- Email: [email protected]
Selection of DNA aptamers against rat liver X receptors
BBRC Biochemical and Biophysical Research Communications 332 (2005) 512–517 www.elsevier.com/locate/ybbrc
Selection of DNA aptamers against rat liver X receptors Ioana Surugiu-Wa¨rnmark a,*, Anette Wa¨rnmark b, Gudrun Toresson b, ˚ ke Gustafsson b, Leif Bu¨low a Jan-A a
Department of Pure and Applied Biochemistry, Center for Chemistry and Chemical Engineering, Lund University, SE-221 00 Lund, Sweden b Department of Biosciences, NOVUM, Karolinska Institute, Huddinge SE-141 57, Sweden Received 28 April 2005 Available online 5 May 2005
Abstract Liver X receptors alpha and beta (LXRa; LXRb) are members of the nuclear hormone receptor superfamily of ligand-activated transcription factors. LXRs play an important role in the reverse cholesterol transport and govern the expression of many of the proteins that are indispensable for the regulation of normal cholesterol levels in the body. SELEX, an in vitro selection technology, was used on a single stranded DNA library harboring a 12 randomized nucleotide sequence in order to isolate aptamers showing affinity for LXRa. Enzyme-linked assays and surface plasmon resonance measurements showed that the selected aptamers had strong affinities for LXRa with apparent dissociation constants, Kds, in nanomolar range. All clones carried CG-repeats, indicating a probability for a similar manner of binding to LXRa. Very high cross-reactivities were observed when testing the aptamers with LXRb (up to 700%) and RXRa (up to 50%). If instead we regard the aptamer sequences as selected against LXRb, the cross-reactivities decrease considerably, to 17% for LXRa and 7% for RXRa. Therefore, in the future we are planning to use the obtained aptamers as binders for LXRb. 2005 Elsevier Inc. All rights reserved. Keywords: SELEX; Aptamer; LXRa; LXRb; SPR
Atherosclerotic cardiovascular disease is the main cause of death in developed countries. Many studies of this disease target the high levels of serum low-density lipoprotein (LDL) and low levels of high-density lipoprotein (HDL) cholesterol. It has been shown that statins are efficient in lowering high levels of LDL [1]. It appears that an essential function of HDL is linked with reverse cholesterol transport (RCT) [2,3]. Two sterol-responsive transcription factors, LXRa and LXRb, are directly involved in RCT. LXRa and LXRb share a high degree of amino acid similarity (78% in their DNA- and ligand-binding domains), but differ in their tissue distribution. LXRa was first identified in the liver (hence the name liver X *
Corresponding author. Fax: +46 46 2224611. E-mail address: [email protected] (I. SurugiuWa¨rnmark). 0006-291X/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.04.147
receptor), but is also expressed in other metabolically active tissues such as kidney, intestine, adipose tissue, and macrophages; in contrast, LXRb is ubiquitously expressed. LXRs govern the expression of many proteins essential for maintenance of normal cholesterol levels in the body. LXR activation is preceded by an increase in cholesterol levels. Since, neither free cholesterol nor cholesterol ester is capable of binding and activating LXRs, it is believed that elevated intracellular cholesterol levels lead to increased formation of oxysterols, which in return serve as LXR ligands [4,5]. It has turned out to be quite difficult to monitor the LXR proteins directly; monoclonal antibodies have been raised against LXRa but the immunoreactive LXRa protein levels were very low rendering their detection difficult [6]. In this paper, we present the selection and use of small ssDNAs as alternative binders for these proteins.
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
The ssDNAs were obtained with the SELEX (Systematic evolution of ligands by exponential enrichment) method [7–9]. SELEX emerged 14 years ago as a simple technique for randomly selecting short DNAs, RNAs or peptides that selectively bind target molecules, from small organic molecules [10–14] to large proteins [15–21]. Aptamers are antibody analogs in terms of both specificity and affinity with an apparent advantage over antibodies in that they may be produced by automated chemical synthesis. The stability of aptamer–protein complexes is characterized by the apparent dissociation constants (Kd), which vary within the 1–100 nM range and therefore are in a similar affinity and specificity range as antigen-antibody complexes [8].
Materials and methods Materials. The binding buffer consisted of 20 mM Tris, 5 mM MgCl2, and 150 mM NaCl at pH 7.5. Three hundred millimolar imidazole was added to the Tris binding buffer to form the elution buffer. The DNA library and the PCR primers were synthesized by MWG Biotech A/S (Risskov, Denmark). The DNA library consisted of two 20-base primer regions and a 12-base random region (5 0 -ATG ACC ATG ACC CTC CAC AC—N12—TCA GAC TGT GGC AGG GAA AC-3 0 ). The forward primer used for PCR was P1 (5 0 -ATGACCATGACCCTCCACAC-3 0 ) and the reverse primer was P2 (5 0 -GTTTCCCTGCCACAGTCTGA-3 0 ). Biotin 5 0 -end modified forward primer P3 was used in the PCR in order to label the aptamer library. For cloning, a P1c 5 0 primer was used (5 0 -ATT AGG ATC CAT GAC CAT GAC CCT CCA C-3 0 ) and a P2c reverse primer (5 0 -TCT AGG TAC CCT AGT TTC CCT GCC ACA GTC TGA-3 0 ). Rat LXRa and LXRb, including N-terminal His6 tag, were cloned, expressed, and purified according to the protocol described by Toresson et al. [4]. His6 tagged green fluorescent protein (GFP) was provided by Florent Bernaudat, Pure and Applied Biochemistry, Lund University, Sweden. Error-prone PCR. An error-prone PCR was performed in order to mutate and hence to further diverge the pool of DNA fragments. The protocol used to mutate the library was based on the use of MnCl2, non-equivalent amounts of dNTPs, high amount of MgCl2, and low fidelity Taq polymerase as described [22]. By performing this errorprone PCR, it was hoped that further mutations would be achieved in 1.5% of the nucleotide positions in the DNA library. The mutated random library was used as the initial library and termed ‘‘Round 0.’’ PCR and ssDNA production. In the PCR 10 pmol of DNA template, 0.2 mM dNTPs (Fermentas), 1· PCR buffer, 1.25 U/50 ll pfu polymerase (Promega), 8 lM P1 primer, and 8 lM P2 primer were used. Denaturation was performed for 5 min at 94 C. A total of 25 cycles of denaturation (45 s, 94 C), annealing (30 s, 59.3 C), and extension (3 min, 72 C) were performed and followed by a final extension for 10 min at 72 C. ssDNA sequences were produced by using the same PCR parameters, as described above, except that only the P1 primer was used. Aptamer selection. The mutated random library ‘‘Round 0’’ was used for ssDNA production. Two hundred microliters of Ni–NTA agarose gel (Qiagen, CA, USA) was mixed in an Eppendorf tube with 200 ll Tris buffer and 1 lM LxRa protein. The mixture was incubated for 3 h at 4 C. The unbound protein was washed out with 3· 400 ll Tris buffer. The ssDNA pool was heated at 94 C for 3 min, cooled slowly to room temperature, and then mixed with 200 ll Ni–NTA agarose gel (negative selection) for 30 min on a rocking table at RT. The unbound ssDNA was then eluted with a Bio Spin column and
513
mixed with the Ni–NTA–LxRa matrix. After 30 min incubation on a rocking table in RT, the unbound ssDNA was washed out with 5· 400 ll Tris buffer. To the Ni–NTA agarose–LXRa–ssDNA matrix was added 400 ll Tris imidazole buffer and the mixture was incubated for 30 min on a rocking table at RT. The LXRa–ssDNA complexes were eluted with a Bio Spin column into an Eppendorf tube. To the column was applied an additional 400 ll Tris imidazole buffer and the eluate was collected as fraction 2. This latter procedure was repeated until fraction 6 was collected. The fractions were precipitated with 2.5 volumes of 95.5% ethanol and left in the freezer at 20 C for at least 1 h. The samples were then centrifuged at maximum speed for 15 min. The DNA pellets were washed with an additional 200 ll ethanol and left to air-dry on the lab bench. The ssDNA was then solubilized with 40 ll pure water. The retrieval of ssDNA molecules after each cycle was demonstrated by performing PCR with both primers and products were visualized on a 2% agarose gel. This dsDNA was then used as the input DNA for the next selection round. Eight selection rounds were performed in total. Enzyme-linked analyses. The P3 primer was used in the PCR in order to biotinylate the aptamer rounds. To a Ni–NTA 96-well plate (Qiagen) were applied different LXRa dilutions in a 50 ll volume. After a 3 h incubation time at 4 C, the unbound LXRa was removed by applying 3· 100 ll Tris buffer. The denatured biotinylated aptamer rounds (100 nM) (94 C, 3 min) were then applied to the plate and binding was allowed for 2 h at 4 C. The plate was washed with 3· 100 ll Tris buffer and then Streptavidin–HRP (DAKOPATTS AB, Sweden) (1:500) was added to the plate. After 1 h incubation at 4 C, the plate was washed 3· 100 ll Tris buffer. The substrate for HRP (25 mg o-phenylenediamine dihydrochloride, 3.13 ll H2O2 30% in 8.33 ml of 44 mM citrate buffer at pH 5.5) was added to the plate and the color reaction was read at 450 nM using a Multiscan MCC/340 microtiter plate reader (Labsystems, Helsinki, Finland). SPR analyses. SPR analyses were performed using a BIAcore 3000 instrument (BIAcore AB, Uppsala, Sweden). The experiments were carried out at a flow rate of 5 ll/min in 10 mM Hepes, 150 mM NaCl, and 0.005% P20 surfactant at pH 7.4. The P3 primer was used in a linear PCR to biotinylate the aptamer rounds. The rounds (100 nM) were immobilized to saturation, each on a separate flow channel on streptavidin coated chip (BIAcore AB, Uppsala, Sweden). The surface was then blocked with 0.5 mg/ml mannose–biotin and then a series of dilution of LXRa was passed over the immobilized aptamer rounds. Between injections the surface of the chip was regenerated with 0.03% SDS and, if applicable, with 50 mM NaOH containing 0.5 M NaCl. The responses for each individual round were subtracted from the responses obtained for the initial library (negative control). For cross-reactivity studies, the biotinylated clones 50, 67, and 122 were immobilized onto the streptavidin surface and responses were monitored when the clones interacted with LXRa, LXRb, RXRa and GFP. Cloning and sequencing. Round 8 of aptamer selection was further amplified with P1c and P2c primers. Both PCR product and vector pQE-30Xa (Qiagen) were enzymatically digested with the restriction enzymes, BamHI and KpnI (Promega). Different amounts of round 8 and vector were ligated with T4 DNA ligase (Fermentas). The resulting pQE-30 Xa derivatives carrying the eight rounds DNA sequences were transformed into CaCl2-competent TG1 Escherichia coli cells. Plasmids from individual bacterial clones were sequenced using Big Dye Terminator v 3.1 kit (Applied Biosystems).
Results and discussion LXRa and LXRb are members of the nuclear hormone receptor superfamily of ligand-activated tran-
514
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
scription factors. The nuclear receptors (NRs) are characterized by several conserved domains. The DNA-binding domain which is located at the N-terminus is highly conserved and is characterized by a double zinc-finger structure formed by nine Cys residues. The homology between different NRs at this domain is always greater than 50%. The ligand-binding domain of the NRs is less conserved, in the range of 15–40% identity.
LXRa and LXRb are two highly homologous NRs that sense cholesterol excess and regulate multiple genes of lipid metabolism. The phenotypes of LXR knockout mice strongly suggest that the two subtypes have different biological functions. Specifically, LXRa is expressed most abundantly in liver and intestine where it appears to control fatty acid synthesis, whereas LXRb is ubiquitously expressed and appears to control ABC1 expression, and therefore high-density lipoprotein assembly.
Fig. 1. Scheme of aptamer production. The degree of randomization of the DNA library is increased by performing an EP-PCR. The products of the EP-PCR are used to produce the ssDNA, which is then mixed with Ni–NTA agarose in order to eliminate the sequences that bind to the carrier. The unbound ssDNA is then mixed with a Ni–NTA–LXRa matrix. The ssDNA–LXRa complexes are eluted, collected with ethanol precipitation, and the ssDNA amplified with both primers. The obtained dsDNA is used further for ssDNA production and the cycle is repeated eight times. N, nucleotides.
Fig. 2. Enzyme-linked analyses for aptamer rounds. Round 0 (s), round 1 (d), round 4 (m), round 6 (h), and round 8 (j).
Fig. 3. SPR analyses of aptamer binding. LXRa (0.6 lM) was injected onto flow cells covered with immobilized 5 0 biotinylated rounds on a streptavidin coated sensorchip. The arrow indicates the increase in the SPR response for the enriched aptamer rounds (0 fi 8).
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
Fig. 4. SPR analyses of aptamer binding. A streptavidin sensorchip was coated with 5 0 biotinylated aptamer rounds and a series of LXRa dilutions was passed on the chip. Round 0 was used as a negative reference, which was subtracted from the sensorgrams obtained for the other rounds. Round 1 (d), round 4 (n), round 6 (h), and round 8 (j).
LXRa and LXRb function as heterodimers with retinoid X receptor (RXR) and together they bind to response elements that are formed by two hexameric directly repeated (DR) motifs spaced by four nucleotides: AGGTCAXXXXAGGTCA (‘‘DR 4’’) [4,23].
515
This study has started with the selection of a series of short ssDNAs that bind to LXRa. These ssDNAs, named aptamers, were generated using the SELEX method. The method usually starts with a random library containing a core of 25–100 random nucleotides. We wished to simplify the protocol and investigated if we could explore a library with a random core of only 12 nucleotides. Since a 12-nucleotide random core does not provide sufficient number of variants in the library, an error-prone PCR was performed on the ssDNA library that resulted in further mutations in 1.5% of the nucleotide positions. Eight rounds of selection were performed in total and binding analyses were used to monitor the enrichment of binding sequences between selections (Fig. 1). Two methods were used for this purpose, enzyme-linked analyses [12] and SPR measurements [24–26]. Enzyme-linked analyses were carried out in a similar manner as the selection rounds, utilizing the N-terminal His6 tag. To the immobilized proteins were applied the biotinylated aptamers and the binding was monitored with the help of streptavidin–HRP. Fig. 2 shows a clear enrichment between aptamer selections. SPR was used as an alternative method to measure the affinities between aptamer rounds and LXRa.
Table 1 Sequence analysis of 30 DNA aptamers Clone
Sequence 5 0 –3 0
50 53 55 58 61 62 63 67 725 94 96 98 103 122 124 126 132 134 135 1311 1315 1325 1382 151 152 155 156 1516 1537 1555
ATGACCATGACCCTCCACACACCCTACGCGTGTCAGACTGTGGCAGGGAAAC . . .AACGTGCGACGA. . . . . .CACCCGCGTGCA. . . . . .TCGGCGGGCTGA. . . . . .CACGCGAGCTGA. . . . . .CGCATGCACGAA. . . . . .TGCGCGGTGGGA. . . . . .ATGACGATGGGA. . . . . .AATGCGCCGTCA. . . . . .ACCGGGGTACGA. . . . . .ATTGCGAACGGG. . . . . .CGCACCGGATCA. . . . . .CACGCGAGCTGA. . . . . .AATGCGCCGTCA. . . . . .CACTTCACCGTG. . . . . .CCCGCTCGACAA. . . . . .CGACTTGTCGCA. . . . . .GTGCTGGGTGGA. . . . . .TCAGGGCGACGG. . . . . .TGTTGCGACCAA. . . . . .GTCGTGGGAAGT. . . . . .TTGGGCCCGGTG. . . . . .TACCCGCGCATG. . . . . .TGCGCAATGTGG. . . . . .ACGCGCGGACAA. . . . . .CCGGCATGCGAA. . . . . .TCGTTGCGCAGG. . . . . .TCCAGGGCGCAA. . . . . .CGCACCGGATCA. . . . . .ACGGCGATGATG. . .
Primer regions are shown in boldface type. CG repeats are shown underlined.
516
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
In the SPR measurements, a reverse system was employed where the biotinylated aptamer rounds were immobilized on a streptavidin chip. After immobilization of biotinylated aptamer rounds on an SPR-chip, sensorgrams (response versus time) were recorded in the presence of LXRa solutions with concentrations up to 2.77 lM. Round 0 was used as a negative reference and the sensogram obtained for this channel was subtracted from the results obtained for the other rounds (Fig. 4). Enrichment was noticed also with the help of SPR measurements, however, round 0 exhibited a rather high background/binding compared to the results obtained with the enzyme-linked method. Fig. 3 depicts the sensograms obtained for different rounds for an LXRa concentration of 0.6 lM. Apparent Kds could be calculated and, for round 1, were in the 1010 M range while for the rest of the analyzed rounds were in the 1011 M range. Table 1 shows a series of aptamer sequences. It is apparent that they all have in common CG-repeats (underlined in the table), however, thymine was the only nucleotide showing a statistically significant difference and thus lower abundance compared to the others (A, C, and G) (Fig. 5). