Relative abundance of interferon-stimulated genes STAT1, OAS1, CXCL10 and MX1 in ovine lymph nodes during early pregnancy

Animal Reproduction Science 214 (2020) 106285

Contents lists available at ScienceDirect

Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci

Relative abundance of interferon-stimulated genes STAT1, OAS1, CXCL10 and MX1 in ovine lymph nodes during early pregnancy

T

Leying Zhanga,1, Lidong Caoa,1, Fei Yangb,1, Xu Hana, Yujiao Wanga, Nan Caoa, Ling Yanga,* a b

College of Life Sciences and Food Engineering, Hebei University of Engineering, Handan 056021, China College of Animal Science and Technology, Jiangsu Agri-animal Husbandry Vocational College, Taizhou 225300, China

A R T IC LE I N F O

ABS TRA CT

Keywords: Interferon-stimulated gene Lymph node Pregnancy Sheep

Lymph nodes have functions in the adaptive immune response, and interferon-tau (IFNT), a primary pregnancy recognition signal in domestic ruminants has effects on immune regulation. It, however, is unclear whether early pregnancy induces an increase in the abundance of interferon-stimulated gene (ISG) mRNA transcripts and proteins in lymph nodes of sheep. In this study, lymph nodes were obtained on day 16 of the estrous cycle from non-pregnant ewes and days 13, 16 and 25 of gestation from pregnant ewes, and the abundance of ISG mRNA transcripts, including signal transducer and activator of transcription 1 (STAT1), phosphorylated STAT1 (pSTAT1), 2′,5′-oligoadenylate synthetase (OAS1), myxovirus resistance protein 1 (MX1) and C-X-C motif chemokine 10 (CXCL10), was analyzed using real-time quantitative PCR. Furthermore, Western blot and immunohistochemistry analysis was conducted to assess relative abundance of proteins encoded by these genes. The results indicated that there was a larger abundance of STAT1 mRNA transcript and protein, and p-STAT1 protein in the maternal lymph node at days 16 and 25 of gestation, and that abundances of OAS1, MX1 and CXCL10 mRNA transcripts and protein were greatest on day 16 of gestations. In addition, STAT1 protein was located in the subcapsular sinus, lymph sinuses, B cells and T cells. The larger relative abundances of STAT1, pSTAT1, OAS1, MX1 and CXCL10 mRNA transcripts and/or protein in the lymph nodes of ewes may be associated with maternal immunoregulation through blood circulation and lymph circulation during early pregnancy.

1. Introduction The pregnancy recognition signal, interferon-tau (IFNT), is produced by the elongated conceptus in domestic ruminants (Bazer, 2013; Spencer et al., 2007). There are anti-luteolytic effects of IFNT on estrogen receptor alpha that inhibit oxytocin receptor synthesis, and prolong the lifespan of the ovarian corpus luteum (CL), which is essential for implantation and placentation (Hansen et al., 2017; Bazer et al., 2018). The ovine recombinant IFNT can inhibit the expression of luteolytic genes in enriched luteal endothelial cells of cattle, and there are also obvious effects on luteal slices in vitro (Basavaraja et al., 2017). There was an increase in the abundance of the interferon-stimulated gene product 15 (ISG15) mRNA transcript in the CL and liver after uterine vein infusion

⁎ Corresponding author at: Department of Animal Science, College of Life Sciences and Food Engineering, Hebei University of Engineering, Handan 056021, China. E-mail addresses: [email protected], [email protected] (L. Yang). 1 These authors contributed equally to this work as co-first author.

https://doi.org/10.1016/j.anireprosci.2020.106285 Received 26 June 2019; Received in revised form 7 January 2020; Accepted 16 January 2020 Available online 17 January 2020 0378-4320/ © 2020 Elsevier B.V. All rights reserved.

