sarA inactivation reduces vancomycin-intermediate and ciprofloxacin resistance expression by Staphylococcus aureus

International Journal of Antimicrobial Agents 34 (2009) 136–141

Contents lists available at ScienceDirect

International Journal of Antimicrobial Agents journal homepage: http://www.elsevier.com/locate/ijantimicag

sarA inactivation reduces vancomycin-intermediate and ciprofloxacin resistance expression by Staphylococcus aureus Reena Lamichhane-Khadka a , Stephanie A. Cantore a , James T. Riordan a,b , Alejandro Delgado a , ˜ a , Shahrear Zaman a , Sonia Horan c , Alesha E.A. Norman a , Sarah Duenas d Brian J. Wilkinson , John E. Gustafson a,b,∗ a

Microbiology Group, Department of Biology, New Mexico State University, Las Cruces, NM 88003-8001, USA Molecular Biology Program, New Mexico State University, Las Cruces, NM 88003-8001, USA c Las Cruces High School, Las Cruces, NM 88001, USA d Microbiology Group, Department of Biological Sciences, Illinois State University, Normal, IL 61790-4120, USA b

a r t i c l e

i n f o

Article history: Received 7 May 2008 Accepted 16 January 2009 Keywords: Staphylococcus aureus VISA Ciprofloxacin Resistance sarA

a b s t r a c t It is known that multiple genome-wide transcriptional changes often accompany the development of antimicrobial resistance and occur in response to challenge with antimicrobial agents. We now show that inactivation of the staphylococcal accessory gene regulator sarA, which controls at least tens of genes in Staphylococcus aureus, leads to dramatic reductions in vancomycin and ciprofloxacin resistance in vancomycin-intermediate and ciprofloxacin-resistant strains of S. aureus. This is particularly evident when judged by antimicrobial-gradient plate analysis or population analysis profiles. Whilst the intact sarA cistron is required for full vancomycin resistance expression by vancomycin-intermediate S. aureus (VISA), sarA expression as determined by quantitative real-time polymerase chain reaction was found to be VISA strain-dependent. Reductions in vancomycin resistance expression levels following sarA inactivation do not necessarily include an alteration in autolysis. Expression of sarR, the negative regulator of sarA, was downregulated in two VISA mutants, and transcription of the alternative sigma factor sigB was downregulated in one VISA strain. This study contributes to a growing body of evidence demonstrating the importance of loci previously identified to control virulence in the regulation of clinically relevant antibiotic resistance mechanisms. © 2009 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

1. Introduction Staphylococcus aureus strains resistant to the action of most antimicrobials appear within a year of their introduction, but vancomycin-intermediate S. aureus (VISA) [minimum inhibitory concentration (MIC) ≥ 4 mg/L) did not appear until ca. 40 years (1997) after the introduction of vancomycin [1–5]. In 2002, isolation of vancomycin-resistant S. aureus (VRSA) (MIC ≥ 16 mg/L) was reported. VRSA are derived from meticillin-resistant S. aureus (MRSA) that acquire the vancomycin resistance mechanism by horizontal transfer of the van gene from vancomycin-resistant enterococci [6,7]. Now that VRSA have appeared, many clinicians fear the possible clonal spread of VRSA, similar to the spread of MRSA following acquisition of the meticillin resistance determinant (mec) by S. aureus in the 1960s. Fluoroquinolones (e.g. ciprofloxacin) are one of the most commonly prescribed antimicrobials and were used as an alternative to

∗ Corresponding author. Tel.: +1 575 646 5660; fax: +1 575 646 5665. E-mail address: [email protected] (J.E. Gustafson).

vancomycin in the treatment of infections caused by MRSA [8,9]. However, starting in the early 1990s, MRSA isolates resistant to these drugs began to appear [10] and today 100% of some geographically isolated clinical MRSA populations can express ciprofloxacin resistance [11,12]. Vancomycin and the fluoroquinolones have unique targets and inhibit bacterial growth by very different mechanisms. Vancomycin binds to terminal d-ala-d-ala residues at the ends of peptidoglycan stem peptides on lipid II and inhibits peptidoglycan synthesis [13], whereas fluoroquinolones inhibit the action of DNA gyrase and topoisomerase IV in S. aureus thereby halting DNA synthesis [14,15]. An important aspect of the VISA phenotype is alterations in peptidoglycan metabolism leading to increased cell wall thickness [16,17]. According to the false-target hypothesis, it is thought that this overproduction of cell wall material and free d-ala-d-ala binding sites in VISA strains sequesters vancomycin away from its target at the plasma membrane [18]. VISA strains can also demonstrate reduced whole-cell autolytic activity compared with parent strains [19,20], further indicating peptidoglycan metabolism alterations. Mutations in a variety of genes have been reported in VISA that

0924-8579/$ – see front matter © 2009 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. doi:10.1016/j.ijantimicag.2009.01.018

R. Lamichhane-Khadka et al. / International Journal of Antimicrobial Agents 34 (2009) 136–141

developed in an infected patient compared with the initial clonal vancomycin-susceptible infecting strain [17]. Clinical high-level fluoroquinolone resistance in S. aureus is mediated by mutations in the genes encoding both topoisomerase IV and DNA gyrase [14,15]. Intrinsic multidrug efflux pumps also contribute to reduced fluoroquinolone susceptibility in S. aureus [21]. Genes that control virulence factor production or the general stress response of S. aureus, such as the staphylococcal accessory regulator (sarA), the sarA homologue mgrA and the alternative sigma factor (sigB), also affect antimicrobial resistance expression [22–28]. sarA, which was originally identified as a virulence gene product regulator in S. aureus [29], is also required for full expression of fluoroquinolone and vancomycin susceptibility levels and meticillin resistance expression [23,26,30]. Furthermore, sarA inactivation can also lead to increased whole-cell autolysis [31]. The sarA locus is controlled by three unique promoters which produce three overlapping transcripts that terminate at a similar end. sarA controls the expression of select cell wall proteins and exoproteins, and the effector protein SarA binds to several promoters, including those encoding virulence regulatory systems and separate virulence genes (for review see [32]). In an effort to expand our previous work, we have now investigated the effects of sarA inactivation on resistance expression by laboratory-derived VISA and ciprofloxacin-resistant S. aureus strains expressing clinically relevant levels of antimicrobial resistance. Our findings indicate that the sarA locus acts as an important ‘scaffolding’ gene for the expression of these clinically relevant antimicrobial resistance mechanisms. Furthermore, we have investigated whether acquisition of the VISA phenotype in two unrelated S. aureus strains results in an alteration in sarA, sarR, mgrA and sigB expression. 2. Materials and methods 2.1. Bacterial strains The unrelated laboratory-derived isogenic VISA and parent strain sets have been described previously [20,33]. Laboratory VISA were derived from BB270 (a heterogeneous MRSA transductant) [34], COL (a homogeneous MRSA) [35] and strain 13136p–m+, which is one of the first MRSA strains described [36]. Secondstep ciprofloxacin-resistant mutants of SH1000 [37] and COL were picked off Luria broth agar (LBA) (Fisher Scientific, Hampton, NH) containing 4 mg/L (SH10002nd) or 8 mg/L (COL2nd) ciprofloxacin, respectively. Upon repeated passage on drug-free LBA media, these strains continued to express ciprofloxacin-resistant MICs (see below). 2.2. Chemicals and microbiological and molecular biology techniques Transduction of sarA::kan into all S. aureus strains, polymerase chain reaction (PCR) confirmation of sarA::kan acquisition with previously described primers [30] and quantitative real-time PCR (qRT-PCR) with the primers in Table 1 were carried out as described previously [37]. Since kan cassettes can harbour a SmaI site, pulsedfield gel electrophoresis (PFGE) of SmaI-restricted chromosomal DNA [12] was also used to confirm sarA::kan acquisition. All media were prepared with double-distilled water and autoclaved (121 ◦ C, 15 psi, 20 min). Working cultures were maintained on LBA plates made with 25 mg/L kanamycin (Sigma-Aldrich, St Louis, MO) when required for sarA::kan transductants at 4 ◦ C. Frozen culture stocks (−80 ◦ C) were prepared by adding glycerol to overnight Luria broth cultures to a final concentration of 20% (v/v).

