treiber et al., 2010). Mouse Ebf1 is also expressed throughout adipogenesis with low levels of expression in the preadipocytes and higher levels in mature adipocytes (Akerblad et al., 2002; Hagman et al., 1993). However, few studies on Ebf1 in
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
581
Fig. 3. Effect of loss of Shh and disturbance of its downstream target Ebf1 on morphology of feathers. A, B and C are control HH30 embryos. Small symmetrical swellings observed at 12 h (A), developed into distinct and prominent feather buds at 24 h (B) and 48 h (C) (arrowheads). D, E and F cyclopamine treated samples. Little effect is observed in the presence of cyclopamine at 12 h and 24 h (white arrowheads, D and E); however, fusions (red arrow) of feather buds were observed at 48 h (F). Note also that despite the fusions, the buds in the cyclopamine samples are markedly less prominent than the control samples. (G) In control HH33 embryo: after 48 h, the buds appeared normal with wider anterior and narrower posterior ends (arrowhead). (H) In the presence of cyclopamine, by 48 h, the fused buds became more apparent and resulted in elongated buds with similar two ends (arrowhead). (Scale bar = 200 m). (For interpretation of the references to color in this legend, the reader is referred to the web version of the article.)
other tissues have been performed. Previously, we reported that cEbf1 is expressed in the medial sclerotomal cells and the limb buds of chick embryos (El-Magd, 2011; El-Magd et al., 2013). Here, we showed that cEbf1 is the only member of chick Ebf genes which is expressed in the feather buds and as early as at the placode stage and that this expression increased during feather-bud development. The position of cEbf1 transcripts in the bud differs according to the order of feather buds, which in turn depends on the stage of development. During the initial stage, when the bud is still young and so called feather placode, cEbf1 expression extended throughout the mesenchymal cells of the core (dermis). This early distribution is in concert with the initial expression of Bmp2/4 in the outer epithelial covering of the feather placodes (Harris et al., 2002). After feathers became mature and grew distally, cEbf1 expression became polarized and confined to the caudal margin of the formed feather bud. This dynamic pattern of expression resembles that of Shh which is also expressed in the posterior half but in the ectodermal covering of the feather bud. However because both Shh and Bmp4 act as morphogens and are very important for normal patterning and differentiation of the feather, it is possible that these molecules can regulate cEbf1 in the feather. We have recently shown that the medial sclerotomal expression of cEbf1 is induced by Bmp4 signals from the lateral mesoderm and is maintained by Shh signals from the notochord (El-Magd, 2011). Similarly, in the present study, both Shh and Bmp4 also regulate cEbf1 expression in the feather buds. This means that cEbf1 may be a downstream target for both Shh and Bmp4 signals in different tissues. Our previous study has also showed that cEbf1 under regulation of Shh and Bmp4 plays an important role in the mediolateral
patterning of somites through keeping the identity of the medial sclerotomal cells (El-Magd, 2011). In feathers, both Shh and Bmp4 signals are also required for keeping the anterior posterior identity of cEbf1 within the developed feather, whereby Shh is responsible for the permanent posterior identity and Bmp4 for the early transient anterior identity. This raises the possibility that cEbf1 may be a novel downstream target in Shh/Bmp signaling pathway controlling the identity of the feathers. In this study, we showed that treatment with 12.5 M cyclopamine at stage 30 or 33 did not inhibit feather-bud formation but rather the buds became irregularly distributed and fused concomitant with a decrease in cEbf1 expression. Shh is not required for the initiation of either feather placodes and buds in this study or hair placodes (Nanba et al., 2003), as both placodes and buds were formed after inhibition of Shh by cyclopamine. However, another study on mouse has shown that Shh induces hair growth by proliferation in early hair development and therefore, in chick it will be expected that Shh inhibition could lead to formation of small feather buds, but with normal discrete pattern (St-Jacques et al., 1998). In contrast, we have found irregular distribution and fusion of feather buds in absence of Shh signals. We conclude that cEbf1 is expressed in the feather bud under the control of Shh and Bmp4 signals which are required for keeping the posterior and anterior identity, respectively, of cEbf1 within the developing feather. This expression suggests that cEbf1 has an important role in feather formation. However, further study on the relationships among cEbf1 and these morphogenetic signals is recommended to elucidate the processes underlying the development of feather buds.
582
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
Acknowledgements The authors would like to thank Prof. Ketan Patel (School of Biological Sciences, University of Reading, Reading, UK) and Dr. Steve Allen, Dr. Imelda McGonnell (Department of Veterinary Basic Sciences, Royal Veterinary College, London, UK) for their support and useful discussion of the study. References Akerblad P, Lind U, Liberg D, Bamberg K, Sigvardsson M. Early B-cell factor (O/E-1) is a promoter of adipogenesis and involved in control of genes important for terminal adipocyte differentiation. Mol Cell Biol 2002;22:8015–25. Akerblad P, Sigvardsson M. Early B cell factor is an activator of the B lymphoid kinase promoter in early B cell development. J Immunol 1999;163:5453–61. Chuong CM. Molecular basis of epithelial appendage morphogenesis. Feather morphogenesis: a model of the formation of epithelial appendages. Landes Biosci 1998:3–14. Crozatier M, Valle D, Dubois L, Ibnsouda S, Vincent A. Collier, a novel regulator of Drosophila head development, is expressed in a single mitotic domain. Curr Biol 1996;6:707–18. Dubois L, Vincent A. The COE – Collier/Olf1/EBF – transcription factors: structural conservation and diversity of developmental functions. Mech Dev 2001;108:3–12. El-Magd MA. The function and regulation of chick Ebf genes in somite development. Saarbrücken, Germany: LAP Lambert Academic Publishing; 2011, ISBN-10: 3846590886, ISBN-13: 978-3846590881. El-Magd MA, Allen S, McGonnell I, Otto A, Patel K. Bmp4 regulates chick Ebf2 and Ebf3 gene expression in somite development. Dev Growth Differ 2013;55:710–22. Garcia-Dominguez M, Poquet C, Garel S, Charnay P. Ebf gene function is required for coupling neuronal differentiation and cell cycle exit. Development 2003;130:6013–25. Garel S, Garcia-Dominguez M, Charnay P. Control of the migratory pathway of facial branchiomotor neurones. Development 2000;127:5297–307. Garel S, Marin F, Grosschedl R, Charnay P. Ebf1 controls early cell differentiation in the embryonic striatum. Development 1999;126:5285–94. Garel S, Marin F, Mattei MG, Vesque C, Vincent A, Charnay P. Family of Ebf/Olf-1-related genes potentially involved in neuronal differentiation and regional specification in the central nervous system. Dev Dyn 1997;210:191–205. Garel S, Yun K, Grosschedl R, Rubenstein JL. The early topography of thalamocortical projections is shifted in Ebf1 and Dlx1/2 mutant mice. Development 2002;129:5621–34. Gisler R, Jacobsen SE, Sigvardsson M. Cloning of human early B-cell factor and identification of target genes suggest a conserved role in B-cell development in man and mouse. Blood 2000;96:1457–64. Hagman J, Belanger C, Travis A, Turck CW, Grosschedl R. Cloning and functional characterization of early B-cell factor, a regulator of lymphocyte-specific gene expression. Genes Dev 1993;7:760–73. Hagman J, Gutch MJ, Lin H, Grosschedl R. EBF contains a novel zinc coordination motif and multiple dimerization and transcriptional activation domains. EMBO J 1995;14:2907–16. Hagman J, Lukin K. Early B-cell factor ‘pioneers’ the way for B-cell development. Trends Immunol 2005;26:455–61. Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. J Morphol 1951;88:49–92.
Harris MP, Fallon JF, Prum RO. Shh-Bmp2 signaling module and the evolutionary origin and diversification of feathers. J Exp Zool 2002;294:160–76. Hesslein DG, Fretz JA, Xi Y, Nelson T, Zhou S, Lorenzo JA, et al. Ebf1dependent control of the osteoblast and adipocyte lineages. Bone 2009;44:537–46. Jiang TX, Jung HS, Widelitz RB, Chuong CM. Self-organization of periodic patterns by dissociated feather mesenchymal cells and the regulation of size, number and spacing of primordia. Development 1999;126:4997–9. Jung HS, Francis-West PH, Widelitz RB, Jiang TX, Ting-Berreth S, Tickle C, et al. Local inhibitory action of BMPs and their relationships with activators in feather formation: implications for periodic patterning. Dev Biol 1998;196:11–23. Liberg D, Sigvardsson M, Akerblad P. The EBF/Olf/Collier family of transcription factors: regulators of differentiation in cells originating from all three embryonal germ layers. Mol Cell Biol 2002;22:8389–97. Lin H, Grosschedl R. Failure of B-cell differentiation in mice lacking the transcription factor EBF. Nature 1995;376:263–7. Lobo MK, Karsten SL, Gray M, Geschwind DH, Yang XW. FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains. Nat Neurosci 2006;9:443–52. Mella S, Soula C, Morello D, Crozatier M, Vincent A. Expression patterns of the coe/ebf transcription factor genes during chicken and mouse limb development. Gene Expr Patterns 2004;4:537–42. Nanba D, Nakanishi Y, Hieda Y. Role of Sonic Hedgehog signaling in epithelial and mesenchymal development of hair follicles in an organ culture of embryonic mouse skin. Dev Growth Differ 2003;45:231–9. Nieminen P, Liippo J, Lassila O. Pax-5 and EBF are expressed in committed B-cell progenitors prior to the colonization of the embryonic bursa of fabricius. Scand J Immunol 2000;52: 465–9. Nieto MA, Patel K, Wilkinson DG. In situ hybridization analysis of chick embryos in whole mount and tissue sections. Methods Cell Biol 1996;51:219–35. Noramly S, Freeman A, Morgan BA. beta-catenin signaling can initiate feather bud development. Development 1999;126:3509–21. St-Jacques B, Dassule HR, Karavanova I, Botchkarev VA, Li J, Danielian PS, et al. Sonic Hedgehog signaling is essential for hair development. Curr Biol 1998;8:1058–68. Ting-Berreth SA, Chuong CM. Local delivery of TGF beta2 can substitute for placode epithelium to induce mesenchymal condensation during skin appendage morphogenesis. Dev Biol 1996a;179:347–59. Ting-Berreth SA, Chuong CM. Sonic Hedgehog in feather morphogenesis: induction of mesenchymal condensation and association with cell death. Dev Dyn 1996b;207: 157–70. Treiber T, Mandel EM, Pott S, Györy I, Firner S, Liu ET, et al. Early B cell factor 1 regulates B cell gene networks by activation, repression, and transcription-independent poising of chromatin. Immunity 2010;32:714–25. Wang SS, Betz AG, Reed RR. Cloning of a novel Olf-1/EBF-like gene O/E-4, by degenerate oligo-based direct selection. Mol Cell Neurosci 2002;20:404–14. Wang SS, Tsai RY, Reed RR. The characterization of the Olf1/EBF-like HLH transcription factor family: implications in olfactory gene regulation and neuronal development. J Neurosci 1997;17:4149–58. Yu M, Wu P, Widelitz RB, Chuong CM. The morphogenesis of feathers. Nature 2002;420:308–12.
