RAGE-dependent activation of microglia via NF-κB and AP-1

Neurobiology of Aging 31 (2010) 665–677

S100B/RAGE-dependent activation of microglia via NF-␬B and AP-1 Co-regulation of COX-2 expression by S100B, IL-1␤ and TNF-␣ Roberta Bianchi, Ileana Giambanco, Rosario Donato ∗ Department of Experimental Medicine and Biochemical Sciences, University of Perugia, C.P. 81 Succ. 3, 06122 Perugia, Italy Received 2 October 2007; received in revised form 9 May 2008; accepted 18 May 2008 Available online 2 July 2008

Abstract Extracellular S100B is known to affect astrocytic, neuronal and microglial activities, with different effects depending on its concentration. Whereas at relatively low concentrations S100B exerts trophic effects on neurons and astrocytes, at relatively high concentrations the protein causes neuronal apoptosis and activates astrocytes and microglia, thus potentially representing an endogenous factor implicated in neuroinflammation. We have reported that RAGE ligation by S100B in BV-2 microglia results in the upregulation of expression of the proinflammatory cyclo-oxygenase 2 (COX-2) via parallel Ras-Cdc42-Rac1-dependent activation of c-Jun NH2 terminal protein kinase (JNK) and Ras-Rac1-dependent stimulation of NF-␬B transcriptional activity. We show here that: (1) S100B also stimulates AP-1 transcriptional activity in microglia via RAGE-dependent activation of JNK; (2) S100B upregulates IL-1␤ and TNF-␣ expression in microglia via RAGE engagement; and (3) S100B/RAGE-induced upregulation of COX-2, IL-1␤ and TNF-␣ expression requires the concurrent activation of NF-␬B and AP-1. We also show that S100B synergizes with IL-1␤ and TNF-␣ to upregulate on COX-2 expression in microglia. Given the crucial roles of COX-2, IL-1␤ and TNF-␣ in the inflammatory response, we propose that, by engaging RAGE, S100B might play an important role in microglia activation in the course of brain damage. © 2008 Elsevier Inc. All rights reserved. Keywords: S100B; RAGE; Microglia; IL-1␤; TNF-␣; COX-2; NF-␬B; AP-1

1. Introduction Besides being implicated in the regulation of intracellular activities, the Ca2+ -binding protein of the EF-hand type, S100B, is also secreted into extracellular fluids and found in serum thereby affecting cellular activities in a paracrine, autocrine and endocrine manner (Donato, 2001; Heizmann et al., 2002; Van Eldik and Wainwright, 2003). Astrocytes, which represent the cell type with the highest expression of the protein (Donato, 2001), release S100B constitutively (Van Eldik and Zimmer, 1987), and increases in S100B release occur upon astrocyte stimulation with several agents (Ciccarelli et al., 1999; Pinto et al., 2000; ∗ Corresponding author at: Department of Experimental Medicine and Biochemical Sciences, Sect. Anatomy, University of Perugia, Via del Giochetto C.P. 81 Succ. 3, 06122 Perugia, Italy. Tel.: +39 075 585 7453; fax: +39 075 585 7451. E-mail address: [email protected] (R. Donato).

0197-4580/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.neurobiolaging.2008.05.017

Whitaker-Azmitia et al., 1990), including tumor necrosis factor (TNF)-␣ (Edwards and Robinson, 2006). At the subnanomolar to nanomolar concentrations found in the brain extracellular space under normal conditions S100B acts as neurotrophic factor, promoting neuronal survival under stress conditions and neurite outgrowth (Huttunen et al., 2000; Kligman and Marshak, 1985; Winningham-Major et al., 1989), countering the stimulatory effect of the neurotoxicant, trimethyltin, on TNF-␣ release by microglia (Reali et al., 2005) and stimulating the uptake of the cytotoxic glutamate by astrocytes (Tramontina et al., 2006). Thus, secreted S100B can be viewed as a factor involved in astrocyteneuron communication, which might be important during brain development and during the initial phases of brain insults acting as a protective agent towards neurons. However, following accumulation in the brain extracellular space S100B may be detrimental to astrocytes and neurons causing their death by apoptosis (Donato, 2001; Heizmann et al., 2002; Hu et al., 1997; Huttunen et al.,

666

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

2000; Van Eldik and Wainwright, 2003). Increases in brain S100B levels occur in Alzheimer’s disease, chronic epilepsy, Down’s syndrome, HIV infection and other brain pathological conditions (Donato, 2001; Heizmann et al., 2002; Griffin et al., 1998; Mrak and Griffin, 2001; Van Eldik and Wainwright, 2003). Notably, the human S100B gene maps to chromosome 21q22.23 (Allore et al., 1988), with consequent overexpression of S100B in Down’s syndrome. Trophic effects of the protein on neurons depend on interaction with the receptor for advanced glycation end products (RAGE) (Huttunen et al., 2000), a multiligand receptor belonging to the immunoglobulin superfamily that has been implicated in both neuroprotection and neurodegeneration, and in the inflammatory response (Bierhaus et al., 2005; Schmidt et al., 2001). On the other hand, acute stimulation of RAGE with relatively high doses of S100B causes neuronal apoptosis via excessive activation of extracellular signal-regulated kinase (ERK)1/2 and overproduction of reactive oxygen species (ROS) (Huttunen et al., 2000). Also, at relatively high doses S100B stimulates inducible nitric oxide synthase (iNOS) in astrocytes and microglia by synergizing with lipid A and interferon-␥ in the case of microglia (Adami et al., 2001; Hu et al., 1996; Petrova et al., 2000), which might contribute to astrocytic and neuronal apoptosis via increased NO production (Hu et al., 1997). Moreover, S100B stimulates interleukin (IL)-1␤ release from microglia (Kim et al., 2004), although the receptor transducing this effect is not known. Thus, S100B might participate in the brain inflammatory response. However, despite the ability of S100B to activate RAGE in microglia (Hofmann et al., 1999), S100B-induced stimulation of iNOS activity in these cells proved independent of RAGE transducing activity, though dependent on ROS production and the density of RAGE extracellular domain in microglia (Adami et al., 2004). This suggests the possibility that RAGE might concentrate S100B at the microglial cell surface thereby favoring an S100B-dependent, RAGE signaling-independent stimulation of NO release through ROS overproduction via a mechanism to be elucidated. Yet, S100B binding to RAGE in microglia in the absence of cofactors was shown to cause activation of the transcription factor NF-␬B (Adami et al., 2004; Hofmann et al., 1999), suggesting that binding of S100B might stimulate RAGE transducing activity and expression of proinflammatory genes. Accordingly, S100B was shown to upregulate the expression of the proinflammatory enzyme, cyclo-oxygenase 2 (COX-2), and to stimulate PGE2 secretion in circulating monocytes in a RAGE- and NF-␬B-dependent manner (Shanmugam et al., 2003). Recently, we reported that S100B upregulates the expression of COX-2 in microglia in a dose- and RAGE-dependent manner via parallel activation of NF-␬B and c-Jun NH2 terminal protein kinase (JNK) (Bianchi et al., 2007). However, the blockade of ERK1/2 and p38 mitogen-activated protein kinase (MAPK) activities, which are known to activate NF-␬B in monocytes/macrophages/microglia (reviewed in Block and Hong, 2005; Hauwel et al., 2005; Kim and de Vellis, 2005; Town et

al., 2005), did not affect S100B’s ability to upregulate COX2 expression in microglia (Bianchi et al., 2007). We show here that S100B/RAGE-induced upregulation of COX-2 in the presence of inhibited p38 MAPK and ERK1/2 is dependent on parallel activation of a Rac1/JNK/AP-1 pathway and a Rac1/NF-␬B pathway. We also show that by engaging RAGE in microglia, S100B upregulates IL-1␤ and TNF-␣ expression via concurrent stimulation of NF-␬B and AP-1 transcriptional activity and synergizes with IL-1␤ and TNF-␣ to upregulate COX-2 expression.