137

Table 1 Primers used for quantitative real-time polymerase chain reaction. Primer

Gene

Sequence 5 → 3

Nucleotide positionsa

SarA2-1 SarA2-2 SigB2-1 SigB2-2 MgrA1-1 MgrA1-2 SarR1-1 SarR1-2

sarA sarA sigB sigB mgrA mgrA sarR sarR

CATCAGCGAAAACAAAGAGAAA TTCTTTCATCATGCTCATTACGTT TTTCACCTGAGCAAATTAACCA TCTTCGTGATGTGATTGTCCTT CAATGCTCAAAGACAAGTTAATCG TCTTGACGTTTACAGGAGATTCA CAACGCAACATTTCAAGTTAAGA GGTTTGAACTCTGAGCACTTAGC

700225–700204 700080–700103 2121931–2121910 2121787–2121808 768265–768242 768144–768166 2347148–2347126 2346996–2347018

a

Nucleotide positions based on the published COL genome sequence.

Vancomycin hydrochloride was obtained from Sigma-Aldrich and ciprofloxacin was a gift from Bayer Corp. (Morristown, NJ). Single colonies were used to initiate growth for overnight cultures in appropriate liquid media, which were then grown for 18 h (37 ◦ C, 200 rpm). Agar diffusion MICs were performed according to Clinical and Laboratory Standards Institute guidelines [38] and Etest (AB BIODISK, New Jersey, NJ), according to the manufacturer’s instructions. Antimicrobial resistance population analyses, antimicrobial gradient plates and Triton X-100 (0.05%, v/v, final concentration) (Sigma-Aldrich)-stimulated autolysis were performed as described previously [23,39]. 3. Results 3.1. sarA::kan mutant construction Representative sarA::kan transductants were analysed to determine whether sarA had been appropriately inactivated. All sarA::kan transductants investigated (Table 2) demonstrated stable resistance to kanamycin as expected. Using primers previously described, parent strains COL, COLV10 , BB270 and BB270 V15 produced a 0.4 kb sarA amplicon, whilst strains COLsarA::kan-1, COLV10 sarA::kan-1, BB270sarA::kan-1 and BB270 V15 sarA::kan-1 produced a 1.9 kb sarA amplicon due to the insertion of kan into sarA [30]. Both BB270sarA::kan-1 and COLsarA::kan-1 exhibited two new chromosomal SmaI bands on PFGE analysis (93 kb and 171 kb, and 126 kb and 152 kb, respectively) and each strain also lost one chromosomal band (264 kb and 318 kb, respectively) compared with their respective parent strains BB270 and COL. This demonstrates the acquisition of a kan SmaI site in the sarA::kan mutants investigated. 3.2. Effects of sarA inactivation on vancomycin resistance expression by vancomycin-intermediate Staphylococcus aureus (VISA) and parent strains Almost all of the sarA::kan mutants of vancomycin-susceptible strains BB270, COL and 13136p–m+ did not demonstrate reduced agar diffusion or Etest vancomycin MICs. However, all sarA::kan mutants of BB270 and COL demonstrated reduced distances grown on vancomycin gradients, whilst sarA inactivation in 13136p–m+ background did not alter distances grown on a gradient (Table 2). This is probably due to the increased sensitivity of the gradient plate method compared with the fold changes in drug resistance levels detected by MIC and Etest methods. All sarA::kan mutants of the VISA strains demonstrated a 1.7–3.3-fold reduction in agar dilution vancomycin MICs and a 1.4–12.2-fold reduction in distances grown on vancomycin gradients, and the BB270 and COL series displayed a 1.3–12-fold reduction in Etest vancomycin MICs (Table 2). Vancomycin resistance population analyses also demonstrate reduced survival of BB270sarA::kan and BB270V15 sarA::kan in the presence of vancomycin compared with their parent strains (Fig. 1A). BB270V15 grew to a vancomycin concentration of 8 mg/L,

138

R. Lamichhane-Khadka et al. / International Journal of Antimicrobial Agents 34 (2009) 136–141

Table 2 Vancomycin minimum inhibitory concentrations (MICs) and gradient plate analyses. Strain

Reference

BB270 BB270sarA::kan-1 BB270sarA::kan-2 BB270sarA::kan-3 BB270V15 BB270V15 sarA::kan-1 BB270V15 sarA::kan-2 BB270V15 sarA::kan-3 COL COLsarA::kan-1 COLsarA::kan-2 COLsarA::kan-3 COLV10 COLV10 sarA::kan-1 COLV10 sarA::kan-2 COLV10 sarA::kan-3 13136p–m+ 13136p–m+sarA::kan-1 13136p–m+sarA::kan-2 13136p–m+sarA::kan-3 13136p–m+V20 13136p–m+V20 sarA::kan-1 13136p–m+V20 sarA::kan-3

[20,33] This study This study This study [20,33] This study This study This study [20,33] This study This study This study [20,33] This study This study This study [20,33] This study This study This study [20,33] This study This study

Vancomycin gradientsa,b,c

Vancomycin MICs (␮g/mL) Agar dilution 1 1 1 1 8 3 3 3 2 2 2 2 8 3 3 3 1 1 1 1 10 6 3

Etest 1 1 1 1 12 2.0 1 2 1.5 1.5 1 1.5 4 2 3 3 ND ND ND ND ND ND ND

20 14 14 14 77 14 15

14 55 33 28 23 42 13 16 16 19 17 19 19 73 32 6

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0a 0.5a, * 0.5a, * 0.5a, * 3.7c 0.8c, * 1.7c, * 1.4c, * 8.1b 2.0b, * 2.1b, * 6.7b, * 4.4c 1.5c, * 2.9c, * 3.8c, * 0.6a 4.0a 1.0a 1.0a 0.6c 0.6c, * 0.6c, *

ND, not determined. a–c Mean (±standard deviation) distance grown up vancomycin gradient (mm) (n = 3): a 0 → 1 mg/L; b 0 → 2 mg/L; c 0 → 8 mg/L. * P ≤ 0.05 compared with parent strain.

whilst all three BB270V15 sarA::kan mutants only grew to 2 mg/L. Similar vancomycin resistance population analyses results were observed when COLV10 sarA::kan-1 was compared with COLV10 (Fig. 1B).

3.3. Effects of sarA inactivation on vancomycin-intermediate Staphylococcus aureus (VISA) strain whole-cell autolysis Triton X-100-stimulated whole-cell autolysis experiments were carried out to confirm whether sarA inactivation alters this parameter as previously reported. As expected, the percent optical density at 580 nm (OD580 ) at 60 min was higher for BB270V15 (51 ± 2.8%) and COLV10 (64 ± 0%) compared with parent strains BB270 (35 ± 7%) and COL (47.5 ± 9%) (P ≤ 0.1), indicative of decreased VISA strain whole-cell autolysis. Only COLV10 sarA::kan-1 demonstrated an increase in whole-cell autolysis (41.5 ± 0.7%) compared with COLV10 (P = 0.0005). No other increase in whole-cell autolysis was observed in the sarA::kan transductants of BB270 and BB270V15 and COL compared with their respective parent strains.

3.4. qRT-PCR analysis of sarA, sarR, sigB and mgrA in the BB270 and COL VISA background qRT-PCR revealed that sarA transcriptional activity was downregulated in COLV10 (−2.0-fold) and upregulated in BB270V15 (2.2-fold) compared with their respective parent strains COL and BB270. sarR, the negative regulator gene of sarA [40], was downregulated in both VISA strains compared with parent strains (COLV10 −2.2-fold and BB270V15 −6.2-fold). sigB activity was also downregulated in strain COLV10 (−2.1-fold) compared with COL, but was unaltered in BB270V15 compared with BB270. Although mgrA temporally upregulates sigB and sarA [41], no alteration in mgrA activity was detected in either VISA strain compared with their respective parent strains.

3.5. Effects of sarA inactivation on ciprofloxacin resistance expression by SH1000 and COL fluoroquinolone-resistant mutants Inactivation of sarA in SH10002nd and COL2nd reduced ciprofloxacin agar dilution MICs from 4 mg/L to 1 mg/L and from 8 mg/L to 4 mg/L, respectively. In addition, on a 0 → 10 mg/L ciprofloxacin gradient: SH10002nd grew to a distance of 39 ± 4 mm, whilst SH10002ndsarA::kan did not grow at all; and COL2nd grew to >90 ± 0 mm and COL2ndsarA::kan grew to 45 ± 0.7 mm (P ≤ 0.05). Ciprofloxacin resistance population analysis revealed that whilst SH10002nd produced colonies on 2.5 mg/L ciprofloxacin, SH10002ndsarA::kan stopped producing colonies at 1.25 mg/L (Fig. 2A). Similar results were observed when COL2nd and COL2ndsarA::kan were compared by population analysis (Fig. 2B). 4. Discussion Our findings demonstrate that an intact sarA locus is required for the expression of both vancomycin-intermediate and ciprofloxacin resistance. The present findings are partially supported by a previous report demonstrating reduced vancomycin resistance levels in a sarA-inactivated VISA mutant [42] as well as work from our laboratory demonstrating that sarA is required to support vancomycin and ciprofloxacin susceptibility levels [23,30]. Considering that sarA controls the synthesis of at least tens of genes in the S. aureus genome in a strain-specific manner [43,44], the exact reason why its inactivation reduces resistance to these drugs is open to speculation. It is possible that inactivation of sarA, which leads to a decrease in the half-lives of transcripts required for energy production and carbohydrate transport [45], mechanistically contributes to reduced vancomycin and fluoroquinolone resistance expression. Loss of sarA and the acquisition of mutations leading to the VISA phenotype leads to altered regulation of capJ, purA, fnbA, fnbB, hld, alt, lrgB, purM, nuc and spa, among others [43,46–48]. Perhaps VISA require a functional sarA locus to allow for the SarA control of genes that are needed collectively to thwart the action of vancomycin. The same could be said for ciprofloxacin

R. Lamichhane-Khadka et al. / International Journal of Antimicrobial Agents 34 (2009) 136–141

139

Fig. 1. Vancomycin resistance population analysis of various vancomycin-intermediate Staphylococcus aureus (VISA) strains and their sarA::kan transductants.

since ciprofloxacin induces both the SOS response as well as genes of the tricarboxylic acid cycle in S. aureus [49], and many of these altered genes are also regulated by sarA. In fact, sarA and sarR are also downregulated in response to ciprofloxacin [49], suggesting that a functional sarA response is required for the cell to respond to ciprofloxacin insult, and therefore inactivating this locus and losing this ability reduces ciprofloxacin resistance. sarA also plays a significant role in the regulation of the accessory gene regulator (agr) operon [29,50]. agr-null S. aureus strains acquire the VISA phenotype much more readily that wild-type agr+ strains [51], and loss of agr function contributes to the development of vancomycin resistance [17,22]. Many other loci are required for full expression of the VISA mechanism [18], but the series of mutations leading to this mechanism, whilst identified to a degree [17], still require careful analysis. sarA activity was downregulated in COLV10 but was upregulated in BB270V15 . Since sigB can upregulate sarA [52], and sigB activity was downregulated in COLV10 , this finding may in part account for the decreased expression of sarA in COLV10 . The finding that sarR activity was reduced in both COLV10 and BB270V15 suggests that sarA transcription should be increased in both strains; however, this was only evident in BB270V15 . These findings indicate that whilst the intact sarA cistron is required for full vancomycin resistance expression by VISA, sarA activity remains VISA straindependent. It is interesting to note that fluoroquinolones affect the transcription of both sigB and sarA in a strain-dependent manner

[49,53]. Only COLV10 sarA::kan-1 demonstrated an increase in Triton X-100-stimulated whole-cell autolysis compared with COLV10 . No increase in whole-cell autolysis was observed in the sarA::kan transductants of the other strains investigated. This demonstrates that reductions in vancomycin resistance expression levels following sarA inactivation do not necessarily have to include an alteration in autolysis, even though reduced autolytic activity plays a role in the VISA mechanism. mgrA was not altered in either of the VISA strains investigated, indicating that the VISA mechanism in these strains does not require altered regulation of the multiple efflux pumps that this DNA-binding protein controls [28,54,55]. Planned transcriptome analysis of a sarA-inactivated VISA and ciprofloxacin-resistant mutants will provide valuable insight into the sarA-controlled genes that S. aureus requires to survive in the presence of these antimicrobials. Acknowledgments This work was presented in part at a poster session of the 107th American Society for Microbiology (ASM) Meeting, 21–25 May 2007, Toronto, Canada. Funding: National Institutes of Health: 1R15AI054382-01; S06 GM008136-32 [JEG; New Mexico State University (NMSU) SCORE Program]; R25 GM07667-30 (AEAN and SD; NMSU MARC Program); S06 GM61222-05 (AD; NMSU MBRS-RISE Program); and P20RR016480 from the NM-INBRE Program of the National

140

R. Lamichhane-Khadka et al. / International Journal of Antimicrobial Agents 34 (2009) 136–141

Fig. 2. Vancomycin resistance population analysis of (A) BB270 and BB270V15, and (B) COLV10 and their respective sarA::kan mutants.