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
Regulation of chick early B-cell factor-1 gene expression in feather development Mohammed Abu El-Magd a , Ahmed Sayed-Ahmed b,∗ , Ashraf Awad c , Mustafa Shukry d a
Department of Anatomy and Embryology, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt Department of Anatomy and Embryology, Faculty of Veterinary Medicine, Damanhour University, Egypt Department of Animal Wealth Development, Faculty of Veterinary Medicine, Zagazig University, Egypt d Department of Physiology, Faculty Veterinary Medicine, Kafrelsheikh University, Egypt b c
a r t i c l e
i n f o
Article history: Received 22 October 2013 Received in revised form 13 November 2013 Accepted 14 November 2013 Keywords: Early B-cell factor 1 Sonic Hedgehog Bone morphogenetic protein 4 Feathers Chick embryo
a b s t r a c t The chick Ebf1 (early B-cell factor-1) gene is a member of a novel family of helix loop helix transcription factors. The expression profile, regulation and significance of this gene have been extensively studied in lymphatic, nervous, adipose and muscular tissues. However, cEbf1 expression, regulation and function in the feather of chick embryo have not yet been investigated. cEbf1 expression was first detected throughout the mesenchymal core of some few feather placodes (D7–D7.5). After feathers became mature and grew distally (D9 and D10), the mesenchymal expression of cEbf1 became confined to the caudal margin of the proximal half of all formed feather buds. Because this dynamic pattern of expression resembles that of Sonic Hedgehog (Shh) protein and bone morphogenetic protein (Bmp4) plus the crucial role of these two major signals in feather development, we hypothesized that cEbf1 expression in the feather may be regulated by Shh and Bmp4. In a feather explant culture system, Shh signals are necessary to initiate and maintain cEbf1 expression in the posterior half of the feather bud, while Bmp4 is crucial for the initial cEbf1 expression in the anterior half of the feather bud. Inhibition of Shh, not only down-regulates cEbf1, but also changes the morphology of feather buds, which become irregular and fused. This is the first study to demonstrate that cEbf1 expression in the feather bud is under the control of Shh and Bmp4 signals and that expression may play a role in the normal development of feathers. © 2013 Elsevier GmbH. All rights reserved.
Introduction The skin consists of two morphologically homogenous tissue layers: the epidermis and the underlying dermis. The deeper hypodermis is a subcutaneous layer mainly composed of adipose tissue. The development of feather primordia relies upon a series of inductive and reciprocal signals between the epidermis and dermis layers (Jiang et al., 1999; Yu et al., 2002). The dermis derived signals induce thickening of the overlying ectoderm and this results in formation of the epidermal placode. The placode then signals to the dermis to initiate a dermal condensation, which forms a symmetrical feather bud. The coordinated outgrowth of this bud is regulated by reciprocal signaling between the epidermis and the dermis (Chuong, 1998; Jiang et al., 1999). Several key molecules controlling fundamental aspects of the interplay of epithelia and mesenchyme have been identified. Sonic Hedgehog (Shh) is a secreted protein expressed in the epidermis
∗ Corresponding author. E-mail address: afi[email protected] (A. Sayed-Ahmed). 0065-1281/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.acthis.2013.11.010
and implicated in mitogenic and morphogenetic processes throughout feather development from bud induction to feather filament shaping (Harris et al., 2002; Ting-Berreth and Chuong, 1996a,b; Yu et al., 2002). Suppression of Shh by cyclopamine results in dispersion of such activity. Furthermore, Shh signaling is necessary for the formation and proper differentiation of a barb ridge during feather development that it is mediated by bone morphogenetic protein (Bmp) signaling (Harris et al., 2002). Previous studies have also shown that Bmp2, which is expressed in the epidermis and dermis, and Bmp4 (which is expressed in the dermis) control the size and distribution of feather buds via a lateral inhibition mechanism (Jung et al., 1998; Jiang et al., 1999; Noramly et al., 1999). In addition, antagonistic balance between Noggin and Bmp4 play a critical role in feather branching, with Bmp4 promoting rachis formation and barb fusion, and Noggin enhancing rachis and barb branching (Noramly et al., 1999). The early B cell factor 1 (Ebf1) and closely related genes (e.g. Ebf2 and Ebf3) constitute a novel transcription factor family in mammals. In general, EBF proteins are composed of five domains: (1) the highly conserved DNA binding domain (DBD); (2) immunoglobulinlike plexins transcription factor domain (IPT); (3) the conserved
578
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
atypical helix-loop-helix domain (HLH) that mediate dimerization in the absence of DNA; (4) transactivation I domain (TSI) and (5) transactivation II domain (TSII) (Hagman et al., 1993, 1995; Crozatier et al., 1996). Ebf1 has been proposed to play a role in B cell lymphopoiesis (Hagman and Lukin, 2005) and neuronal differentiation (Garel et al., 1999). Expression of the Ebf1 gene is not limited to B cells and developing forebrain, but has also been detected in adipocytes, osteoblasts (Hesslein et al., 2009), somites (El-Magd, 2011) and limb buds (Mella et al., 2004). The expression of Ebf1 in multiple tissues suggests that cooperation with other tissue-restricted factors is required for its lineage specific effect. Our previous studies have shown that Ebf genes are expressed in somites under the control of Shh and Bmp4 from the notochord and the lateral mesoderm, respectively (El-Magd, 2011; El-Magd et al., 2013) So far, there is no information about the expression or regulation of chick Ebf1 in feather development. Therefore, we endeavored to investigate the expression profile of the cEbf1 gene during feather morphogenesis and to investigate the suggested regulatory effect of Shh and Bmp4 on this expression. Material and methods Explant cultures of chick skin Explant cultures were carried out as previously described by Jung et al. (1998). Briefly, dorsal skin from stage HH28-33 Faiomy chicken embryos (staged according to Hamburger and Hamilton, 1951) was dissected in phosphate buffered saline (PBS) and pinned dorsal side up onto nitrocellulose membranes (Millipore, Billerica, MA, USA). The anterior–posterior axis of the explant was identified by applying Nile blue stain to label the posterior end. Membranes were then placed on a solid 1% agarose in Dulbecco’s modified Eagle’s medium (DMEM-Gibco/BRL, Life Technologies, Grand Island, NY, USA) base, which was supplemented with growth media – DMEM containing 10% fetal calf serum and 2% chick serum (Gibco/BRL). Explants were grown at the air-media interface at 37 ◦ C in an incubator containing 100% humidity and an atmosphere of 95% air: 5% CO2 . Notably, this system allows addition of compounds (i.e. cyclopamine, Bmp4, or DMSO) directly to the media supplementing the culture. Application of cyclopamine (Toronto Research Chemicals, North York, ON, Canada) and recombinant human Bmp4 (R&D Systems, Minneapolis, MN, USA) to chick skin explant cultures was achieved by supplementation of the growth media. Cyclopamine and Bmp4 was dissolved in DMSO and added to a final concentration of 12.5 M and 50 g/ml, respectively. The apparent effect of cyclopamine and Bmp4 treatment was noticeably clear after 12–24 h of incubation. Therefore, the changes in cEbf1 expression by whole-mount in situ hybridization were detected after 12 h and 24 h incubation. Control cultures were supplemented with an equivalent volume of DMSO. Whole-mount in situ hybridization Samples were washed in PBS and fixed overnight in 4% paraformaldehyde in PBS containing 0.1% Triton. Whole-mount in situ hybridization was performed as described by Nieto et al. (1996). The genes of chick EbF1-3 were cloned by RT-PCR for preparing the RNA probes in brief; total RNA was isolated from 3day old whole chick embryos using Trizol (Invitrogen, Carlsbad, CA, USA) and was then reverse transcribed using M-MLV reverse transcriptase as described by the manufacturer (Qiagen Sciences, Germantown, MD, USA). RNA was replaced by water for a negative control during the RT reaction. Chick Ebf1-3 genes were then cloned
by PCR using primers based on conserved regions in HLH and DBD of mouse mEbf1-3 as described by (Garcia-Dominguez et al., 2003; Mella et al., 2004). cEbf1 forward primer was 5 AGAAGGTTATCCCCCGGCAC 3 and the reverse was 5 CATGGGGGGAACAATCATGC 3 ; cEbf2 forward primer was 5 TCAGGACTGAACAGGATCTG 3 and the reverse was 5 GGTTATTGTGGACGAACAG 3 ; and cEbf3 forward primer was 5 CGCCTCATAGACT-CCATGAC 3 and the reverse was 5 TGTATCACTCACTCCAGAC 3 . PCR was performed with the following cycling parameters: 95 ◦ C for 5 min for initial denaturation, followed by 40 cycles with 94 ◦ C for 30 s, annealing temperature 60 ◦ C (cEbf1 and cEbf2), 58 ◦ C (cEbf3) for 1 min, 72 ◦ C for 2 min, and final extension at 72 ◦ C for 10 min. cDNA was replaced by water for a negative control during the PCR and to rule out the possibility of amplifying genomic DNA. In some experiments PCR was carried out without prior RT of the RNA. PCR products were analyzed by 1% gel electrophoresis, and products of the correct size (696 bp for cEbf1, 405 bp for cEbf2 and 504 bp for cEbf3) purified and ligated into pGEM-T Easy vector. Cloning procedure was as described by the manufacturer (Promega, Madison, WI, USA). Plasmid DNA was linearized using Nco1 (cEbf1) and Sac II (cEbf2 and cEbf3) restriction enzymes. RNA probes were transcribed from 1 g linearized plasmid DNA in a total reaction volume of 20 l containing the following constituent parts: 1 g of purified linear DNA, 1 l RNase inhibitor, 4 l 5× transcription buffer, 2 l 10× digoxygenin labeling mix, 2 l of SP6 RNA polymerase enzyme and a calculated amount of RNase-free water to make the volume up to 20 l. The reaction was incubated at 37 ◦ C for 2 h. The probe was precipitated by adding 2.5 l 4 M LiCl and 75 l prechilled 100% ethanol to the RNA and incubated for at least 1 h at −70 ◦ C followed by centrifugation at 13,000 rpm for 10 min. Following a prechilled 70% ethanol rinse and 2 min spin, all liquid was removed by inverting the tube; the pellet was briefly air-dried and finally resuspended in 100 l TE, giving an approximate concentration of 0.1 g/l. 5 l of the probe was analyzed by gel electrophoresis to gauge the quality and quantity of probe. Cryo-sectioning and photography Embryo wings were frozen in tissue embedding medium (O.C.T., Tissue-Tek® , Sakura Finetek) and cryo-sectioned at 30 m. Sections were mounted on Tespa coated slides (Sigma-Aldrich) and the slides were then mounted using HydromountTM (National Diagnostics, Atlanta, GA, USA) coverslipped and left to dry overnight before photographing. Sections were photographed using a Leica DMRA2 microscope and DC300 camera system (Leica Microsystems, Nussloch, Germany). Whole mounted embryos and skin explants were photographed using a Nikon E990 digital camera mounted on a Nikon dissecting microscope with both lateral and transillumination. Scanning electron microscopy To check whether equally dramatic morphological effects accompanied the loss of Shh signals and disturbance of Ebf1 expression. Chick skin explants from control and cyclopamine treated samples were rinsed in PBS and fixed for 4 h in a mixture of paraformaldehyde 2.5% and glutaraldehydehyde 2.5% solution in 0.1 M phosphate buffer at 4 ◦ C. Tissues were then rinsed in phosphate buffer and postfixed in 1% osmium tetroxide (OsO4 ) for 1 h. Samples were then dehydrated through ascending ethanol series, with displacement of alcohol accomplished by three changes of acetone. Samples were then CO2 critical point dried, gold sputter coated and examined with Jeol JSM 5300 scanning electron microscope (Faculty of Medicine, Tanta University, Egypt).
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
579
cEbf1 was expressed throughout the feather placodes, but became confined to the proximal half of the feather buds at the posterior border of the wing (blue arrowhead, Fig. 1D). Transverse sections through the wing revealed that the expression is localized only in the mesenchymal core of the proximal feather buds at the posterior margin as clearly noticed in the longest and moderate buds (blue arrowhead, Fig. 1E). However, in the smallest feather buds the expression distributed throughout the mesenchymal core (Fig. 1E). Unlike cEbf1, cEbf2 and cEbf3 expression was not noticed in any feather bud in the whole examined stages from D7 to D10 (Fig. 1F and G). Regulation of cEbf1 in feather buds by Shh and Bmp4
Fig. 1. Whole mount in situ hybridization analysis of cEbf1-3 expression profile in the feather buds during HHD7-D10. (A and C) Lateral view, (B and D) dorsal view and (E) transverse section. The anterior–posterior direction for all photos was shown in (A). (A) At D7, the initial feather placodal expression of cEbf1 was in the tail (red arrowhead) and thigh (green arrowhead). (B) At D7.5, cEbf1 expression became apparent in some feather placodes in the back and the neck (white arrowheads). (C) AT D9, cEbf1 expression became evident in the majority of the feather placodes, but not yet in the wing dorsum. (D) At D10, cEbf1 labeling was detected in the dorsum of the wing. It was expressed in the entire feather placodes and the proximal half of the feather buds at the caudal edge of the wing (blue arrowhead). Blue dashed lines mark the level of (E). (E) Transverse sections through the wing at the marked level in (D). In young feather buds cEbf1 was noticed throughout the mesenchymal core however in older (longer) buds the mesenchymal expression became confined to the posterior border of the bud proximal half (blue arrowhead). (F and G) No cEbf2 (F) or cEbf3 (G) expression was detected in the feathers as was represented here in the wing of D9 chick embryo (arrowheads). Abbreviations: A, anterior; D, distal half of feather bud; Ec, ectoderm; F1, short feather bud; F2, moderate length feather bud; F3, long feather bud; Fb, feather buds; Fp, feather placodes; Ms, mesenchymal core; P, posterior; Pr, proximal half of feather bud. Scale bars; A and D = 500 m; B, C, F and G = 400 m; E = 200 m. (For interpretation of the references to color in this legend, the reader is referred to the web version of the article.)
Results Expression of cEbf1-3 genes in feathers Formation of the feather buds are normally preceded by the appearance of localized thickened cutaneous regions known as feather placodes. cEbf1 was first detected in three pairs of tail (red arrowhead, Fig. 1A) and thigh (green arrowhead, Fig. 3A) feather placodes at day 7 (D7). By D7.5, it appeared in the posterior half of few individual placodes in the back and the neck (white arrowheads, Fig. 1B). AT D9, cEbf1 expression extended throughout all the feather placodes (e.g. in the rest of tail, dorsum, and lateral aspect of thigh, shoulder, pectoral regions and posterior border of wings) (Fig. 1C). By D10, the feather placodes grew distally to form distinct feather buds. Dorsal view to the wing of D10 embryo showed that
To check this possibility, the Shh inhibitor, cyclopamine, was applied to chick skin explant cultures at an optimized concentration of 12.5 M. After 12 h, this treatment resulted in a complete downregulation of cEbf1 from the posterior domain of feather placode (magenta arrowhead, Fig. 2A, n = 5/5). However, the expression in anterior domain remained normal (green arrowhead, Fig. 2A). In contrast, the DMSO-treated control embryo displayed a unique cEbf1 expression pattern in both the anterior (green arrowhead, Fig. 2B, n = 3/3) and posterior domain (magenta arrowhead, Fig. 2B). Subsequently, cyclopamine treated explants at 24 h resulted in almost entire down-regulation of cEbf1 expression in the feather placode (arrowheads, Fig. 2C, n = 5/5), unlike the control explant which showed normal cEbf1 expression in the posterior domain (magenta arrowhead, Fig. 2D, n = 3/3). This means that Shh signals are necessary to initiate and maintain cEbf1 expression in the posterior half of the feather bud. On the other hand, at 12 h, 100 ng/ml Bmp4 protein treated skin explant revealed an initial strong upregulation of cEbf1 expression in the anterior domain of the feather placode in comparison with either the posterior domain in the same placode (compare green to magenta arrowheads, Fig. 2E, n = 5/5) or to the anterior half of the control (green arrowhead, Fig. 2F, n = 3/3). After 24 h, cEbf1 expression was expanded to the anterior domain (green arrowhead, Fig. 2G, n = 5/5), which normally lacks any labeling at this stage as shown in the control (green arrowhead, Fig. 2H, n = 3/3). These findings indicate that Bmp4 is crucial for the initial cEbf1 expression in the anterior half of the feather bud. Taken together, both Shh and Bmp4 signals are required for keeping the anterior posterior identity of cEbf1 within the developed feather, whereby Shh is responsible for the permanent posterior identity and Bmp4 for the early transient anterior identity. Effect of loss of Shh and disturbance of its downstream target cEbf1on morphology of feathers (SEM) In control HH30 embryo, SEM showed the normal progression of bud development from 12 to 48 h where it appeared as small regularly spaced swellings at 12 h (arrowhead, Fig. 3A), developed into distinct and prominent feather buds at 24 h (arrowhead, Fig. 3B), becoming increasingly prominent and well defined at 48 h (arrowhead, Fig. 3C). In cyclopamine treated cultures, little difference could be detected at 12 h and 24 h (Fig. 3D and E), however by 48 h the buds became less prominent and displayed irregular distribution pattern). In control day 4 (stage HH33) embryo, electron microscopy examination of skin explant after 48 h incubation showed normal feathers buds, which became wider anteriorly and narrower posteriorly (Fig. 3G). In contrast, a major morphological abnormality could be observed 48 h after application of cyclopamine, when the fused buds became distinct and resulted in elongated buds without distinct anterior or posterior ends (Fig. 3H). The above results revealed that the morphology of the feather buds was indeed affected by the presence of cyclopamine. Thus, the
580
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
Fig. 2. Whole mount in situ hybridization of chick skin explant cultures showed effect of Shh inhibition and Bmp4 supplementation on cEbf1 expression. (A) After 12 h of cyclopamine application (12.5 M), cEbf1 expression was completely down-regulated from the posterior (post) domain of feather placode (magenta arrowhead), but remained normal in the anterior (ant) domain (green arrowhead) as compared to the control embryo (B) which displayed a unique cEbf1 expression pattern in both the anterior (green arrowhead) and posterior domain (magenta arrowhead). (C) At 24 h, cyclopamine treated explants resulted in almost entire down-regulation of cEbf1 expression in the feather (arrowhead), unlike the control explant (D) which showed normal cEbf1 expression in the posterior domain (arrowhead). (E) Application of 100 ng/ml Bmp4 for 12 h caused up-regulation of cEbf1 expression in the anterior domain of the feather placode as compared to either the posterior domain in the same placode (compare green to magenta arrowhead) or to the anterior half of the control (F, arrowhead). (G) After 24 h, cEbf1 expression was expanded to the anterior domain (arrowhead), which normally lacks any labeling at this stage as shown in the control (H, arrowhead). (Scale bar = 100 m). (For interpretation of the references to color in this legend, the reader is referred to the web version of the article.)
abnormalities of feather development observed at the molecular level are mirrored morphologically, with an apparent loss of feather pattern. This was manifest as an expansion of feather domains that results in a loss of distinct buds and fusion of existing buds. Discussion In this study, we describe the expression of cEbf1 during the development of feathers and study the effect of Shh inhibition and Bmp4 supplementation on this expression. Both Shh and Bmp4 signals are necessary for maintenance of the permanent posterior identity and early transient anterior identity, respectively, of cEbf1 within the developed feather. In the present study, we showed for the first time that the cEbf1gene was expressed in the feather bud. Studies on Ebf1 have concentrated on nervous, lymphatic and adipose tissues (reviewed
by Dubois and Vincent, 2001; Liberg et al., 2002). For example, mouse Ebf1 gene is expressed in the neural tube from the level of the mesencephalon to the end of the spinal cord (Wang et al., 1997, 2002) and at specific sites in the embryonic prosencephalon including; the lateral ganglionic eminence (Garel et al., 1997, 2002), the basal ganglia (Lobo et al., 2006), and the facial branchiomotor neurons (Garel et al., 2000). Ebf1 is the only member of Ebf genes expressed in B cells of mice, human and chick (Akerblad and Sigvardsson, 1999; Gisler et al., 2000; Hagman and Lukin, 2005; Lin and Grosschedl, 1995; Nieminen et al., 2000) where the collaboration with other transcription factors and cofactors allows Ebf1 to direct the ultimate transcription state of target genes throughout B cell differentiation (Treiber et al., 2010). Mouse Ebf1 is also expressed throughout adipogenesis with low levels of expression in the preadipocytes and higher levels in mature adipocytes (Akerblad et al., 2002; Hagman et al., 1993). However, few studies on Ebf1 in
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
581
Fig. 3. Effect of loss of Shh and disturbance of its downstream target Ebf1 on morphology of feathers. A, B and C are control HH30 embryos. Small symmetrical swellings observed at 12 h (A), developed into distinct and prominent feather buds at 24 h (B) and 48 h (C) (arrowheads). D, E and F cyclopamine treated samples. Little effect is observed in the presence of cyclopamine at 12 h and 24 h (white arrowheads, D and E); however, fusions (red arrow) of feather buds were observed at 48 h (F). Note also that despite the fusions, the buds in the cyclopamine samples are markedly less prominent than the control samples. (G) In control HH33 embryo: after 48 h, the buds appeared normal with wider anterior and narrower posterior ends (arrowhead). (H) In the presence of cyclopamine, by 48 h, the fused buds became more apparent and resulted in elongated buds with similar two ends (arrowhead). (Scale bar = 200 m). (For interpretation of the references to color in this legend, the reader is referred to the web version of the article.)
other tissues have been performed. Previously, we reported that cEbf1 is expressed in the medial sclerotomal cells and the limb buds of chick embryos (El-Magd, 2011; El-Magd et al., 2013). Here, we showed that cEbf1 is the only member of chick Ebf genes which is expressed in the feather buds and as early as at the placode stage and that this expression increased during feather-bud development. The position of cEbf1 transcripts in the bud differs according to the order of feather buds, which in turn depends on the stage of development. During the initial stage, when the bud is still young and so called feather placode, cEbf1 expression extended throughout the mesenchymal cells of the core (dermis). This early distribution is in concert with the initial expression of Bmp2/4 in the outer epithelial covering of the feather placodes (Harris et al., 2002). After feathers became mature and grew distally, cEbf1 expression became polarized and confined to the caudal margin of the formed feather bud. This dynamic pattern of expression resembles that of Shh which is also expressed in the posterior half but in the ectodermal covering of the feather bud. However because both Shh and Bmp4 act as morphogens and are very important for normal patterning and differentiation of the feather, it is possible that these molecules can regulate cEbf1 in the feather. We have recently shown that the medial sclerotomal expression of cEbf1 is induced by Bmp4 signals from the lateral mesoderm and is maintained by Shh signals from the notochord (El-Magd, 2011). Similarly, in the present study, both Shh and Bmp4 also regulate cEbf1 expression in the feather buds. This means that cEbf1 may be a downstream target for both Shh and Bmp4 signals in different tissues. Our previous study has also showed that cEbf1 under regulation of Shh and Bmp4 plays an important role in the mediolateral
patterning of somites through keeping the identity of the medial sclerotomal cells (El-Magd, 2011). In feathers, both Shh and Bmp4 signals are also required for keeping the anterior posterior identity of cEbf1 within the developed feather, whereby Shh is responsible for the permanent posterior identity and Bmp4 for the early transient anterior identity. This raises the possibility that cEbf1 may be a novel downstream target in Shh/Bmp signaling pathway controlling the identity of the feathers. In this study, we showed that treatment with 12.5 M cyclopamine at stage 30 or 33 did not inhibit feather-bud formation but rather the buds became irregularly distributed and fused concomitant with a decrease in cEbf1 expression. Shh is not required for the initiation of either feather placodes and buds in this study or hair placodes (Nanba et al., 2003), as both placodes and buds were formed after inhibition of Shh by cyclopamine. However, another study on mouse has shown that Shh induces hair growth by proliferation in early hair development and therefore, in chick it will be expected that Shh inhibition could lead to formation of small feather buds, but with normal discrete pattern (St-Jacques et al., 1998). In contrast, we have found irregular distribution and fusion of feather buds in absence of Shh signals. We conclude that cEbf1 is expressed in the feather bud under the control of Shh and Bmp4 signals which are required for keeping the posterior and anterior identity, respectively, of cEbf1 within the developing feather. This expression suggests that cEbf1 has an important role in feather formation. However, further study on the relationships among cEbf1 and these morphogenetic signals is recommended to elucidate the processes underlying the development of feather buds.
582
M.A. El-Magd et al. / Acta Histochemica 116 (2014) 577–582
Acknowledgements The authors would like to thank Prof. Ketan Patel (School of Biological Sciences, University of Reading, Reading, UK) and Dr. Steve Allen, Dr. Imelda McGonnell (Department of Veterinary Basic Sciences, Royal Veterinary College, London, UK) for their support and useful discussion of the study. References Akerblad P, Lind U, Liberg D, Bamberg K, Sigvardsson M. Early B-cell factor (O/E-1) is a promoter of adipogenesis and involved in control of genes important for terminal adipocyte differentiation. Mol Cell Biol 2002;22:8015–25. Akerblad P, Sigvardsson M. Early B cell factor is an activator of the B lymphoid kinase promoter in early B cell development. J Immunol 1999;163:5453–61. Chuong CM. Molecular basis of epithelial appendage morphogenesis. Feather morphogenesis: a model of the formation of epithelial appendages. Landes Biosci 1998:3–14. Crozatier M, Valle D, Dubois L, Ibnsouda S, Vincent A. Collier, a novel regulator of Drosophila head development, is expressed in a single mitotic domain. Curr Biol 1996;6:707–18. Dubois L, Vincent A. The COE – Collier/Olf1/EBF – transcription factors: structural conservation and diversity of developmental functions. Mech Dev 2001;108:3–12. El-Magd MA. The function and regulation of chick Ebf genes in somite development. Saarbrücken, Germany: LAP Lambert Academic Publishing; 