2. Materials and methods 2.1. Protein purification Recombinant bovine S100B, which is 97% identical to mouse S100B, was expressed and purified as reported (Donato, 1988; Huttunen et al., 2000). S100B was passed through END-X B15 Endotoxin Affinity Resin column (Associated of Cape Cod) to remove contaminating bacterial endotoxin. Residual bacterial endotoxin was evaluated using the chromogenic Limulus amoebocyte lysates assay (Associated of Cape Cod). These tests indicated that bacterial endotoxin in the S100B preparation after passage through the END-X B15 Endotoxin Affinity Resin amounted to <0.2 pg/␮g. As a further test aimed at verifying whether contaminating bacterial endotoxin could be responsible for effects of S100B on microglia, a sample of the S100B preparation was heated at 100 ◦ C for 5 min before use. No effects of the protein on microglia were registered following this procedure. The S100B concentration was calculated using the Mr of the S100B dimer, i.e. 21 kDa. 2.2. Cell culture The murine BV-2 microglial cell line was obtained and characterized as described (Adami et al., 2001; Blasi et al., 1990; Bocchini et al., 1992). Cells were cultivated in RPMI containing 10% heat inactivated fetal bovine serum (FBS) (Hyclone Laboratories, Lagan, UK) supplemented with l-glutamine (4 mM) and gentamicin (5 ␮g/ml) in H2 Osaturated 5% CO2 atmosphere at 37 ◦ C. BV-2 microglia were tested periodically and resulted negative for mycoplasma contamination. Primary microglia were isolated from 6-dayold rat brain, characterized and cultivated as described (Levi et al., 1993). 2.3. Transfections BV-2 microglia stably transfected with human RAGE cDNA (BV-2/RAGE microglia), human RAGEcyto cDNA (BV-2/RAGEcyto microglia) or empty vector (BV-2/mock microglia) were obtained as described (Bianchi et al., 2007). RAGEcyto is a RAGE mutant lacking the cytoplasmic and transducing domain (Hofmann et al., 1999; Huttunen

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

et al., 1999). BV-2/wt microglia express RAGE (Adami et al., 2004; Hofmann et al., 1999), and BV-2/RAGE microglia express larger amounts of the receptor compared with wild-type BV-2 microglia while BV-2/RAGEcyto microglia express endogenous RAGE plus the signalingdeficient RAGE mutant, RAGEcyto (Adami et al., 2004). Transient transfections were carried out using Lipofectamine 2000 as recommended by the manufacturer. Briefly, cells cultured in 10% FBS without antibiotics were transfected with p65 NF-␬B-luc reporter gene, AP-1-luc reporter gene (BD Biosciences, Clontech) or empty vector (pBIIX-luc for NF␬B and pUC18-luc for AP-1). After 6 h, cells were shifted to 10% FBS for 20 h and then to 10% FBS containing no additions or S100B plus or minus 30 ␮M PD98059 (an inhibitor of the ERK1/2 upstream kinase, MAP kinase kinase [MEK]) (Calbiochem), 5 ␮M SB203580 (an inhibitor of p38 mitogen-activated protein kinase [MAPK]) (Calbiochem), 10 ␮M LY294002 (an inhibitor of phosphatydilinositol-3kinase [PI3-K]) (Alexis), 20 ␮M SP600125 (an inhibitor of JNK) (Calbiochem), or 50 ␮M NSC23766 (an inhibitor of Rac1) (Calbiochem). After another 9 h cells were harvested to measure luciferase activity by Luciferase Reporter Gene Assay Constant Light Signal (Roche). Transfection efficiency was estimated by transfecting parallel cells with green fluorescent protein (GFP) cDNA. The percentage of GFP-positive cells (20–25%) was determined by fluorescence-activated cell sorter analysis. Parallel cells were analyzed for viability by trypan-blue exclusion assay and by a tetrazolium-based (MTT) colorimetric assay. No significant changes could be registered in the number of cells transfected with expression plasmids or empty vector (data not shown). 2.4. Treatment of microglia BV-2/mock, BV-2/RAGE and BV-2/RAGEcyto microglia (5 × 105 ) were seeded in 24-multiwell plates in the presence or absence of S100B. Each sample was tested in triplicate. Where appropriate, the kinase inhibitors above were used. In some experiments, the NF-␬B inhibitor, Bay 11–7082 (5 ␮M) (Calbiochem) or the Rac1 inhibitor, NSC23766 (50 ␮M) was used. Where used, inhibitors were added 30–45 min in advance of S100B. In some experiments, TNF-␣ (Sigma) or IL-1␤ (Sigma) was added to cells with or without S100B. In some experiments with primary microglia, a RAGE-neutralizing antibody (N16, Santa Cruz Biotechnology, 50 ␮g/ml) (Sorci et al., 2004) was added to the cells with or without S100B, while control cells received 50 ␮g/ml of non-immune IgG. 2.5. Western blot analyses BV-2 microglia (5 × 105 ) were seeded in 24-multiwell plates and cultivated in the presence or absence of S100B, TNF-␣ or IL-1␤. Cells were then solubilized with 2.5% SDS, 10 mM Tris–HCl, pH 7.4, 0.1 M dithiothreitol, 0.1 mM TPCK protease inhibitor (Roche) for Western blot anal-

667

yses. COX-2 was detected in BV-2 cell and rat brain microglia extracts by Western blotting using a polyclonal anti-COX-2 antibody (1:1000, Santa Cruz Biotechnology). RAGE was detected by a similar procedure using a monoclonal anti-RAGE antibody directed against RAGE extracellular domain (1:2000, Chemicon International). Phosphorylated JNK, ERK1/2, p38 MAPK and p65 NF-␬B were detected using a polyclonal anti-phosphorylated JNK (Thr183/Tyr185) antibody (1:1000) (Cell Signaling Technology), a polyclonal anti-phosphorylated (Thr202/Tyr204) ERK1/2 antibody (1:2,000, New England BioLabs), a polyclonal anti-phosphorylated (Thr180/Tyr182) p38 MAPK antibody (1:1000, New England BioLabs), and a polyclonal anti-phosphorylated (Thr534) p65 NF-␬B (1:1000, Cell Signaling Technology) antibody, respectively. Total ERK1/2, p38 MAPK and p65 NF-␬B were detected using a polyclonal anti-ERK1/2 antibody (1:20,000, Sigma), a polyclonal antip38 MAPK antibody (1:2000, New England BioLabs), and a polyclonal anti-p65 NF-␬B antibody (1:1000, Santa Cruz Biotechnology), respectively. A monoclonal anti-␣-tubulin (1:10,000, Sigma) was used to monitor protein loading on SDS gels. Peroxidase-conjugated secondary antibodies were from Sigma. Antibodies were diluted in blocking buffer (10 mM Tris–HCl, pH 7.4, 0.1 M NaCl, 5% nonfat dried milk powder, 0.1% Tween-20). The immune reaction was developed by enhanced chemiluminescence (ECL) (SuperSignal West Pico, Pierce). 2.6. Reverse transcriptase-PCR and real-time PCR BV-2/mock, BV-2/RAGE and BV-2/RAGEcyto microglia were incubated for 1 h with or without S100B in the absence or presence of 30 ␮M PD98059, 5 ␮M SB203580, 20 ␮M SP600125 or 5 ␮M Bay 11-7082. Total cytoplasmic RNA was isolated from BV-2 microglia using the TRI-ZOL Reagent method. The expression of IL-1␤ and TNF-␣ was analyzed by reverse transcriptase (RT)-PCR using the following IL-1␤- and TNF-␣-specific oligonucleotides: (5 –3 ) TCCCCAAAGGGATGAGAAGTT (forward primer) (300 nM) and (5 –3 ) TCATACCAGGGTTTGAGCTCAG (reverse primer 1) (300 nM) for IL-1␤ (30 cycles) and (5 –3 ) TGTTTCCATCCTGGAAGGTC (forward primer) (300 nM) and (5 –3 ) TCACAGCAGCACATCAACAA (reverse primer 1) (300 nM) for TNF-␣ (30 cycles). The following oligonucleotide forward and reverse sequences were used for GAPDH: CCTTCATTGACCTCAACTACATGG and AGTCTTCTGGGTGGCAGTGATGG. After a 10-min incubation at 95 ◦ C, 28 cycles were performed using a DNA Thermal Cycler 480 (Perkin–Elmer) as follows: GAPDH and IL-1␤, denaturation at 94 ◦ C for 45 s, annealing at 55 ◦ C for 45 s, extension at 72 ◦ C for 1 min; TNF-␣, denaturation at 94 ◦ C for 1 min, annealing at 58 ◦ C for 2.5 min, extension at 72 ◦ C for 60 s, followed by 10 min at 72 ◦ C. After amplification, 20 ␮l of each sample were electrophoresed on a 2.0% (w/v) agarose gel and reverse transcriptase polymerase chain reaction (RT-PCR) products

668

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

were revealed by staining the gel with ethidium bromide. The expected PCR products were 112 bp for mouse IL-1␤, 411 bp for mouse TNF-␣ and 654 bp for GAPDH. To detect IL-1␤ and TNF-␣ mRNAs by real-time PCR, cDNA (0.1 ␮g/sample) was incubated with primers 5 TCCCCAAAGGGATGAGAAGTT3 and 5 TCATACCAGGGTTTGAGCTCAG3 for IL-1␤ and 5 ACGGCATGGATCTCAAAGAC3 and 5 GTGGGTGAGGAGCACGTAGT3 for TNF-␣ in a reaction volume of 20 ␮l containing Real Master Mix and SYBR solution (Eppendorf). Reaction mixtures were incubated in a thermocycler (Stratagene) and analyzed by Multiplex Quantitative PCR System. Housekeeping ␤actin mRNA was used as a control (primers: 5 AGCCATGTACGTAGCCATCC3 and 5 CTCTCAGCTGTGGTGGTGAA3 ). 2.7. Determination of TNF-α by ELISA BV-2/mock, BV-2/RAGE and BV-2/RAGEcyto microglia (1 × 106 /ml) were seeded in the presence or absence of S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580, 20 ␮M SP600125 or 5 ␮M Bay 11–7082. After 9 h, culture media were taken up, centrifuged and subjected to ELISA using a commercial kit (Euroclone murine TNF-␣) to measure TNF-␣. Each sample was tested in triplicate. 2.8. Statistical analysis Each experiment was repeated at least three times. Representative experiments are depicted in the figures unless stated otherwise. The data were subjected to analysis of variance (ANOVA) with SNK post hoc analysis using a statistical software package (GraphPad Prism version 4.00, GraphPad Software, San Diego, CA, www.graphpad.com). Statistical significance was assumed when p < 0.05.

3. Results 3.1. S100B stimulates NF-κB transcriptional activity in BV-2 microglia via RAGE-dependent activation of p38 MAPK and MEK-ERK1/2, and JNK modulates this effect S100B was shown to stimulate NF-␬B transcriptional activity via RAGE engagement (Adami et al., 2004; Hofmann et al., 1999) and RAGE-dependent activation of a Ras-Rac1 module (Bianchi et al., 2007), and to stimulate p38 MAPK, ERK1/2 and JNK activities in microglia (Adami et al., 2004; Bianchi et al., 2007; Hofmann et al., 1999; Kim et al., 2004). However, whereas the blockade of either JNK or NF-␬B resulted in abolition of S100B/RAGE-induced upregulation of COX-2 in microglia, the blockade of ERK1/2 and p38 MAPK activities did not affect S100B’s ability to upregulate COX-2 expression (Bianchi et al., 2007) although p38 MAPK and ERK1/2 are known to activate NF-␬B in monocytes/macrophages/microglia (reviewed in Block

and Hong, 2005; Hauwel et al., 2005; Kim and de Vellis, 2005; Town et al., 2005). To explain this inconsistency, we first addressed the question what relationship, if any, exists between S100B/RAGE-induced activation of p38 MAPK, ERK1/2 and JNK and S100B/RAGE-dependent stimulation of NF-␬B transcriptional activity in microglia. Thus, we analyzed S100B effects on NF-␬B transcriptional activity in BV-2 microglia stably transfected with full-length RAGE (BV-2/RAGE microglia), RAGEcyto (BV-2/RAGEcyto microglia) and in mock-transfected BV-2 microglia (BV2/mock microglia), in the absence or presence of the p38 MAPK inhibitor, SB203580, the MEK/ERK1/2 inhibitor, PD98059, or the JNK inhibitor, SP600125. Basal levels of NF-␬B transcriptional activity in BV-2/mock microglia were two times higher than in BV2/RAGEcyto microglia and 65% lower than in BV-2/RAGE microglia (Fig. 1). Inactivation of either p38 MAPK, the ERK1/2 upstream kinase, MEK, or both resulted in reduction but not abolition S100B/RAGE-stimulated NF␬B transcriptional activity in BV-2/mock and BV-2/RAGE microglia, and no effects in BV-2/RAGEcyto microglia (Fig. 1). By contrast, inactivation of JNK resulted in no effects on basal NF-␬B transcriptional activity in BV2/mock and BV-2/RAGEcyto microglia, in a significant (∼30%) stimulation of NF-␬B transcriptional activity in S100B-treated BV-2/mock microglia, in a slight stimulation of basal NF-␬B transcriptional activity in BV-2/RAGE microglia, and in a two-fold stimulation in S100B-treated BV-2/RAGE microglia (Fig. 1). These latter data established that S100B/RAGE also stimulated NF-␬B transcriptional activity in BV-2 microglia via activation of p38 MAPK and MEK-ERK1/2 in part, and that S100B/RAGE-activated JNK activity might reduce S100B/RAGE-stimulated p38 MAPKand/or MEK-ERK1/2-dependent NF-␬B activation. Indeed, in BV-2 microglia treated simultaneously with SB203580 and SP600125 or with PD98059 and SP600125 we registered a reduction, though again not abolition of S100B/RAGEdependent stimulation of NF-␬B transcriptional activity (Fig. 1). However, transfection of BV-2 microglia with dominant negative Ras, Ccd42 or Rac1 each resulted in the abolition of S100B-stimulated NF-␬B transcriptional activity and JNK activation, and the blockade of NF-␬B with the NF-␬B inhibitor, Bay 11-7082, completely blocked S100B/RAGE-dependent NF-␬B activation without interfering with the ability of S100B to stimulate JNK activation (Bianchi et al., 2007). We also found that inhibition of PI3K did not interfere with the ability of S100B/RAGE to stimulate NF-␬B transcriptional activity in BV-2/mock and BV-2/RAGE microglia (Fig. 1). Collectively, these results suggested that p38 MAPK, MEK-ERK1/2 and JNK might influence each other with respect to S100B/RAGE-dependent activation of NF-␬B. A negative cross-talk between NF-␬B and JNK has been described by which NF-␬B reduces JNK activity (Tang et al., 2001), and, recently, enhancement of NF-␬B activity following inhibition of JNK has been reported (Polk et al., 2007). An analysis of the molecular mechanism

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

Fig. 1. S100B/RAGE-dependent activation of NF-␬B transcriptional activity via MEK-ERK1/2 and p38 MAPK in BV-2 microglia, and modulatory effects of JNK. (A–C) BV-2/mock (A), BV-2/RAGEcyto (B) and BV2/RAGE (C) microglia were transiently transfected with NF-␬B-luc reporter gene or empty vector, cultivated for 6 h in the absence or presence of 1 ␮M S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580, 10 ␮M LY294002 or 20 ␮M SP600125. * Significantly different from control (first column from left in panels A–C). ** Significantly different from cells treated with inhibitors in the absence of S100B and from cells treated with S100B in the absence of inhibitors (A). *** Significantly different from control (first column from left), from cells treated with S100B in the absence of inhibitors and from cells treated with inhibitor in the absence of S100B (panels A and C). # Significantly different from control (first column from left) and from cells treated with inhibitor in the absence of S100B (panel C).

by which inhibition of JNK results in an enhancement of S100B/RAGE-induced stimulation of NF-␬B transcriptional activity in microglia is beyond the scope of the present work. 3.2. Rac1 activity is necessary and sufficient for S100B/RAGE-dependent stimulation of NF-κB and AP-1 transcriptional activity: concurrent activity of NF-κB and AP-1 is required for S100B to upregulate COX-2 To analyze reciprocal influences of p38 MAPK, MEKERK1/2 and JNK in microglia, we monitored effects of treatment of BV-2 cells with pharmacological inhibitors, in

669

Fig. 2. ERK1/2, p38 MAPK and JNK reciprocally influence their activity in BV-2 microglia: effects of S100B. BV-2 microglia were cultivated for 30 min in the absence or presence of 1 ␮M S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580 or 20 ␮M SP600125. Inhibitors were administered to cells 30 min before addition of S100B. Cells were harvested and processed for Western blotting to detect phosphorylated ERK1/2, p38 MAPK and JNK, as shown. One representative experiment of three is shown. * Significantly different from control (first column from left in panels A–C). ** Significantly different from control (first column from left) and from cells treated with inhibitor in the absence of S100B (panel A). *** Significantly different from control (first column from left), from cells treated with S100B in the absence of inhibitors and from cells treated with inhibitor in the absence of S100B (panels B and C).

the absence or presence of S100B. We found that (Fig. 2A–C): (1) individual inhibitors abolished the phosphorylation of the respective kinase irrespective of the absence or presence of S100B; (2) inhibition of p38 MAPK resulted in enhanced basal and S100B-induced phosphorylation of JNK and ERK1/2; (3) inhibition of JNK resulted in no appreciable changes in levels of p38 MAPK and ERK1/2 phosphorylation in the absence or presence of S100B; and (4) inhibition of ERK1/2 resulted in stimulation of basal and S100B-induced phosphorylation of p38 MAPK and no changes in JNK phosphorylation. Thus, a complex cross-talk occurred among the three kinases investigated. A reciprocal, negative control of ERK1/2 and p38 MAPK has been documented (Ciuffini et

670

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

3.3. The S100B/RAGE pair upregulates IL-1β and TNF-α expression and stimulates TNF-α release via ERK1/2-, p38 MAPK-, NF-κB- and JNK-dependent mechanisms

Fig. 3. S100B stimulates p65 NF-␬B phosphorylation and activates AP-1 transcriptional activity. (A) BV-2 microglia was cultivated for 30 min in the absence or presence of 1 ␮M S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580, 20 ␮M SP600125, or 50 ␮M NSC23766. Cells were harvested and processed for Western blotting to detect phosphorylated p65 NF-␬B. (B) BV-2 microglia were transiently transfected with AP-1-luc reporter gene or empty vector, cultivated for 6 h in the absence or presence of 1 ␮M S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580, 20 ␮M SP600125 or 50 ␮M NSC23766. One representative experiment of three is shown in (A) and (B). * Significantly different from control (first column from left in panels A and B). ** Significantly different from control (first column from left), from cells treated with S100B in the absence of inhibitors and from cells treated with inhibitor in the absence of S100B (panel A).

al., 2008; Lee et al., 2002; Mukhopadhyay et al., 2004; Westermarck et al., 2001), and p38 MAPK was reported to inactivate JNK (Riuzzi et al., 2006) via upregulation of MAPK phosphatase-1 (Perdiguero et al., 2007) in certain cell types. We also analyzed levels of p65 NF-␬B phosphorylation, another index of NF-␬B activation (Hayden and Ghosh, 2008). In agreement with data in Fig. 1, S100B stimulated p65 NF-␬B phosphorylation. Again, this effect was reduced, but not abolished in BV-2 microglia treated either with MEKERK1/2 inhibitor, p38 MAPK inhibitor or both (Fig. 3A), or in BV-2 microglia transiently transfected with MKK6AA, an inactive mutant of the p38 MAPK upstream kinase MKK6, in the absence or presence of MEK-ERK1/2 inhibitor (data not shown), while no S100B-dependent p65 NF-␬B phosphorylation was observed in BV-2 microglia treated with the Rac1 inhibitor, NSC23766 (Fig. 3A). Moreover, we found that S100B stimulated the transcriptional activity of AP-1, a transcription factor activated by JNK, and that inhibition of either JNK or Rac1, but not ERK1/2 or p38 MAPK, abolished S100B-dependent activation of AP-1 (Fig. 3B). Thus, in BV-2 microglia in which p38 MAPK, ERK1/2 or both had been inhibited, S100B might stimulate COX-2 expression via the combined action of Rac1-stimulated NF-␬B activity and Rac1-JNK-stimulated AP-1 activity.

S100B was shown to upregulate IL-1␤ expression via activation of ERK1/2, p38 MAPK and JNK in primary microglia (Kim et al., 2004). In addition, RAGE engagement by S100A12 (another member of the S100 protein family) (Donato, 2001, 2007; Heizmann et al., 2002) was shown to result in increased IL-1␤ and TNF-␣ secretion by BV-2 microglia (Hofmann et al., 1999). Thus, we examined effects of S100B on IL-1␤ and TNF-␣ expression in BV-2 microglia, in the absence or presence of inhibitors of NF-␬B, MEKERK1/2, p38 MAPK and JNK. As investigated by RT-PCR (Fig. 4A), S100B upregulated IL-1␤ and TNF-␣ expression in BV-2-mock and, to a larger extent, in BV-2/RAGE, but not BV-2/RAGEcyto microglia, and this effect was reduced by prior treatment with Bay 11-7082, PD98059, SB203580 and SP (inhibitors of NF-␬B, MEK-ERK1/2, p38 MAPK and JNK, respectively). Real-time PCR measurements showed that inhibition of either JNK or NF-␬B resulted in a complete abolition while inhibition of either MEK-ERK1/2 or p38 MAPK resulted in a significant reduction, but not abolition of S100B-induced upregulation of IL-1␤ and TNF-␣ in BV-2 microglia (Fig. 4B). Previous work has shown that treatment of microglia with S100B results in stimulation of IL-1␤ secretion (Kim et al., 2004). Thus, we next wanted to verify whether the S100B/RAGE-induced stimulation of TNF-␣ expression (Fig. 4) translated into increased TNF-␣ secretion. We found that S100B stimulated TNF-␣ release by BV-2 microglia in a RAGE-dependent manner and that this effect was reduced in microglia treated with inhibitors of NF-␬B, MEK-ERK1/2, p38 MAPK or JNK (Fig. 5). As RAGE ligation by S100B resulted in JNK-AP-1 activation via a Cdc42-Rac1 pathway (Bianchi et al., 2007 and Fig. 3B), and since inhibition of either MEK-ERK1/2, p38 MAPK, JNK or NF-␬B resulted in reduced ability of S100B/RAGE to upregulate IL-1␤ and TNF-␣ (Fig. 4), we concluded that S100B-stimulated RAGE signaling activated both, NF-␬B and AP-1, which cooperated to upregulate these two cytokines in BV-2 microglia. 3.4. S100B synergizes with IL-1β and TNF-α to upregulate COX-2 expression in microglia IL-1␤ and TNF-␣ stimulate COX-2 expression in microglia (Feng et al., 1995; Laflamme et al., 1999; Minghetti et al., 1999; Pettus et al., 2003). As S100B stimulated IL1␤ and TNF-␣ release from microglia (Kim et al., 2004 and Figs. 4 and 5), we next asked whether S100B might cooperate with IL-1␤ and/or TNF-␣ to upregulate COX-2 expression in BV-2 microglia. S100B upregulated COX-2 expression in BV-2 microglia in a dose-dependent manner with significant effect a concentration ≥250 nM (Fig. 6A) and maximum

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

671

Fig. 4. RAGE ligation by S100B stimulates IL-1␤ and TNF-␣ expression in BV-2 microglia. (A) BV-2/mock, BV-2/RAGEcyto and BV-2/RAGE microglia were cultivated for 1 h in the absence or presence of 1 ␮M S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580, 20 ␮M SP600125 or 5 ␮M Bay 11–7082, and analyzed by RT-PCR using IL-1␤- and TNF-␣-specific oligonucleotides. Shown is one representative experiment of three. (B) BV-2 microglia were cultivated for 1 h in the absence or presence of 1 ␮M S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580, 20 ␮M SP600125 or 5 ␮M Bay 11–7082, and analyzed for expression of IL-1␤ and TNF-␣ by real-time PCR. * Significantly different from control (first column from left in each panels). ** Significantly different from control (first column from left in each panel) and from cells treated with S100B in the absence of inhibitors.

effect at 9–12 h with decreasing efficiency at later time points (Fig. 6B). Similarly, S100B upregulated COX-2 expression in primary microglia in a dose-dependent manner, and it failed to do so in the presence of a RAGE-neutralizing antibody (Fig. 6C). Moreover, S100B stimulated p38 MAPK, ERK1/2 and JNK phosphorylation (activation) in primary microglia, and, similar to BV-2 microglia, inhibition of either JNK, Rac1 or NF-␬B, but not ERK1/2 and p38 MAPK resulted in reduced ability of S100B to upregulate COX-2 expression (data not shown). As shown in Fig. 6D and F, IL-1␤ and TNF-␣, respectively, stimulated COX-2 expression in BV-2 microglia in a dose-dependent manner. However, whereas IL1␤ upregulated COX-2 protein expression at 4 h (Fig. 6D), no effects of TNF-␣ could be registered at this same time point (Fig. 6F) or at 6, 9 or 12 h (data not shown), the cytokine being effective at a later time (16 h) (Fig. 6F). Notably, in the presence of 100 nM S100B, a dose which was not sufficient to stimulate COX-2 expression per se (Fig. 6A), IL-1␤ and TNF-␣ showed an enhanced ability to upregulate COX-2 expression in both BV-2 and primary microglia (Fig. 6E, F right panel and C).

4. Discussion An increasing body of evidence suggests that besides being implicated in the Ca2+ -dependent regulation of intracellular activities, S100B, a member of a multigenic family of Ca2+ -binding proteins of the EF-hand type, also has extracellular regulatory roles (Donato, 2001, 2007; Heizmann et al., 2002; Van Eldik and Wainwright, 2003). By far, the brain is the richest source of S100B, and astrocytes are the brain cell type with the highest expression of the protein and release S100B constitutively (Donato, 2001; Van Eldik and Zimmer, 1987). Moreover, agents such as serotonin agonists, glutamate and lysophosphatidic acid increase S100B release by astrocytes (Ciccarelli et al., 1999; Pinto et al., 2000; Whitaker-Azmitia et al., 1990), suggesting that S100B release is one mechanism by which astrocytes communicate with neurons and/or alter neuronal and microglial functions. Extracellular effects of S100B in the brain have attracted much attention because of the elevated expression of the protein in several brain pathological states and because increased levels of S100B in the cerebrospinal fluid and serum are of

672

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

Fig. 5. RAGE ligation by S100B stimulates the release of TNF-␣ by BV-2 microglia. BV-2/mock, BV-2/RAGEcyto and BV-2/RAGE microglia were cultivated for 9 h in the absence or presence of 1 ␮M S100B plus or minus 30 ␮M PD98059, 5 ␮M SB203580, 20 ␮M SP600125 or 5 ␮M Bay 11-7082. Culture media were then analyzed for TNF-␣ by an ELISA kit. * Significantly different from control (first column from left). ** Significantly different from control and from S100B-treated cells in the absence of inhibitors.

diagnostic and prognostic value (Donato, 2001; Heizmann et al., 2002; Kochanek et al., 2008; Mrak and Griffin, 2004; Rothermundt et al., 2003; Van Eldik and Wainwright, 2003). However, increases in extracellular S100B levels might not be simply important for diagnosis and prognosis; they might represent a means whereby the insulted brain responds to traumatic, cerebrovascular, infective, degenerative and autoimmune injuries, and the developing brain organizes its neuronal architecture. Indeed, at the subnanomolar to nanomolar concentrations found extracellularly in the brain under normal conditions, S100B protects neurons against toxic cues (Ahlemeyer et al., 2000; Businaro et al., 2006; Huttunen et al., 2000; Kligman and Marshak, 1985; Reali et al., 2005; Winningham-Major et al., 1989) and stimulates neurite outgrowth (Huttunen et al., 2000; Kligman and Marshak, 1985; Winningham-Major et al., 1989) via engagement of RAGE and its downstream effectors, ERK1/2 and Cdc42-Rac1, respectively (Businaro et al., 2006; Huttunen

et al., 2000), and stimulates glutamate uptake by astrocytes (Tramontina et al., 2006). Thus, extracellular S100B might be viewed as an astrocytic factor involved in neuronal survival and differentiation during brain development and early phases of brain insults. However, at high doses S100B is detrimental to neurons, causing their death by apoptosis (Donato, 2001, 2007; Heizmann et al., 2002; Huttunen et al., 2000; Van Eldik and Wainwright, 2003), and is able to activate microglia (Adami et al., 2001; Hofmann et al., 1999; Kim et al., 2004; Petrova et al., 2000), i.e. the resident macrophage component of the brain tissue (Block and Hong, 2005; Hauwel et al., 2005; Kim and de Vellis, 2005; Town et al., 2005), as well as astrocytes (Hu et al., 1996; Hu and Van Eldik, 1999). These latter findings suggest that S100B might participate in the inflammatory response in the brain, analogous to other members of the same family (Hofmann et al., 1999; Roth et al., 2003; Shepherd et al., 2005). Specifically, S100B stimulates NO release by microglia in the presence of cofactors (Adami et al., 2001; Petrova et al., 2000) and upregulates the expression of the proinflammatory cytokine IL-1␤ (Kim et al., 2004) and the proinflammatory enzyme, COX-2 (Bianchi et al., 2007) in the absence of cofactors in microglia. S100B-induced upregulation of COX-2 in microglia was shown to be dependent on RAGE engagement and to occur via RAGE-dependent activation of two parallel signaling pathway, a Ras-Cdc42Rac1-JNK pathway and a Ras-Rac1-NF-␬B pathway. Activation of microglia results in MEK-ERK1/2-NF-␬Band p38 MAPK-NF-␬B-regulated secretion of IL-1␤ and TNF-␣ (Block and Hong, 2005; Hauwel et al., 2005; Kim and de Vellis, 2005; Town et al., 2005). We found that S100B upregulated IL-1␤ and TNF-␣ expression in and stimulated TNF-␣ secretion by BV-2 microglia, and that the blockade of either MEK-ERK1/2, p38 MAPK or NF-␬B resulted in reduction of these S100B effects. While the ability of S100B to upregulate IL-1␤ expression via ERK1/2 and p38 MAPK activation in microglia has been reported (Kim et al., 2004), we show here that this occurs via RAGE engagement. Additionally, we show that RAGE engagement by S100B in microglia also results in TNF-␣ secretion. However, we found that inhibition of JNK, that is stimulated by a Ras- and a Cdc42-Rac1 module in S100B-treated BV-2 microglia (Bianchi et al., 2007), also results in negation of S100B/RAGE ability to upregulate IL-1␤ and TNF-␣ expression and to stimulate TNF-␣ release by microglia. Moreover, S100B stimulates AP-1 transcriptional activity in a Rac1-JNK-dependent manner (Fig. 3B). Thus, the S100B/RAGE-dependent recruitment of Ras- and/or Cdc42Rac1-JNK-AP-1 in microglia serves to stimulate the release of these cytokines, besides upregulating COX-2 expression. In this context, it is noteworthy that TNF-␣ stimulates S100B release from astrocytes (Edwards and Robinson, 2006), suggesting the possibility that in case of brain insult TNF-␣ might concur to elevating the extracellular concentration of S100B thereby favoring activating effects of S100B on microglia.

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

673

Fig. 6. S100B synergizes with IL-1␤ and TNF-␣ to upregulate COX-2 expression in BV-2 microglia. (A) BV-2 microglia were treated with increasing S100B concentrations for 9 h and processed for detection of COX-2 by Western blotting. (B) BV-2 microglia were treated with 1 ␮M S100B for increasing time intervals and processed for detection of COX-2 by Western blotting. (C) Primary microglia isolated from rat brain were treated with increasing S100B concentrations for 9 h and processed for detection of COX-2 by Western blotting. In some experiments primary microglia were pre-treated with a RAGE-neutralizing antibody for 3 h before adding S100B. Treatment of primary microglia either with a RAGE-neutralizing antibody in the absence of S100B or with non-immune IgG in the absence or presence of S100B did not change the pattern of COX-2 expression (data not shown). In some other experiments primary microglia were treated with a low concentration of either IL-1␤ (4 h) or TNF-␣ (16 h) in the absence or presence of S100B. (D) BV-2 microglia were treated with increasing IL-1␤ concentrations for 4 h and processed for detection of COX-2 by Western blotting. (E) BV-2 microglia were cultivated in the absence or presence of 0.1 ␮M S100B plus or minus 0.2 nM IL-1␤ for 4 h and processed for detection of COX-2 by Western blotting. (F) BV-2 microglia were treated either with increasing concentrations of TNF-␣ for 4 h (left panel) or 16 h (right panel) in the absence or presence of 0.1 ␮M S100B and processed for detection of COX-2 by Western blotting. One representative experiment of three is shown. * Significantly different from control (first column from left in panels A, C–F). ** Significantly different from control and from cells treated with 1 ␮M S100B in the absence of anti-RAGE antibody (panel C).

However, whereas direct inhibition of NF-␬B resulted in negation of S100B/RAGE-induced upregulation of COX-2 expression, inhibition of the NF-␬B-activating kinases, MEK-ERK1/2 and/or p38 MAPK, did not affect S100B/RAGE-induced upregulation of COX-2 expression (Bianchi et al., 2007). This discrepancy might be explained by the observation that inhibition of either ERK1/2, p38 MAPK

or both reduces but does not abolish S100B’s ability to activate NF-␬B (Figs. 1 and 3A), that inhibition of p38 MAPK results in an enhanced activation of JNK (Fig. 2) and inhibition of ERK1/2 leaves JNK activation unchanged (Fig. 2), and that inhibition of Rac1 is required for abolition of S100Bdependent activation of NF-␬B (Fig. 3A). While we cannot exclude that S100B/RAGE-dependent activation of NF-␬B

674

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

Fig. 7. Schematic representation of the proposed mechanism of S100B/RAGE-dependent upregulation of COX-2, IL-1␤ and TNF-␣ expression in BV-2 microglia. RAGE ligation by S100B results in activation of AP-1 and NF-␬B, which cooperate to stimulate COX-2, IL-1␤ and TNF-␣ expression. X = intermediate(s) to be identified; N = nucleus.

via MEK-ERK1/2 and/or p38 MAPK might contribute to upregulate COX-2 expression in microglia, analogous to the case of monocytes/macrophages (Shanmugam et al., 2003), our present findings suggest that the RAGE-Cdc42-Rac1JNK-AP-1 module and the RAGE-Ras-Rac1-NF-␬B module might play a major role in the S100B’s stimulatory effect on COX-2 expression in microglia (Fig. 7). Also, whereas recent work has shown that AP-1-dependent upregulation of COX-2 in kidney cells results in inhibition of NF-␬B activation (Polk et al., 2007), our data suggest that the concurrent activation of AP-1 and NF-␬B is required for S100B/RAGEdependent upregulation of COX-2 expression in microglia. The same applies to S100B/RAGE-dependent upregulation of IL-1␤ and TNF-␣ expression, based on data in Fig. 4. Incidentally, we noted an inverse relationship between basal levels of NF-␬B transcriptional activity and the amount of signaling-competent RAGE in BV-2 microglia (Fig. 1). This suggests that culture medium factors whose identity remains to be established might intervene in the RAGE-dependent stimulation of NF-␬B transcriptional activity in microglia under basal conditions. A potential candidate factor might be HMGB1 (amphoterin), another RAGE ligand (Huttunen and Rauvala, 2004), which is present in commercial FBS (Sorci et al., 2004), and is known to be secreted by macrophages (Lotze and Tracey, 2005) and to participate in inflammatory processes (Muller et al., 2001), including microglia activation (Kim et al., 2006; Lue et al., 2005). S100B was shown to upregulate COX-2 expression in circulating monocytes by both an IL-1␤-dependent and

an IL-1␤-independent mechanism via RAGE engagement (Shanmugam et al., 2003). Also, RAGE engagement by HMGB1 has been involved in IL-1␤ sensitization of vascular smooth muscle cells to sPLA2-IIA with consequent upregulation of COX-2 expression and production of prostaglandins (Jaulmes et al., 2006). Thus, we cannot exclude the possibility that S100B might stimulate COX-2 expression in microglia via stimulation of IL-1␤ release and autocrine activity of IL1␤ in part. By contrast, our present results suggest that TNF-␣ does not appear to play a major role in the S100B-induced upregulation of COX-2 expression in BV-2 microglia given that TNF-␣ induces COX-2 expression at a time, i.e. 16 h, when S100B’s ability to upregulate the enzyme is declining. However, we cannot exclude the possibility that TNF-␣ might do so at later time points. Whatever the case, our data support the conclusion that S100B might contribute to microglia activation thereby actively participating in the inflammatory response in the injured brain. As stimulation of COX-2 (Fig. 6A) expression in microglia was detected at ≥250 nM, one could hypothesize that S100B might switch from neurotrophic to neurotoxic on accumulation above a certain threshold (i.e. 250 nM) in the brain extracellular space. High concentrations of S100B in the brain extracellular compartment can be attained following astrocyte death, leakage of S100B from damaged astrocytes and/or defective clearance of extracellular S100B consequent to inflammation, events that are expected to occur in the injured brain (Donato, 2001; Griffin et al., 1998; Heizmann et al., 2002; Mrak and Griffin, 2001; Van Eldik and Wainwright, 2003). Moreover, the non-reducing, high Ca2+ conditions found extracellularly might favor the formation and stabilization of S100B multimers (Barger et al., 1992; Ma et al., 2007; Ostendorp et al., 2007) that interact with RAGE with high affinity (Ostendorp et al., 2007). All these conditions might cause S100B to persist in the extracellular space, favor RAGE oligomerization (Dattilo et al., 2007; Ostendorp et al., 2007) and chronically activate RAGE in microglia, thereby amplifying the inflammatory response. However, we have shown that at doses (e.g. 100 nM) that are still trophic to neurons and astrocytes under normal conditions (Donato, 2001; Heizmann et al., 2002; Van Eldik and Wainwright, 2003) and do not stimulate the microglia inflammatory activity (Bianchi et al., 2007, and Fig. 6A and C), S100B amplifies IL-1␤’s and TNF-␣’s ability to upregulate COX-2 expression and vice versa (Fig. 6C–E). This suggests that S100B might switch from neurotrophic and protective to neurotoxic in the presence of relatively low amounts of IL-1␤ and TNF-␣, i.e. at the very beginning of a brain insult, by accelerating microglia activation. Microglial cells represent a population of resident brain macrophages, which are able to phagocyte and are implicated in immune and inflammatory reactions (Block and Hong, 2005; Hauwel et al., 2005; Kim and de Vellis, 2005; Town et al., 2005). They have been demonstrated to act as antigen-presenting cells and to produce and secrete proinflammatory cytokines such as IL-1␤, IL-6 and TNF-␣. Also,

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

tight regulation of COX-2 expression in several cell types including microglia is a key feature controlling eicosanoid production in inflammatory syndromes (Minghetti, 2004). Given the important role of microglia in the brain inflammatory response (Block and Hong, 2005; Hauwel et al., 2005; Kim and de Vellis, 2005; Town et al., 2005), we propose that the S100B’s ability to activate microglia via RAGE engagement and to upregulate RAGE expression in microglia might contribute significantly to neuroinflammation. Yet, one cannot exclude the possibility that S100B’s ability to activate microglia might be part of a protective effect in the context of recent views about the beneficial role of microglia in brain homeostasis and neuroinflammation (Glezer et al., 2007; Hanisch and Kettenmann, 2007).

Acknowledgements We wish to thank Heikki Rauvala (Helsinki, Finland) for providing the RAGE and RAGEcyto constructs, Pier Lorenzo Puri (La Jolla, CA) for the p65 NF-␬B-luc constructs, and Teresa Ciotti (EBRI, Rome, Italy) for instructing us on how to produce primary microglia. Supported by Ministero dell’Istruzione, dell’Universit`a e della RicercaUniversity of Perugia (FIRB 2001, RBAU014TJ8 001) and Fondazione Cassa di Risparmio di Perugia (Project 2004.0282.020 001) funds to RD. The authors declare no conflict of interest.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.neurobiolaging. 2008.05.017.

References Adami, C., Bianchi, R., Pula, G., Donato, R., 2004. S100B-stimulated NO production by BV-2 microglia is independent of RAGE transducing activity but dependent on RAGE extracellular domain. Biochim. Biophys. Acta 1742, 169–177. Adami, C., Sorci, G., Blasi, E., Agneletti, A.L., Bistoni, F., Donato, R., 2001. S100B expression in and effects on microglia. Glia 33, 131–142. Ahlemeyer, B., Beier, H., Semkova, I., Schaper, C., Krieglstein, J., 2000. S-100␤ protects cultured neurons against glutamate- and staurosporineinduced damage and is involved in the antiapoptotic action of the 5 HT(1A)-receptor agonist, Bay x 3702. Brain Res. 858, 121–128. Allore, R., O’Hanlon, D., Price, R., Neilson, K., Willard, H.F., Cox, D.R., Marks, A., Dunn, R.J., 1988. Gene encoding the ␤ subunit of S100 protein is on chromosome 21: implications for Down’s syndrome. Science 239, 1311–1313. Barger, S.W., Wolchok, S.R., Van Eldik, L.J., 1992. Disulfide-linked S100 beta dimers and signal transduction. Biochim. Biophys. Acta 1160, 105–112. Bianchi, R., Adami, C., Giambanco, I., Donato, R., 2007. S100B binding to RAGE in microglia stimulates COX-2 expression. J. Leukoc. Biol. 81, 108–118.

675

Bierhaus, A., Humpert, P.M., Morcos, M., Wendt, T., Chavakis, T., Arnold, B., Stern, D.M., Nawroth, P.P., 2005. Understanding RAGE, the receptor for advanced glycation end products. J. Mol. Med. 83, 876–886. Blasi, E., Barluzzi, R., Bocchini, V., Mazzolla, R., Bistoni, F., 1990. Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus. J. Neuroimmunol. 27, 229–237. Block, M.L., Hong, J.S., 2005. Microglia and inflammation-mediated neurodegeneration: Multiple triggers with a common mechanism. Prog. Neurobiol. 76, 77–98. Bocchini, V., Mazzolla, R., Barluzzi, R., Blasi, E., Sick, P., Kettenmann, H., 1992. An immortalized cell line expresses properties of activated microglial cells. J. Neurosci. Res. 31, 616–621. Businaro, R., Leone, S., Sorci, G., Donato, R., Lauro, G.M., Fumagalli, L., 2006. S100B protects neurons against A␤ amyloid-induced neurotoxicity via RAGE engagement at low doses and increases A␤ amyloid neurotoxicity at high doses. J. Neurosci. Res. 83, 897–906. Ciccarelli, R., Di Iorio, P., Bruno, V., Battaglia, G., D’Alimonte, I., D’Onofrio, M., Nicoletti, F., Caciagli, F., 1999. Activation of A1 adenosine or mGlu3 metabotropic glutamate receptors enhances the release of Nerve Growth Factor and S100␤ protein from cultured astrocytes. Glia 27, 275–281. Ciuffini, L., Castellani, L., Salvati, E., Galletti, S., Falcone, G., Alema, S., 2008. Delineating v-Src downstream effector pathways in transformed myoblasts. Oncogene 27, 528–539. Dattilo, B.M., Fritz, G., Leclerc, E., Kooi, C.W., Heizmann, C.W., Chazin, W.J., 2007. The extracellular region of the receptor for advanced glycation end products is composed of two independent structural units. Biochemistry 46, 6957–6970. Donato, R., 1988. Calcium dependent, pH regulated effects of S-100 proteins on assembly-disassembly of brain microtubule protein in vitro. J. Biol. Chem. 263, 106–110. Donato, R., 2001. S100: a multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles. Int. J. Biochem. Cell Biol. 33, 637–668. Donato, R., 2007. RAGE: a single receptor for several ligands and different cellular responses: the case of certain S100 proteins. Curr. Mol. Med. 7, 711–724. Edwards, M.M., Robinson, S.R., 2006. TNF-␣ affects the expression of GFAP and S100B: implications for Alzheimer’s disease. J. Neural Transm. 113, 1709–1715. Feng, L., Xia, Y., Garcia, G.E., Hwang, D., Wilson, C.B., 1995. Involvement of reactive oxygen intermediates in cyclooxygenase-2 expression induced by interleukin-1, tumor necrosis factor-␣, and lipopolysaccharide. J. Clin. Invest. 95, 1669–1675. Glezer, I., Simard, A.R., Rivest, S., 2007. Neuroprotective role of the innate immune system by microglia. Neuroscience 147, 867–883. Griffin, S.W.T., Sheng, J.G., Royston, M.C., Gentleman, S.M., McKenzie, J.E., Graham, D.I., Roberts, G.W., Mrak, R.E., 1998. Glial-neuronal interactions in Alzheimer’s disease: the potential role of a “cytokine cycle” in disease progression. Brain Pathol. 8, 65–72. Hanisch, U.K., Kettenmann, H., 2007. Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat. Neurosci. 10, 1387–1394. Hauwel, M., Furon, E., Canova, C., Griffiths, M., Neal, J., Gasque, P., 2005. Innate (inherent) control of brain infection, brain inflammation and brain repair: the role of microglia, astrocytes, “protective” glial stem cells and stromal ependymal cells. Brain Res. Brain Res. Rev. 48, 220–233. Hayden, M.S., Ghosh, S., 2008. Shared principles in NF-kappaB signaling. Cell 132, 344–3462. Heizmann, C.W., Fritz, G., Schaefer, B.W., 2002. S100 proteins: structure, functions and pathology. Front Biosci. 7, d1356–d1368. Hofmann, M.A., Drury, S., Fu, C., Qu, W., Taguchi, A., Lu, Y., Avila, C., Kambham, N., Bierhaus, A., Nawroth, P., Neurath, M.F., Slattery, T., Beach, D., McClary, J., Nagashima, M., Morser, J., Stern, D., Schmidt, A.M., 1999. RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides. Cell 97, 889–901.

676

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677

Hu, J., Castets, F., Guevara, J.L., Van Eldik, L.J., 1996. S100␤ stimulates inducible nitric oxide synthase activity and mRNA levels in rat cortical astrocytes. J. Biol. Chem. 271, 2543–2547. Hu, J., Ferreira, A., Van Eldik, L.J., 1997. S100␤ induces neuronal cell death through nitric oxide release from astrocytes. J. Neurochem. 69, 2294–2301. Hu, J., Van Eldik, L.J., 1999. Glial-derived proteins activate cultured astrocytes and enhance beta amyloid-induced glial activation. Brain Res. 842, 46–54. Huttunen, H.J., Rauvala, H., 2004. Amphoterin (HMGB1) as an extracellular regulator of cell motility: from development to disease. J. Int. Med. 255, 266–351. Huttunen, H.J., Fages, C., Rauvala, H., 1999. Receptor for advanced glycation end products (RAGE)-mediated neurite outgrowth and activation of NF-B require the cytoplasmic domain of the receptor but different downstream signaling pathways. J. Biol. Chem. 274, 19919–19924. Huttunen, H.J., Kuja-Panula, J., Sorci, G., Agneletti, A.L., Donato, R., Rauvala, H., 2000. Coregulation of neurite outgrowth and cell survival by amphoterin and S100 proteins through RAGE activation. J. Biol. Chem. 275, 40096–40105. Jaulmes, A., Thierry, S., Janvier, B., Raymondjean, M., Marechal, V., 2006. Activation of sPLA2-IIA and PGE2 production by high mobility group protein B1 in vascular smooth muscle cells sensitized by IL-1␤. FASEB J. 20, 1727–1729. Kim, J.B., Sig Choi, J., Yu, Y.M., Nam, K., Piao, C.S., Kim, S.W., Lee, M.H., Han, P.L., Park, J.S., Lee, J.K., 2006. HMGB1, a novel cytokine-like mediator linking acute neuronal death and delayed neuroinflammation in the postischemic brain. J. Neurosci. 26, 6413–6421. Kim, S.H., Smith, C.J., Van Eldik, L.J., 2004. Importance of MAPK pathways for microglial pro-inflammatory cytokine IL-1␤ production. Neurobiol. Aging 25, 431–439. Kim, S.U., de Vellis, J., 2005. Microglia in health and disease. J. Neurosci. Res. 81, 302–313. Kligman, D., Marshak, D.R., 1985. Purification and characterization of a neurite extension factor from bovine brain. Proc. Natl. Acad. Sci. U.S.A. 82, 7136–7139. Kochanek, P.M., Berger, R.P., Bayr, H., Wagner, A.K., Jenkins, L.W., Clark, R.S., 2008. Biomarkers of primary and evolving damage in traumatic and ischemic brain injury: diagnosis, prognosis, probing mechanisms, and therapeutic decision making. Curr. Opin. Crit. Care 14, 135–141. Laflamme, N., Lacroix, S., Rivest, S., 1999. An essential role of interleukin1␤ in mediating NF-␬B activity and COX-2 transcription in cells of the blood-brain barrier in response to a systemic and localized inflammation but not during endotoxemia. J. Neurosci. 19, 10923–10930. Lee, J., Hong, F., Kwon, S., Kim, S.S., Kim, D.O., Kang, H.S., Lee, S.J., Ha, J., Kim, S.S., 2002. Activation of p38 MAPK induces cell cycle arrest via inhibition of Raf/ERK pathway during muscle differentiation. Biochem. Biophys. Res. Commun. 298, 765–771. Levi, G., Patrizio, M., Bernardo, A., Petrucci, T.C., Agresti, C., 1993. Human immunodeficiency virus coat protein gp120 inhibits the β-adrenergic regulation of astroglial and microglial functions. Proc. Natl. Acad. Sci. U.S.A. 90, 1541–1545. Lotze, M.T., Tracey, K.J., 2005. High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal. Nat. Rev. Immunol. 5, 331–342. Lue, L.F., Yan, S.D., Stern, D.M., Walker, D.G., 2005. Preventing activation of receptor for advanced glycation endproducts in Alzheimer’s disease. Curr. Drug Targets CNS Neurol. Disord. 4, 249–266. Ma, W., Lee, S.E., Guo, J., Qu, W., Hudson, B.I., Schmidt, A.M., Barile, G.R., 2007. RAGE ligand upregulation of VEGF secretion in ARPE-19 cells. Invest. Ophthalmol. Vis. Sci. 48, 1355–1361. Minghetti, L., Walsh, D.T., Levi, G., Perry, V.H., 1999. In vivo expression of cyclooxygenase-2 in rat brain following intraparenchymal injection of bacterial endotoxin and inflammatory cytokines. J. Neuropathol. Exp. Neurol. 58, 1184–1191. Minghetti, L., 2004. Cyclooxygenase-2 (COX-2) in inflammatory and degenerative brain diseases. J. Neuropathol. Exp. Neurol. 63, 901–910.

Mrak, R.E., Griffin, W.S., 2001. The role of activated astrocytes and of the neurotrophic cytokine S100B in the pathogenesis of Alzheimer’s disease. Neurobiol. Aging 22, 915–922. Mrak, R.E., Griffin, W.S., 2004. Trisomy 21 and the brain. J. Neuropathol. Exp. Neurol. 63, 679–685. Mukhopadhyay, S., Munshi, H.G., Kambhampati, S., Sassano, A., Platanias, L.C., Stack, M.S., 2004. Calcium-induced matrix metalloproteinase 9 gene expression is differentially regulated by ERK1/2 and p38 MAPK in oral keratinocytes and oral squamous cell carcinoma. J. Biol. Chem. 279, 33139–33146. Muller, S., Scaffidi, P., Degryse, B., Bonaldi, L., Ronfani, L., Agresti, A., Beltrame, M., Bianchi, M.E., 2001. The double life of HMGB1 chromatin protein: architectural factor and extracellular signal. EMBO J. 20, 4337–4340. Ostendorp, S., Leclerc, E., Galichet, A., Koch, M., Demling, N., Weigle, B., Heizmann, C.W., Kroneck, P.M.H., Fritz, G., 2007. Structural and functional insights into RAGE activation by multimeric S100B. EMBO J. 26, 3868–3878. Perdiguero, E., Ruiz-Bonilla, V., Gresh, L., Hui, L., Ballestar, E., SousaVictor, P., Baeza-Raja, B., Jardi, M., Bosch-Comas, A., Esteller, M., Caelles, C., Serrano, A.L., Wagner, E.F., Munoz-Canoves, P., 2007. Genetic analysis of p38 MAP kinases in myogenesis: fundamental role of p38␣ in abrogating myoblast proliferation. EMBO J. 26, 1245–1256. Petrova, V., Hu, J., Van Eldik, L.J., 2000. Modulation of glial activation by astrocyte-derived protein S100B: differential responses of astrocyte and microglial cultures. Brain Res. 853, 74–80. Pettus, B.J., Bielawski, J., Porcelli, A.M., Reames, D.L., Johnson, K.R., Morrow, J., Chalfant, C.E., Obeid, L.M., Hannun, Y.A., 2003. The sphingosine kinase 1/sphingosine-1-phosphate pathway mediates COX-2 induction and PGE2 production in response to TNF-␣. FASEB J. 17, 1411–1421. Pinto, S.S., Gottfried, C., Mendez, A., Gonc¸alves, D., Karl, J., Gonc¸alves, C.A., Wofchuk, S., Rodnight, R., 2000. Immunocontent and secretion of S100B in astrocyte cultures from different brain regions in relation to morphology. FEBS Lett. 486, 203–207. Polk, W.W., Ellis, M.E., Kushleika, J.V., Simmonds, P.L., Woods, J.S., 2007. RhoA regulation of NF-␬B activation is mediated by Cox-2-dependent feedback inhibition of IKK in kidney epithelial cells. Am. J. Physiol. Cell Physiol. 293, C1160–C1170. Reali, C., Scintu, F., Pillai, R., Donato, R., Michetti, F., Sogos, V., 2005. S100B counteracts effects of the neurotoxicant trimethyltin on astrocytes and microglia. J. Neurosi. Res. 81, 677–686. Riuzzi, F., Sorci, G., Donato, R., 2006. The amphoterin/RAGE pair modulates myoblast proliferation, apoptosis, adhesiveness, migration and invasiveness. Functional inactivation of RAGE in L6 myoblasts results in tumor formation in vivo. J. Biol. Chem. 281, 8242–8253. Roth, J., Vogl, T., Sorg, C., Sunderkotter, C., 2003. Phagocyte-specific S100 proteins: a novel group of proinflammatory molecules. Trends Immunol. 24, 155–158. Rothermundt, M., Peters, M., Prehn, J.H., Arolt, V., 2003. S100B in brain damage and neurodegeneration. Microsc. Res. Tech. 60, 614–632. Schmidt, A.M., Yan, S.D., Yan, S.F., Stern, D.M., 2001. The multiligand receptor RAGE as a progression factor amplifying immune and inflammatory responses. J. Clin. Invest. 108, 949–955. Shanmugam, N., Kim, Y.S., Lantin, G.L., Natarajan, R., 2003. Regulation of cyclooxygenase-2 expression in monocytes by ligation of the receptor for advanced glycation end products. J. Biol. Chem. 278, 34834–43444. Shepherd, C.E., Goyette, J., Utter, V., Rahimi, F., Yang, Z., Geczy, C.L., Halliday, G.M., 2005. Inflammatory S100A9 and S100A12 proteins in Alzheimer’s disease. Neurobiol. Aging 27, 1554–1563. Sorci, G., Riuzzi, F., Arcuri, C., Giambanco, I., Donato, R., 2004. Amphoterin stimulates myogenesis and counteracts the antimyogenic factors basic fibroblast growth factor and S100B via RAGE binding. Mol. Cell Biol. 24, 4880–4894. Tang, G., Minemoto, Y., Dibling, B., Purcell, N.H., Li, Z., Karin, M., Lin, A., 2001. Inhibition of JNK activation through NF-␬B target genes. Nature 414, 313–317.

R. Bianchi et al. / Neurobiology of Aging 31 (2010) 665–677 Town, T., Nikolic, V., Tan, J., 2005. The microglial “activation” continuum: from innate to adaptive responses. J. Neuroinflam. 31, 2–24. Tramontina, F., Tramontina, A.C., Souza, D.F., Leite, M.C., Gottfried, C., Souza, D.O., Wofchuk, S.T., Gonc¸alves, C.A., 2006. Glutamate uptake is stimulated by extracellular S100B in hippocampal astrocytes. Cell Mol. Neurobiol. 26, 81–86. Van Eldik, L.J., Wainwright, M.S., 2003. The Janus face of glial-derived S100B: beneficial and detrimental functions in the brain. Restor. Neurol. Neurosci 21, 97–108. Van Eldik, L.J., Zimmer, D.B., 1987. Secretion of S100 from rat C6 glioma cells. Brain Res. 436, 367–370.

677

Westermarck, J., Li, S.P., Kallunki, T., Han, J., Kahari, V.M., 2001. p38 mitogen-activated protein kinase-dependent activation of protein phosphatases 1 and 2A inhibits MEK1 and MEK 2 activity and collagenase 1 (MMP-1) gene expression. Mol. Cell. Biol. 21, 237323–323783. Whitaker-Azmitia, P.M., Murphy, R., Azmitia, E.C., 1990. S100 protein is released from astroglial cells by stimulation of 5-HT1A receptors. Brain Res. 528, 155–158. Winningham-Major, F., Staecker, J.L., Barger, S.W., Coats, S., Van Eldik, L.J., 1989. Neurite extension and neuronal survival activities of recombinant S100␤ proteins that differ in the content and position of cysteine residues. J. Cell Biol. 109, 3036–3071.