Center for Research Resources. JEG and SZ also acknowledge the NMSU Undergraduate Howard Hughes Medical Institute Program (52005881). Competing interests: None declared. Ethical approval: Not required. References [1] Hiramatsu K. The emergence of Staphylococcus aureus with reduced susceptibility to vancomycin in Japan. Am J Med 1998;104:7S–10S. [2] Hiramatsu K, Hanaki H, Ino T, Yabuta K, Oguri T, Tenover FC. Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility. J Antimicrob Chemother 1997;40:135–6. [3] Sieradzki K, Roberts RB, Haber SW, Tomasz A. The development of vancomycin resistance in a patient with methicillin-resistant Staphylococcus aureus infection. N Engl J Med 1999;340:517–23. [4] Smith TL, Pearson ML, Wilcox KR, Cruz C, Lancaster MV, Robinson-Dunn B, et al. Emergence of vancomycin resistance in Staphylococcus aureus. Glycopeptide-Intermediate Staphylococcus aureus Working Group. N Engl J Med 1999;340:493–501. [5] Tenover FC, Biddle JW, Lancaster MV. Increasing resistance to vancomycin and other glycopeptides in Staphylococcus aureus. Emerg Infect Dis 2001;7:327–32. [6] Tiwari HK, Sen MR. Emergence of vancomycin resistant Staphylococcus aureus (VRSA) from a tertiary care hospital from northern part of India. BMC Infect Dis 2006;6:156. [7] Centers for Disease Control and Prevention (CDC). Staphylococcus aureus resistant to vancomycin—United States, 2002. MMWR Morb Mortal Wkly Rep 2002;51:565–7. [8] Smith SM, Eng RH, Tecson-Tumang F. Ciprofloxacin therapy for methicillinresistant Staphylococcus aureus infections or colonizations. Antimicrob Agents Chemother 1989;33:181–4. [9] Westblom TU, Abele B, Blount R, Hyslop DL. Successful oral treatment of methicillin-resistant Staphylococcus aureus osteomyelitis using ciprofloxacin. Am J Med 1988;85:884. [10] Harnett N, Brown S, Krishnan C. Emergence of quinolone resistance among clinical isolates of methicillin-resistant Staphylococcus aureus in Ontario, Canada. Antimicrob Agents Chemother 1991;35:1911–3.

[11] O’Brien FG, Lim TT, Winnett DC, Coombs GW, Pearson JC, Delgado A, et al. Survey of methicillin-resistant Staphylococcus aureus strains from two hospitals in El Paso, Texas. J Clin Microbiol 2005;43:2969–72. [12] Delgado A, Riordan JT, Lamichhane-Khadka R, Winnett DC, Jimenez J, Robinson K, et al. Hetero-vancomycin-intermediate methicillin-resistant Staphylococcus aureus isolate from a medical center in Las Cruces, New Mexico. J Clin Microbiol 2007;45:1325–9. [13] Perkins HR, Nieto M. The chemical basis for the action of the vancomycin group of antibiotics. Ann N Y Acad Sci 1974;235:348–63. [14] Ferrero L, Cameron B, Manse B, Lagneaux D, Crouzet J, Famechon A, et al. Cloning and primary structure of Staphylococcus aureus DNA topoisomerase IV: a primary target of fluoroquinolones. Mol Microbiol 1994;13:641–53. [15] Ng EY, Trucksis M, Hooper DC. Quinolone resistance mutations in topoisomerase IV: relationship to the flqA locus and genetic evidence that topoisomerase IV is the primary target and DNA gyrase is the secondary target of fluoroquinolones in Staphylococcus aureus. Antimicrob Agents Chemother 1996;40:1881–8. [16] Cui L, Ma X, Sato K, Okuma K, Tenover FC, Mamizuka EM, et al. Cell wall thickening is a common feature of vancomycin resistance in Staphylococcus aureus. J Clin Microbiol 2003;41:5–14. [17] Mwangi MM, Wu SW, Zhou Y, Sieradzki K, de Lencastre H, Richardson P, et al. Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by whole-genome sequencing. Proc Natl Acad Sci USA 2007;104:9451–6. [18] Pfeltz RF, Wilkinson BJ. The escalating challenge of vancomycin resistance in Staphylococcus aureus. Curr Drug Targets Infect Disord 2004;4:273–94. [19] Sieradzki K, Tomasz A. Inhibition of cell wall turnover and autolysis by vancomycin in a highly vancomycin-resistant mutant of Staphylococcus aureus. J Bacteriol 1997;179:2557–66. [20] Pfeltz RF, Singh VK, Schmidt JL, Batten MA, Baranyk CS, Nadakavukaren MJ, et al. Characterization of passage-selected vancomycin-resistant Staphylococcus aureus strains of diverse parental backgrounds. Antimicrob Agents Chemother 2000;44:294–303. [21] Aeschlimann JR, Kaatz GW, Rybak MJ. The effects of NorA inhibition on the activities of levofloxacin, ciprofloxacin and norfloxacin against two genetically related strains of Staphylococcus aureus in an in-vitro infection model. J Antimicrob Chemother 1999;44:343–9. [22] Sakoulas G, Eliopoulos GM, Moellering Jr RC, Wennersten C, Venkataraman L, Novick RP, et al. Accessory gene regulator (agr) locus in geographically diverse Staphylococcus aureus isolates with reduced susceptibility to vancomycin. Antimicrob Agents Chemother 2002;46:1492–502. [23] O’Leary JO, Langevin MJ, Price CT, Blevins JS, Smeltzer MS, Gustafson JE. Effects of sarA inactivation on the intrinsic multidrug resistance mechanism of Staphylococcus aureus. FEMS Microbiol Lett 2004;237:297–302. [24] Price CT, Singh VK, Jayaswal RK, Wilkinson BJ, Gustafson JE. Pine oil cleanerresistant Staphylococcus aureus: reduced susceptibility to vancomycin and oxacillin and involvement of SigB. Appl Environ Microbiol 2002;68:5417– 21. [25] Singh VK, Schmidt JL, Jayaswal RK, Wilkinson BJ. Impact of sigB mutation on Staphylococcus aureus oxacillin and vancomycin resistance varies with parental background and method of assessment. Int J Antimicrob Agents 2003;21:256–61. [26] Piriz Duran S, Kayser FH, Berger-Bachi B. Impact of sar and agr on methicillin resistance in Staphylococcus aureus. FEMS Microbiol Lett 1996;141:255–60. [27] Wu S, de Lencastre H, Tomasz A. Sigma-B, a putative operon encoding alternate sigma factor of Staphylococcus aureus RNA polymerase: molecular cloning and DNA sequencing. J Bacteriol 1996;178:6036–42. [28] Truong-Bolduc QC, Dunman PM, Strahilevitz J, Projan SJ, Hooper DC. MgrA is a multiple regulator of two new efflux pumps in Staphylococcus aureus. J Bacteriol 2005;187:2395–405. [29] Cheung AL, Projan SJ. Cloning and sequencing of sarA of Staphylococcus aureus, a gene required for the expression of agr. J Bacteriol 1994;176:4168–72. [30] Riordan JT, O’Leary JO, Gustafson JE. Contributions of sigB and sarA to distinct multiple antimicrobial resistance mechanisms of Staphylococcus aureus. Int J Antimicrob Agents 2006;28:54–61. [31] Fujimoto DF, Bayles KW. Opposing roles of the Staphylococcus aureus virulence regulators, Agr and Sar, in Triton X-100- and penicillin-induced autolysis. J Bacteriol 1998;180:3724–6. [32] Manna AC, Cheung AL. Expression of SarX, a negative regulator of agr and exoprotein synthesis, is activated by MgrA in Staphylococcus aureus. J Bacteriol 2006;188:4288–99. [33] Gustafson JE, O’Brien FG, Coombs GW, Malkowski MJ, Grubb WB, Pfeltz RF, et al. Alterations in phage-typing patterns in vancomycin-intermediate Staphylococcus aureus. J Med Microbiol 2003;52:711–4. [34] Berger-Bachi B. Insertional inactivation of staphylococcal methicillin resistance by Tn551. J Bacteriol 1983;154:479–87. [35] Kornblum J, Hartman BJ, Novick RP, Tomasz A. Conversion of a homogeneously methicillin-resistant strain of Staphylococcus aureus to heterogeneous resistance by Tn551-mediated insertional inactivation. Eur J Clin Microbiol 1986;5:714–8. [36] Jevons MP. ‘Celbenin’-resistant staphylococci. Br Med J 1961;1:124–5. [37] Riordan JT, Muthaiyan A, Van Voorhies W, Price CT, Graham JE, Wilkinson BJ, et al. Response of Staphylococcus aureus to salicylate challenge. J Bacteriol 2007;189:220–7. [38] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. 15th informational supplement. Document M100-S15. Wayne, PA: CLSI; 2005.