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

with IFNT in sheep (Bott et al., 2010). Treatment with IFNT inhibits luteal prostaglandin F2 alpha (PGF2α) synthesis, and induces an increase in abundance of interferon-stimulated gene (ISG) mRNA transcript in circulating peripheral blood mononuclear cells (PBMCs) through endocrine actions in ruminants (Hansen et al., 2017). Treatment with IFNT leads to modulation of the expression of genes, as determined by relative abundance of mRNA transcripts, in endometrial tissues and trophectoderm to promote conceptus elongation by binding to interferon (α and β) receptors of ewes (Brooks and Spencer, 2015). There are functions of IFNT at the endometrial stroma and glandular epithelium through a signal transducer and activator of transcription 1 (STAT1)/STAT2 pathway in a paracrine manner to stimulate the expression of ISG genes (Bazer and Spencer, 2006). In the uterus, for there to be induction of IFNT actions, it is required for there to be uterine receptivity and implantation of a conceptus in ruminants (Bazer and Thatcher, 2017). Embryonic IFNT activates the Janus kinase (JAK)-STAT pathway to induce the expression of ISG genes, which leads to regulation of cyclooxygenase (COX)-2 gene expression, as indicated by abundance of (COX)-2 mRNA transcript, and secretion of PGF2α from the endometria of cattle (Thatcher et al., 2001). There is an increase in protein abundance, as a result of IFNT actions, of ubiquitin cross-reactive protein ISG15 (Johnson et al., 1999), 2′,5′oligoadenylate synthetase (OAS1) (Mirando et al., 1991) and myxovirus resistance protein 1 (MX1) in the uterus as a result of paracrine actions during early pregnancy in ewes (Ott et al., 1998). In addition, IFNT is released from the uterus via the uterine vein to induce increases in abundance of RTP4 mRNA transcript in the CL of ewes (Gifford et al., 2008), that leads to an increase in the abundance of ISG15 and OAS1 in the CL and blood cells (Oliveira et al., 2008) as a result of endocrine actions during early pregnancy in sheep (Hansen et al., 2010). Results of recent studies indicate that there is an increase in the ISG15 abundance in maternal bone marrow (Yang et al., 2017a), thymus (Zhang et al., 2018), spleen (Yang et al., 2018) and lymph node (Yang et al., 2019b) during the early period of gestation in ewes. Lymph nodes are the tissues in which the adaptive immune response is induced and modified and are involved in the activation of T cells and B cells (Gasteiger et al., 2016). The cortical areas of lymph nodes contain B-cells, and medullary areas contain T-cells (Willard-Mack, 2006). The weights of lymph nodes, including lumbar, renal, and inguinal lymph nodes, increase during pregnancy in mice (Hetherington and Humber, 1977). There, however, are no obvious changes in the weights of popliteal lymph nodes, but mean white cell counts of the popliteal and iliac lymph nodes obviously decrease during early pregnancy in rats (McLean et al., 1974). Results from previous studies indicate there are marked changes in the expression of genes and proteins for progesterone (P4) receptor and P4-induced blocking factor (Yang et al., 2017b), ISG15, PG synthases, including COX-1, COX-2, PGE synthase (PTGES), a PGF synthase (aldo-keto reductase family 1, member B1, AKR1B1) (Yang et al., 2019b), and T helper cytokines (Yang et al., 2019a), in lymph nodes of ewes during early gestation. The conceptus during the early developmental stages has effects on maternal lymph nodes, and it is hypothesized that during the early stages of gestation maternal lymph node substances are stimulated to express ISGs in sheep. The objective of this study, therefore, was to ascertain the abundances of mRNA and or protein for STAT1, phosphorylated STAT1 (p-STAT1), OAS1, C-X-C motif chemokine 10 (CXCL10) and MX1 in the lymph nodes of nonpregnant and early pregnant ewes. The results may be helpful for understanding the changes in the maternal lymphatic system during early pregnancy in ruminants. 2. Materials and methods 2.1. Animals and experimental design Healthy and estrous cyclic Small-tail Han ewes (16–20 months of age) were housed at a farm in Handan, China. The experimental protocol was approved by the Hebei University of Engineering Animal Care and Use Committee, and humane animal care and handling procedures were adhered to throughout the experiments. All experiments were conducted using the guidelines of the National Standards for Laboratory Animals of China (GB 14925-2010). The ewes were randomly assigned to four groups [nonpregnant ewes, day 16 of the estrous cycle (NP16); pregnant ewes, day 13 after mating (P13); and pregnant ewes, day 16 after mating (P16); pregnant ewes, day 25 after mating (P25); n = 6 for each group], and were observed daily for estrous behavior in the presence of caudae-pididyectomized rams. The ewes assigned to the pregnant groups were mated with intact rams twice at a 12-h interval after detection of sexual receptivity (day 0), and the ewes assigned to the estrous cyclic group were not mated with intact rams. Inguinal lymph nodes were sampled from the ewes on day 16 of the estrous cycle, and days 13, 16, and 25 after mating at necropsy. Pregnancy was confirmed by detecting the presence of an apparently normal conceptus in the uterus. To ensure 18 pregnant ewes were available for the study (three groups), 36 ewes were mated with intact rams. There were seven mated ewes that were non-pregnant at the time of slaughter of the ewes, and 11 mated ewes were not slaughtered. Several sections (0.3 cm3) of lymph nodes were fixed in fresh 4 % paraformaldehyde in phosphate-buffered solution (PBS, pH 7.4), and the remaining portions of lymph nodes were frozen in liquid nitrogen until RNA or protein extraction. 2.2. RNA extraction and quantitative real-time PCR (qPCR) assay Samples of lymphatic nodes were crushed into fine powder in liquid nitrogen, and the powder was dissolved in TRIzol (Invitrogen, Carlsbad, CA, USA). Total RNA was extracted using the TRIzol reagent protocol. The RNA purity was evaluated using agarose gel (1 %) electrophoresis, and the optical density at 260/280 nm was in the range between 1.8 and 2.1. The RNA integrity was assessed by examining the 28S and 18S rRNA bands of representative samples. Genomic DNA removal and cDNA synthesis was performed using a FastQuant RT kit (with gDNase, KR106, Tiangen Biotech Co., Ltd., Beijing, China) utilizing the manufacturer’s recommendations. Reverse transcription of total RNA (1 μg) was performed in a total reaction volume of 20 ml at 42 °C for 15 min. The specified primers (Table 1) were designed and synthesized by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), and assessed using BLAST (https:// 2

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

Table 1 Primers used for RT-qPCR. Gene

Primer

Sequence

Size (bp)

STAT1

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

GTGGCGGAGAGTCTGCAGCA GGTGAGTTGGCATGCAGGGC AGCCTTCCTGAAGAGTCGTCCTAC TCCAAGCTGCTCCTTACACAGTTG CCACCACCGACAGCTCCCCT GCAGGTGTGGGCGTGAAGCA TCTAGGAACACACGCTGCAC GACACGTGGGCAGGATTGAC GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA

190

NM_001166203.1

88

XM_012097882.2

147

NM_001009753.1

108

NM_001009191.1

176

NM_001190390.1

OAS1 MX1 CXCL10 GAPDH

Accession numbers

blast.ncbi.nlm.nih.gov/Blast.cgi) procedures at the NCBI. The PCR consisted of 95 °C for 10 s, 57–65 °C (57 °C for CXCL10, 60 °C for OAS1, 63 °C for STAT1, or 65 °C for MX1) for 20 s, and 72 °C for 25 s, and the quantification cycles were 40. The PCR amplification efficiency of each pair of primers was assessed before quantification and was found to be in the acceptable range (between 0.9 and 1.1). The primer product was sequenced to assess for determining specificity, and the relative abundance of mRNA of the targeted genes was determined using a Bio-Rad CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA) in 20 μl of solution, which included 2 μl of sense and antisense primers (0.35 nM/ml concentration) for each gene. A SuperReal PreMix Plus kit (Tiangen Biotech) was used to perform the qPCR procedures, and a template that did not undergo the reverse transcription reaction served as the negative control. The melting curve was analyzed to ensure the specificity of the amplification after PCR. The 2−ΔΔCt analysis method was used to determine the relative abundance of mRNA transcripts with use of the qPCR assay utilizing the abundance of mRNA transcript for a reference gene (GAPDH) to normalize the data (Schmittgen and Livak, 2008). For the fold-change in relative abundance of mRNA transcript, the calculated mean CT values obtained from the mean of the four groups were used as reference points. 2.3. Western blot analysis Total proteins were extracted from lymphatic samples using RIPA Lysis Buffer (BL504A, Biosharp, Hefei, China), and the protein concentrations were determined using a BCA Protein Assay kit (Tiangen Biotech) with bovine serum albumin as the standard. The protein samples (10 μg/lane) were separated using 12 % SDS-PAGE, and then transferred onto polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA). Immunoblot analysis was performed using a rabbit anti-OAS1 polyclonal antibody (Abcam, Cambridge, UK, ab86343, 1:1000), a mouse anti-CXCL10 monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA, sc374092), a mouse anti-MX1 monoclonal antibody (Santa Cruz Biotechnology, sc-166412), a goat anti-STAT1 polyclonal antibody (Abcam, ab230428, 1:1000), or a mouse anti-p-STAT1 monoclonal antibody (Santa Cruz Biotechnology, sc-8394). The secondary goat anti-mouse IgG-HRP (BL001A; Biosharp) and goat anti-rabbit IgG-HRP (Biosharp, BL003A) were diluted at 1:2000. Immunoreactive proteins were detected using a pro-light HRP chemiluminescence kit (Tiangen Biotech). An anti-GAPDH antibody (Santa Cruz Biotechnology, sc-20357, 1:1000) was used as an internal control protein. Quantity One V452 (Bio-Rad Laboratories, Hercules, CA, USA) was used to digitally quantify the band intensities, and relative abundances of protein were normalized using the abundance for reference protein (GAPDH) in each group. 2.4. Immunohistochemistry analysis The fixed tissue samples were embedded in paraffin, followed by sectioning, deparaffinization and rehydration. The sections were stained with haematoxylin and eosin (HE). Antigen distributions in tissues were assessed using 0.01 M citrate buffer (pH 6.0). Endogenous peroxidase activity was blocked with 3 % hydrogen peroxide, and nonspecific binding sites were blocked using 5 % normal goat serum in PBS. Immunohistochemical localization of STAT1 in the lymph nodes was performed using the anti-STAT1 polyclonal antibody (Abcam, ab230428, 1:100). Negative control samples were used to confirm signal specificity with antiserumspecific isotype instead of the anti-STAT1 antibody at the same protein concentration. The antibody binding sites in the tissue sections were visualized using a DAB kit (Tiangen Biotech) according to the manufacturer’s instructions, and the images were obtained using a light microscope (Nikon Eclipse E800, Tokyo, Japan) with digital camera DP12. Furthermore, the images on the slides were analyzed independently by four observers, and the immunostaining intensity of the different lymph nodes from different ewes (n = 6 for each group) was rated in a blinded fashion. Histological subtypes of STAT1 staining were evaluated by assigning an immunoreactive intensity in a scale of 0–3, as described previously (Kandil et al., 2007). An intensity of 3 was assigned to the cells with the greatest staining intensity, and an intensity of 0 was assigned to the cells with no immunoreactivity. 2.5. Statistical analyses The data for the relative abundances of STAT1, MX1, OAS1 and CXCL10 mRNA transcripts and proteins were analyzed using a completely randomized design with six animals per group utilizing the Proc Mixed model in SAS (Version 9.1; SAS Institute, Cary, 3

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

Fig. 1. Relative abundances of STAT1, OAS1, MX1 and CXCL10 mRNA transcripts in the lymph nodes in nonpregnant and pregnant ewes (n = 6 for each group); NP16 = nonpregnant ewes, day 16 of estrous cycle; P13 = pregnant ewes, day 13 after mating; P16 = pregnant ewes, day 16 after mating; P25 = pregnant ewes, day 25 after mating; For the fold-change calculation, mean CT values from the mean of the four groups were considered to be 1; Differences (P < 0.05) are indicated by different letters.

NC). For lymph nodes from ewes with a different physiological status, the model contained the random effect of ewe and fixed effect of physiological status. Comparisons of the relative abundance values in the different groups were performed using the Duncan method. The data are presented as least squares means. Mean differences were considered to exist as indicated by a P-value of < 0.05.

3. Results 3.1. Relative abundances of STAT1, MX1, OAS1 and CXCL10 mRNA transcripts in lymph nodes The results with use of the RT-qPCR assay indicated the relative abundance of STAT1 mRNA transcript in the lymph nodes was larger in the P16 and P25 than in NP16 and P13 groups (P < 0.05; Fig. 1). During the early stages of pregnancy, there was a larger abundance of MX1 mRNA in the lymph nodes (P < 0.05), with the largest abundance being on day 16 of pregnancy. Furthermore, the relative abundances of OAS1 and CXCL10 mRNA transcripts in the lymph nodes were similar, with there being larger relative abundances of OAS1 and CXCL10 mRNA transcripts in the P13 and P16 than in NP16 and P25 groups (P < 0.05; Fig. 1).

3.2. Abundances of STAT1, p-STAT1, MX1, OAS1 and CXCL10 proteins in lymph nodes Results for the Western blot analysis (Fig. 2) indicated that during the early stages of pregnancy there was a larger abundance of STAT1 and p-STAT1 proteins in the lymph nodes on days 16 and 25 in pregnant ewes (P < 0.05), however, there was not detection of the p-STAT1 protein in the lymph nodes in the NP16 and P13 groups. During the early stages of pregnancy there were effects of the pregnancy on MX1 protein abundance in the lymph nodes of pregnant ewes, and the abundance of MX1 protein was largest on day 16 of pregnancy (P < 0.05; Fig. 2). In addition, the abundance of OAS1 and CXCL10 protein in the lymph nodes was largest at day 16 of pregnancy (P < 0.05), but there were very small abundances of OAS1 and CXCL10 proteins in the lymph nodes of the NP16 and P25 groups. 4

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

Fig. 2. Relative abundances of STAT1, OAS1, MX1, CXCL10 and p-STAT1 proteins in the lymph nodes in nonpregnant and pregnant ewes (n = 6 for each group); NP16 = nonpregnant ewes, day 16 of estrous cycle; P13 = pregnant ewes, day 13 after mating; P16 = pregnant ewes, day 16 after mating; P25 = pregnant ewes, day 25 after mating; To calculate relative abundances, mean gray values from GAPDH were considered to be 1; Differences (P < 0.05) are indicated by different letters within the same color column.

3.3. Immunohistochemistry for STAT1 protein in lymph nodes Immunohistochemistry results indicated that STAT1 protein was located in the subcapsular sinus, lymph sinuses, B cells and T cells (Fig. 3). The staining intensity for STAT1 protein was greater in the subcapsular sinus, lymph sinuses, B cells and T cells of the P16 and P25 than NP16 and P13 groups (Table 2). 4. Discussion Results in previous reports indicate that during early pregnancy there are effects on maternal lymph node, and induction of increased abundances of ISG15 and ISG15-conjugated proteins in sheep (Yang et al., 2019b). The results of the present study indicate 5

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

Fig. 3. Representative immunohistochemical localization of STAT1 protein in the lymph nodes from nonpregnant and pregnant ewes (n = 6 for each group); The lymph node is divided into the outer cortex (CO) and the inner medulla (ME); Lymph enters the convex through the subcapsular sinus (SS) and trabeculae around the lymphoid nodules (LN, including B cells (B)), and flows into the medulla through the lymph sinus (LS) around the medullary cord (MC, including T cells (T)); HE = stained by haematoxylin and eosin; Clt = negative control; NP16 = nonpregnant ewes, day 16 of estrous cycle; P13 = pregnant ewes, day 13 after mating; P16 = pregnant ewes, day 16 after mating; P25 = pregnant ewes, day 25 after mating; Arrows indicate the positive signals; Bar =20 μm. Table 2 Immunohistochemical assay H-score. Protein STAT1

Cell types and structures Subcapsular sinus Lymph sinuses B cell T cell

Negative control a

0 0a 0a 0a

Day 16 of estrous cycle b

Day 13 of pregnancy b

1 1b 1b 1b

1 1b 1b 1b

c

3 3c 2c 3c

Day 16 of pregnancy

Day 25 of pregnancy 3c 3c 2c 3c

Staining intensity was as follows: 0 = negative; 1 = weak; 2 = strong; 3 = stronger; Within the same row with different superscripts indicate differences (P < 0.05).

there were larger abundances of STAT1 mRNA transcript and protein, and p-STAT1 protein in maternal lymph nodes at days 16 and 25 of pregnancy. There are larger relative abundances of STAT1 mRNA transcript in the endometrial stroma and glandular epithelium during pregnancy and this is greater in the endometrium of estrous cyclic ewes when there is intrauterine administration of IFNT (Choi et al., 2001). In cattle, the administration of IFNT results in an increase in the abundance of STAT1 and 2, and interferon regulatory factor (IRF) proteins, and there are resulting anti-luteolytic effects on the endometrium as a result of activation of the JAKSTAT pathway at the time of maternal recognition of pregnancy (Binelli et al., 2001). Administration of IFNT resulted in an increase in the abundance of STAT1 protein and STAT1 which in turn binds to the IRF and suppressor of cytokine signaling gene promoters in the endometrium of cattle, which has actions in the regulation of endometrial functions during the peri-implantation period (Vitorino Carvalho et al., 2016). There are actions of IFNT in inducing increases in the abundance of STAT1 and STAT2 proteins, which functions in inducing ISGs through the JAK-STAT pathway in an ovine endometrial epithelial cell line (Stewart et al., 2001). Type I interferon affects immune responses as a result of activation of the JAK-STAT pathway (de Weerd et al., 2013), and the JAK-STAT pathway has essential functions in modulating the immune system through actions at helper T cell subsets (Seif et al., 2017). Interferon activates the JAK-STAT pathway as a result of tyrosine phosphorylation of STAT1 (Perwitasari et al., 2011). It is through the tyrosine phosphorylation of STAT1 that interferon-gamma activates the major histocompatibility complex (MHC), which mediates cell-mediated immunity in human cells (Christova et al., 2007). The increase in abundance of STAT1 and p-STAT1 proteins in maternal lymph nodes may affect the innate and adaptive immune responses of maternal lymph nodes during early pregnancy in sheep. Results from the present study indicate the abundances of OAS1 and MX1 mRNA transcripts and proteins were larger in the lymph 6

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

nodes during early pregnancy with the largest abundance being on day 16 of pregnancy. The implantation signals have effects on blood neutrophils during the peri-implantation period, and the relative abundances of ISG15, OAS1 and MX1 mRNA transcripts increase on days 12–21 post artificial insemination in pregnant cows (Manjari et al., 2016). The relative abundances of OAS1 and ISG15 mRNA transcripts in peripheral blood mononuclear leukocytes and polymorphonuclear granulocytes are larger in pregnant cows than in cows with embryonic death, and nonpregnant cows around days 18–21 after artificial insemination (Shirasuna et al., 2012). The relative abundances of OAS1, MX1, MX2 and ISG15 mRNA transcripts in PBMCs is induced by a viable conceptus between days 15 and 22, and is largest on day 20 post-timed artificial insemination in beef cattle (Pugliesi et al., 2014). There are actions of IFNT in inducing a larger abundance of OAS1 mRNA transcript in the blood cells and CL after day 15 in pregnant ewes than in nonpregnant ewes as a result of an extrauterine endocrine mechanism (Oliveira et al., 2008). The relative abundances of ISG15, MX1, MX2 and OAS1 mRNA transcripts is larger in hepatocytes on day 18 of pregnancy in Holstein Friesian heifers, and IFNT induces increases in the abundances of ISG15, MX1, MX2 and OAS1 mRNA transcripts in primary bovine hepatocytes in vitro (Ruhmann et al., 2017). The relative abundances of OAS1 and MX1 mRNA transcripts in blood neutrophils are obviously larger in pregnant cows and cows with embryonic mortality during the later as compared with earlier stages of embryonic mortality, and can be used as peripheral biomarkers for identifying embryonic mortality in the Karan Fries cows (Sheikh et al., 2018). It, therefore, has been suggested that during early gestation there are larger relative abundances of OAS1 and MX1 mRNA transcripts and proteins in the lymph node, which are implicated in the regulation of maternal lymph node function in sheep. In the present study, the abundances of CXCL10 mRNA and protein were larger in the lymph nodes at days 13 and 16 of pregnancy. The abundance of CXCL10 mRNA transcript has been reported to be larger in the endometrium at days 15 and 18 of pregnancy, and IFNT treatment leads to an increase in the relative abundance of CXCL10 mRNA transcript in the endometrium in vitro, indicating CXCL10 is implicated in regulating endometrial function during early gestational periods in cattle (Sakumoto et al., 2017). During the early gestational periods, there is an increase in the abundance of CXCL10mRNA transcript in peripheral blood leukocytes (PBLs), and treatment with IFNT leads to an increase in the abundance of CXCL10 mRNA transcript in cultured PBLs in vitro, indicating that CXCL10 has functions in regulating maternal recognition of pregnancy in cattle (Sakumoto et al., 2018). Onethird of preterm births are induced by premature prelabor rupture of the membranes (PPROM), and women with PPROM have lesser plasma concentrations of CXCL10 (Ronzoni et al., 2018). During early pregnancy and treatments with P4 and/or IFNT results in a larger relative abundance of CXCL10 mRNA transcript in endometria of ewes, which is essential for conceptus growth and adhesion to the maternal endometrium (Gray et al., 2006; Imakawa et al., 2006). The abundance of CXCL10 mRNA transcript is larger in PBMCs, which can serve as a peripheral diagnostic marker of early pregnancy in sheep (Mauffré et al., 2016). The CXCL10 protein is secreted by various cell types, including monocytes and neutrophils, which are involved in autoimmune pathogenesis because of the initiation and maintenance of T helper responses (Antonelli et al., 2014). This finding, therefore, provides supporting evidence that CXCL10 may function in the regulation of the immune response in maternal lymph nodes during early pregnancy in sheep. The immunohistochemistry results in the present study indicate STAT1 protein is located in the subcapsular sinus, lymph sinuses, B cells and T cells (Fig. 3). The staining intensity for STAT1 in the subcapsular sinus, lymph sinuses, B cells and T cells was greater at days 16 and 25 of gestation (Table 2). Lymph nodes are part of the adaptive immune system and are composed of the outer cortex and the inner medulla (von Andrian and Mempel, 2003). Lymph enters the cortex through the subcapsular sinus over each lobule, in which B-cells are located, and then flows into the medulla through the lymph sinus around the medullary cords which contain T cells (Willard-Mack, 2006). Activated effector cells, including helper T cells, migrate into the cortex and have functions in the proliferation and differentiation of B cells, and then lymphocytes migrate to the medulla, and subsequently leave the lymph nodes via the efferent lymphatics or the blood system (Buettner and Bode, 2012). The T cells function in primary immune responses, while B cells secrete antibodies (Willard-Mack, 2006). In the present study, the increase in STAT1 protein abundance indicates STAT1 was involved in the regulation of lymph node function during the early periods of gestation. It has been reported that IFNT is released from the uterus via the uterine vein and induces an increase in the abundance of ISG15, OAS1 and RTP4 mRNA transcripts in the CL, blood cells and liver (Gifford et al., 2008; Oliveira et al., 2008; Bott et al., 2010) as a result of endocrine actions in sheep (Hansen et al., 2010). It, therefore, is possible that IFNT is released from the uterus and affects the abundance of STAT1 protein in the lymph nodes via blood circulation and lymph circulation, which is implicated in the immunoregulation of maternal lymph nodes. In conclusion, during the early stages of gestation there is induction of an increase in the abundance of STAT1, p-STAT1, OAS1, MX1 and CXCL10 proteins in maternal lymph nodes, and the STAT1 protein is localized to the subcapsular sinus, lymph sinuses, B cells and T cells. It, therefore, is proposed that during the early stages of gestation there is an effect of ISGs on the subcapsular sinus, lymph sinuses, B cells and T cells of maternal lymph nodes via blood circulation and lymph circulation, and that ISG expression may be implicated in the immunoregulation of maternal lymph nodes during the early period of gestation in sheep.

Declaration of Competing Interest The authors declare no personal conflict of interest.

Acknowledgments This research was supported by the Science and Technology Project of Hebei Province, China (18236601D), and Science and Technology Research Project of Higher Education Institutions of Hebei Province, China (ZD2016069). 7

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.anireprosci. 2020.106285. References Antonelli, A., Ferrari, S.M., Giuggioli, D., Ferrannini, E., Ferri, C., Fallahi, P., 2014. Chemokine (C-X-C motif) ligand (CXCL)10 in autoimmune diseases. Autoimmun. Rev. 13, 272–280. https://doi.org/10.1016/j.autrev.2013.10.010. Basavaraja, R., Przygrodzka, E., Pawlinski, B., Gajewski, Z., Kaczmarek, M.M., Meidan, R., 2017. Interferon-tau promotes luteal endothelial cell survival and inhibits specific luteolytic genes in bovine corpus luteum. Reproduction 154, 559–568. https://doi.org/10.1530/REP-17-0290. Bazer, F.W., 2013. Pregnancy recognition signaling mechanisms in ruminants and pigs. J. Anim. Sci. Biotechnol. 4, 23. https://doi.org/10.1186/2049-1891-4-23. Bazer, F.W., Burghardt, R.C., Johnson, G.A., Spencer, T.E., Wu, G., 2018. Mechanisms for the establishment and maintenance of pregnancy: synergies from scientific collaborations. Biol. Reprod. 99, 225–241. https://doi.org/10.1093/biolre/ioy047. Bazer, F.W., Spencer, T.E., 2006. Methods for studying interferon tau stimulated genes. Methods Mol. Med. 122, 367–380. https://doi.org/10.1385/1-59259-9893:367. Bazer, F.W., Thatcher, W.W., 2017. Chronicling the discovery of interferon tau. Reproduction 154, F11–F20. https://doi.org/10.1530/REP-17-0257. Binelli, M., Subramaniam, P., Diaz, T., Johnson, G., Hansen, T.R., Badinga, L., Thatcher, W.W., 2001. Bovine interferon-tau stimulates the Janus kinase-signal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol. Reprod. 64, 654–665. https://doi.org/10.1095/biolreprod64.2.654. Bott, R.C., Ashley, R.L., Henkes, L.E., Antoniazzi, A.Q., Bruemmer, J.E., Niswender, G.D., Bazer, F.W., Spencer, T.E., Smirnova, N.P., Anthony, R.V., Hansen, T.R., 2010. Uterine vein infusion of interferon tau (IFNT) extends luteal life span in ewes. Biol. Reprod. 82, 725–735. https://doi.org/10.1095/biolreprod.109.079467. Brooks, K., Spencer, T.E., 2015. Biological roles of interferon tau (IFNT) and type I IFN receptors in elongation of the ovine conceptus. Biol. Reprod. 92, 47. https://doi. org/10.1095/biolreprod.114.124156. Buettner, M., Bode, U., 2012. Lymph node dissection–understanding the immunological function of lymph nodes. Clin. Exp. Immunol. 169, 205–212. https://doi.org/ 10.1111/j.1365-2249.2012.04602.x. Choi, Y., Johnson, G.A., Burghardt, R.C., Berghman, L.R., Joyce, M.M., Taylor, K.M., Stewart, M.D., Bazer, F.W., Spencer, T.E., 2001. Interferon regulatory factor-two restricts expression of interferon-stimulated genes to the endometrial stroma and glandular epithelium of the ovine uterus. Biol. Reprod. 65, 1038–1049. https:// doi.org/10.1095/biolreprod65.4.1038. Christova, R., Jones, T., Wu, P.J., Bolzer, A., Costa-Pereira, A.P., Watling, D., Kerr, I.M., Sheer, D., 2007. P-STAT1 mediates higher-order chromatin remodelling of the human MHC in response to IFNgamma. J. Cell. Sci. 120, 3262–3270. https://doi.org/10.1242/jcs.012328. de Weerd, N.A., Vivian, J.P., Nguyen, T.K., Mangan, N.E., Gould, J.A., Braniff, S.J., Zaker-Tabrizi, L., Fung, K.Y., Forster, S.C., Beddoe, T., Reid, H.H., Rossjohn, J., Hertzog, P.J., 2013. Structural basis of a unique interferon-β signaling axis mediated via the receptor IFNAR1. Nat. Immunol. 14, 901–907. https://doi.org/10. 1038/ni.2667. Gasteiger, G., Ataide, M., Kastenmüller, W., 2016. Lymph node - an organ for T-cell activation and pathogen defense. Immunol. Rev. 271, 200–220. https://doi.org/10. 1111/imr.12399. Gifford, C.A., Assiri, A.M., Satterfield, M.C., Spencer, T.E., Ott, T.L., 2008. Receptor transporter protein 4 (RTP4) in endometrium, ovary, and peripheral blood leukocytes of pregnant and cyclic ewes. Biol. Reprod. 79, 518–524. https://doi.org/10.1095/biolreprod.108.069468. Gray, C.A., Abbey, C.A., Beremand, P.D., Choi, Y., Farmer, J.L., Adelson, D.L., Thomas, T.L., Bazer, F.W., Spencer, T.E., 2006. Identification of endometrial genes regulated by early pregnancy, progesterone, and interferon tau in the ovine uterus. Biol. Reprod. 74, 383–394. https://doi.org/10.1095/biolreprod.105.046656. Hansen, T.R., Henkes, L.K., Ashley, R.L., Bott, R.C., Antoniazzi, A.Q., Han, H., 2010. Endocrine actions of interferon-tau in ruminants. Soc. Reprod. Fertil. Suppl. 67, 325–340. https://doi.org/10.5661/RDR-VII-325. Hansen, T.R., Sinedino, L.D.P., Spencer, T.E., 2017. Paracrine and endocrine actions of interferon tau (IFNT). Reproduction 154, F45–F59. https://doi.org/10.1530/ REP-17-0315. Hetherington, C.M., Humber, D.P., 1977. The effect of pregnancy on lymph node weight in the mouse. J. Immunogenet. 4, 271–276. https://doi.org/10.1111/j.1744313X.1977.tb00909.x. Imakawa, K., Imai, M., Sakai, A., Suzuki, M., Nagaoka, K., Sakai, S., Lee, S.R., Chang, K.T., Echternkamp, S.E., Christenson, R.K., 2006. Regulation of conceptus adhesion by endometrial CXC chemokines during the implantation period in sheep. Mol. Reprod. Dev. 73, 850–858. https://doi.org/10.1002/mrd.20496. Johnson, G.A., Spencer, T.E., Hansen, T.R., Austin, K.J., Burghardt, R.C., Bazer, F.W., 1999. Expression of the interferon tau inducible ubiquitin cross-reactive protein in the ovine uterus. Biol. Reprod. 61, 312–318. https://doi.org/10.1095/biolreprod61.1.312. Kandil, D., Leiman, G., Allegretta, M., Trotman, W., Pantanowitz, L., Goulart, R., Evans, M., 2007. Glypican-3 immunocytochemistry in liver fine-needle aspirates: a novel stain to assist in the differentiation of benign and malignant liver lesions. Cancer 111, 316–322. https://doi.org/10.1002/cncr.22954. Manjari, P., Reddi, S., Alhussien, M., Mohammed, S., De, S., Mohanty, A.K., Sivalingam, J., Dang, A.K., 2016. Neutrophil gene dynamics and plasma cytokine levels in dairy cattle during peri-implantation period. Vet. Immunol. Immunopathol. 173, 44–49. https://doi.org/10.1016/j.vetimm.2016.03.017. Mauffré, V., Grimard, B., Eozenou, C., Inghels, S., Silva, L., Giraud-Delville, C., Capo, D., Sandra, O., Constant, F., 2016. Interferon stimulated genes as peripheral diagnostic markers of early pregnancy in sheep: a critical assessment. Animal 10, 1856–1863. https://doi.org/10.1017/S175173111600077X. McLean, J.M., Mosley, J.G., Gibbs, A.C., 1974. Changes in the thymus, spleen and lymph nodes during pregnancy and lactation in the rat. J. Anat. 118, 223–229. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1231503/. Mirando, M.A., Short Jr, E.C., Geisert, R.D., Vallet, J.L., Bazer, F.W., 1991. Stimulation of 2’,5’-oligoadenylate synthetase activity in sheep endometrium during pregnancy, by intrauterine infusion of ovine trophoblast protein-1, and by intramuscular administration of recombinant bovine interferon-alpha I1. J. Reprod. Fertil. 93, 599–607. https://doi.org/10.1530/jrf.0.0930599. Oliveira, J.F., Henkes, L.E., Ashley, R.L., Purcell, S.H., Smirnova, N.P., Veeramachaneni, D.N., Anthony, R.V., Hansen, T.R., 2008. Expression of interferon (IFN)stimulated genes in extrauterine tissues during early pregnancy in sheep is the consequence of endocrine IFN-tau release from the uterine vein. Endocrinology 149, 1252–1259. https://doi.org/10.1210/en.2007-0863. Ott, T.L., Yin, J., Wiley, A.A., Kim, H.T., Gerami-Naini, B., Spencer, T.E., Bartol, F.F., Burghardt, R.C., Bazer, F.W., 1998. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol. Reprod. 59, 784–794. https://doi.org/10.1095/biolreprod59.4.784. Pugliesi, G., Miagawa, B.T., Paiva, Y.N., França, M.R., Silva, L.A., Binelli, M., 2014. Conceptus-induced changes in the gene expression of blood immune cells and the ultrasound-accessed luteal function in beef cattle: how early can we detect pregnancy? Biol. Reprod. 91, 95. https://doi.org/10.1095/biolreprod.114.121525. Perwitasari, O., Cho, H., Diamond, M.S., Gale, M.Jr., 2011. Inhibitor of κB kinase epsilon (IKK(epsilon)), STAT1, and IFIT2 proteins define novel innate immune effector pathway against West Nile virus infection. J. Biol. Chem. 286, 44412–44423. https://doi.org/10.1074/jbc.M111.285205. Ronzoni, S., Steckle, V., D’Souza, R., Murphy, K.E., Lye, S., Shynlova, O., 2018. Cytokine changes in maternal peripheral blood correlate with time-to-delivery in pregnancies complicated by premature prelabor rupture of the membranes. Reprod. Sci. https://doi.org/10.1177/1933719118815590. First Published December 12, 2018. Ruhmann, B., Giller, K., Hankele, A.K., Ulbrich, S.E., Schmicke, M., 2017. Interferon-τ induced gene expression in bovine hepatocytes during early pregnancy. Theriogenology 104, 198–204. https://doi.org/10.1016/j.theriogenology.2017.07.051. Sakumoto, R., Hayashi, K.G., Fujii, S., Kanahara, H., Hosoe, M., Furusawa, T., Kizaki, K., 2017. Possible roles of CC- and CXC-chemokines in regulating bovine endometrial function during early pregnancy. Int. J. Mol. Sci. 18, E742. https://doi.org/10.3390/ijms18040742. Sakumoto, R., Iga, K., Hayashi, K.G., Fujii, S., Kanahara, H., Hosoe, M., Furusawa, T., 2018. Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes

8

Animal Reproduction Science 214 (2020) 106285

L. Zhang, et al.

during early pregnancy in cows. J. Anim. Sci. Biotechnol. 9, 46. https://doi.org/10.1186/s40104-018-0263-z. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108. https://doi.org/10.1038/nprot. 2008.73. Seif, F., Khoshmirsafa, M., Aazami, H., Mohsenzadegan, M., Sedighi, G., Bahar, M., 2017. The role of JAK-STAT signaling pathway and its regulators in the fate of T helper cells. Cell Commun. Signal 15, 23. https://doi.org/10.1186/s12964-017-0177-y. Sheikh, A.A., Hooda, O.K., Kalyan, A., Kamboj, A., Mohammed, S., Alhussien, M., Reddi, S., Shimray, P.G., Rautela, A., Pandita, S., Kapila, S., De, S., Dang, A.K., 2018. Interferon-tau stimulated gene expression: a proxy to predict embryonic mortality in dairy cows. Theriogenology 120, 61–67. https://doi.org/10.1016/j. theriogenology.2018.07.028. Shirasuna, K., Matsumoto, H., Kobayashi, E., Nitta, A., Haneda, S., Matsui, M., Kawashima, C., Kida, K., Shimizu, T., Miyamoto, A., 2012. Upregulation of interferonstimulated genes and interleukin-10 in peripheral blood immune cells during early pregnancy in dairy cows. J. Reprod. Dev. 58, 84–90. https://doi.org/10.1262/ jrd.11-094k. Spencer, T.E., Johnson, G.A., Bazer, F.W., Burghardt, R.C., 2007. Fetal-maternal interactions during the establishment of pregnancy in ruminants. Soc. Reprod. Fertil. Suppl. 64, 379–396. https://doi.org/10.5661/RDR-VI-379. Stewart, M.D., Johnson, G.A., Vyhlidal, C.A., Burghardt, R.C., Safe, S.H., Yu-Lee, L.Y., Bazer, F.W., Spencer, T.E., 2001. Interferon-tau activates multiple signal transducer and activator of transcription proteins and has complex effects on interferon-responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 142, 98–107. https://doi.org/10.1210/endo.142.1.7891. Thatcher, W.W., Guzeloglu, A., Mattos, R., Binelli, M., Hansen, T.R., Pru, J.K., 2001. Uterine-conceptus interactions and reproductive failure in cattle. Theriogenology 56, 1435–1450. https://doi.org/10.1016/S0093-691X(01)00645-8. Vitorino Carvalho, A., Eozenou, C., Healey, G.D., Forde, N., Reinaud, P., Chebrout, M., Gall, L., Rodde, N., Padilla, A.L., Delville, C.G., Leveugle, M., Richard, C., Sheldon, I.M., Lonergan, P., Jolivet, G., Sandra, O., 2016. Analysis of STAT1 expression and biological activity reveals interferon-tau-dependent STAT1-regulated SOCS genes in the bovine endometrium. Reprod. Fertil. Dev. 28, 459–474. https://doi.org/10.1071/RD14034. von Andrian, U.H., Mempel, T.R., 2003. Homing and cellular traffic in lymph nodes. Nat. Rev. Immunol. 3, 867–878. https://doi.org/10.1038/nri1222. Willard-Mack, C.L., 2006. Normal structure, function, and histology of lymph nodes. Toxicol. Pathol. 34, 409–424. https://doi.org/10.1080/01926230600867727. Yang, L., Liu, B., Yan, X., Zhang, L., Gao, F., Liu, Z., 2017a. Expression of ISG15 in bone marrow during early pregnancy in ewes. Kafkas Univ. Vet. Fak. Derg. 23, 767–772. https://doi.org/10.9775/kvfd.2017.17726. Yang, L., Liu, Y., Lv, W., Wang, P., Wang, B., Xue, J., Zhang, L., 2018. Expression of interferon-stimulated gene 15-kDa protein, cyclooxygenase (COX) 1, COX-2, aldoketo reductase family 1, member B1, and prostaglandin E synthase in the spleen during early pregnancy in sheep. Anim. Sci. J. 89, 1540–1548. https://doi.org/10. 1111/asj.13101. Yang, L., Wang, P., Mi, H., Lv, W., Liu, B., Du, J., Zhang, L., 2019a. Comparison of Th1 and Th2 cytokines production in ovine lymph nodes during early pregnancy. Theriogenology 123, 177–184. https://doi.org/10.1016/j.theriogenology.2018.10.004. Yang, L., Wang, Q., Liu, Y., Zhang, L., Lv, W., Liu, B., 2019b. Expression profiles of interferon-stimulated gene 15 and prostaglandin synthases in the ovine lymph nodes during early pregnancy. Mol. Reprod. Dev. 86, 100–108. https://doi.org/10.1002/mrd.23085. Yang, L., Zang, S., Bai, Y., Yao, X., Zhang, L., 2017b. Effect of early pregnancy on the expression of progesterone receptor and progesterone-induced blocking factor in ovine lymph node. Theriogenology 93, 78–83. https://doi.org/10.1016/j.theriogenology.2017.01.042. Zhang, L., Xue, J., Wang, Q., Lv, W., Mi, H., Liu, Y., Yang, L., 2018. Changes in expression of ISG15, progesterone receptor and progesterone-induced blocking factor in ovine thymus during early pregnancy. Theriogenology 121, 153–159. https://doi.org/10.1016/j.theriogenology.2018.08.018.

9