2011, ISBN-10: 3846590886, ISBN-13: 978-3846590881. El-Magd MA, Allen S, McGonnell I, Otto A, Patel K. Bmp4 regulates chick Ebf2 and Ebf3 gene expression in somite development. Dev Growth Differ 2013;55:710–22. Garcia-Dominguez M, Poquet C, Garel S, Charnay P. Ebf gene function is required for coupling neuronal differentiation and cell cycle exit. Development 2003;130:6013–25. Garel S, Garcia-Dominguez M, Charnay P. Control of the migratory pathway of facial branchiomotor neurones. Development 2000;127:5297–307. Garel S, Marin F, Grosschedl R, Charnay P. Ebf1 controls early cell differentiation in the embryonic striatum. Development 1999;126:5285–94. Garel S, Marin F, Mattei MG, Vesque C, Vincent A, Charnay P. Family of Ebf/Olf-1-related genes potentially involved in neuronal differentiation and regional specification in the central nervous system. Dev Dyn 1997;210:191–205. Garel S, Yun K, Grosschedl R, Rubenstein JL. The early topography of thalamocortical projections is shifted in Ebf1 and Dlx1/2 mutant mice. Development 2002;129:5621–34. Gisler R, Jacobsen SE, Sigvardsson M. Cloning of human early B-cell factor and identification of target genes suggest a conserved role in B-cell development in man and mouse. Blood 2000;96:1457–64. Hagman J, Belanger C, Travis A, Turck CW, Grosschedl R. Cloning and functional characterization of early B-cell factor, a regulator of lymphocyte-specific gene expression. Genes Dev 1993;7:760–73. Hagman J, Gutch MJ, Lin H, Grosschedl R. EBF contains a novel zinc coordination motif and multiple dimerization and transcriptional activation domains. EMBO J 1995;14:2907–16. Hagman J, Lukin K. Early B-cell factor ‘pioneers’ the way for B-cell development. Trends Immunol 2005;26:455–61. Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. J Morphol 1951;88:49–92.
Harris MP, Fallon JF, Prum RO. Shh-Bmp2 signaling module and the evolutionary origin and diversification of feathers. J Exp Zool 2002;294:160–76. Hesslein DG, Fretz JA, Xi Y, Nelson T, Zhou S, Lorenzo JA, et al. Ebf1dependent control of the osteoblast and adipocyte lineages. Bone 2009;44:537–46. Jiang TX, Jung HS, Widelitz RB, Chuong CM. Self-organization of periodic patterns by dissociated feather mesenchymal cells and the regulation of size, number and spacing of primordia. Development 1999;126:4997–9. Jung HS, Francis-West PH, Widelitz RB, Jiang TX, Ting-Berreth S, Tickle C, et al. Local inhibitory action of BMPs and their relationships with activators in feather formation: implications for periodic patterning. Dev Biol 1998;196:11–23. Liberg D, Sigvardsson M, Akerblad P. The EBF/Olf/Collier family of transcription factors: regulators of differentiation in cells originating from all three embryonal germ layers. Mol Cell Biol 2002;22:8389–97. Lin H, Grosschedl R. Failure of B-cell differentiation in mice lacking the transcription factor EBF. Nature 1995;376:263–7. Lobo MK, Karsten SL, Gray M, Geschwind DH, Yang XW. FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains. Nat Neurosci 2006;9:443–52. Mella S, Soula C, Morello D, Crozatier M, Vincent A. Expression patterns of the coe/ebf transcription factor genes during chicken and mouse limb development. Gene Expr Patterns 2004;4:537–42. Nanba D, Nakanishi Y, Hieda Y. Role of Sonic Hedgehog signaling in epithelial and mesenchymal development of hair follicles in an organ culture of embryonic mouse skin. Dev Growth Differ 2003;45:231–9. Nieminen P, Liippo J, Lassila O. Pax-5 and EBF are expressed in committed B-cell progenitors prior to the colonization of the embryonic bursa of fabricius. Scand J Immunol 2000;52: 465–9. Nieto MA, Patel K, Wilkinson DG. In situ hybridization analysis of chick embryos in whole mount and tissue sections. Methods Cell Biol 1996;51:219–35. Noramly S, Freeman A, Morgan BA. beta-catenin signaling can initiate feather bud development. Development 1999;126:3509–21. St-Jacques B, Dassule HR, Karavanova I, Botchkarev VA, Li J, Danielian PS, et al. Sonic Hedgehog signaling is essential for hair development. Curr Biol 1998;8:1058–68. Ting-Berreth SA, Chuong CM. Local delivery of TGF beta2 can substitute for placode epithelium to induce mesenchymal condensation during skin appendage morphogenesis. Dev Biol 1996a;179:347–59. Ting-Berreth SA, Chuong CM. Sonic Hedgehog in feather morphogenesis: induction of mesenchymal condensation and association with cell death. Dev Dyn 1996b;207: 157–70. Treiber T, Mandel EM, Pott S, Györy I, Firner S, Liu ET, et al. Early B cell factor 1 regulates B cell gene networks by activation, repression, and transcription-independent poising of chromatin. Immunity 2010;32:714–25. Wang SS, Betz AG, Reed RR. Cloning of a novel Olf-1/EBF-like gene O/E-4, by degenerate oligo-based direct selection. Mol Cell Neurosci 2002;20:404–14. Wang SS, Tsai RY, Reed RR. The characterization of the Olf1/EBF-like HLH transcription factor family: implications in olfactory gene regulation and neuronal development. J Neurosci 1997;17:4149–58. Yu M, Wu P, Widelitz RB, Chuong CM. The morphogenesis of feathers. Nature 2002;420:308–12.