R. Lamichhane-Khadka et al. / International Journal of Antimicrobial Agents 34 (2009) 136–141 [39] Gustafson JE, Berger-Bachi B, Strassle A, Wilkinson BJ. Autolysis of methicillinresistant and -susceptible Staphylococcus aureus. Antimicrob Agents Chemother 1992;36:566–72. [40] Manna A, Cheung AL. Characterization of sarR, a modulator of sar expression in Staphylococcus aureus. Infect Immun 2001;69:885–96. [41] Luong TT, Newell SW, Lee CY. Mgr, a novel global regulator in Staphylococcus aureus. J Bacteriol 2003;185:3703–10. [42] Sieradzki K, Tomasz A. Suppression of glycopeptide resistance in a highly teicoplanin-resistant mutant of Staphylococcus aureus by transposon inactivation of genes involved in cell wall synthesis. Microb Drug Resist 1998;4:159–68. [43] Dunman PM, Murphy E, Haney S, Palacios D, Tucker-Kellogg G, Wu S, et al. Transcription profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sarA loci. J Bacteriol 2001;183:7341–53. [44] Cassat J, Dunman PM, Murphy E, Projan SJ, Beenken KE, Palm KJ, et al. Transcriptional profiling of a Staphylococcus aureus clinical isolate and its isogenic agr and sarA mutants reveals global differences in comparison to the laboratory strain RN6390. Microbiology 2006;152:3075–90. [45] Roberts C, Anderson KL, Murphy E, Projan SJ, Mounts W, Hurlburt B, et al. Characterizing the effect of the Staphylococcus aureus virulence factor regulator, SarA, on log-phase mRNA half-lives. J Bacteriol 2006;188:2593–603. [46] McAleese F, Wu SW, Sieradzki K, Dunman P, Murphy E, Projan S, et al. Overexpression of genes of the cell wall stimulon in clinical isolates of Staphylococcus aureus exhibiting vancomycin-intermediate-S. aureus-type resistance to vancomycin. J Bacteriol 2006;188:1120–33. [47] Mongodin E, Finan J, Climo MW, Rosato A, Gill S, Archer GL. Microarray transcription analysis of clinical Staphylococcus aureus isolates resistant to vancomycin. J Bacteriol 2003;185:4638–43.

141

[48] Pieper R, Gatlin-Bunai CL, Mongodin EF, Parmar PP, Huang ST, Clark DJ, et al. Comparative proteomic analysis of Staphylococcus aureus strains with differences in resistance to the cell wall-targeting antibiotic vancomycin. Proteomics 2006;6:4246–58. [49] Cirz RT, Jones MB, Gingles NA, Minogue TD, Jarrahi B, Peterson SN, et al. Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J Bacteriol 2007;189:531–9. [50] Chakrabarti SK, Misra TK. SarA represses agr operon expression in a purified in vitro Staphylococcus aureus transcription system. J Bacteriol 2000;182:5893–7. [51] Tsuji BT, Rybak MJ, Lau KL, Sakoulas G. Evaluation of accessory gene regulator (agr) group and function in the proclivity towards vancomycin intermediate resistance in Staphylococcus aureus. Antimicrob Agents Chemother 2007;51:1089–91. [52] Bischoff M, Dunman P, Kormanec J, Macapagal D, Murphy E, Mounts W, et al. Microarray-based analysis of the Staphylococcus aureus sigmaB regulon. J Bacteriol 2004;186:4085–99. [53] Li D, Renzoni A, Estoppey T, Bisognano C, Francois P, Kelley WL, et al. Induction of fibronectin adhesins in quinolone-resistant Staphylococcus aureus by subinhibitory levels of ciprofloxacin or by sigma B transcription factor activity is mediated by two separate pathways. Antimicrob Agents Chemother 2005;49:916–24. [54] Truong-Bolduc QC, Hooper DC. The transcriptional regulators NorG and MgrA modulate resistance to both quinolones and ␤-lactams in Staphylococcus aureus. J Bacteriol 2007;189:2996–3005. [55] Truong-Bolduc QC, Zhang X, Hooper DC. Characterization of NorR protein, a multifunctional regulator of norA expression in Staphylococcus aureus. J Bacteriol 2003;185:3127–38.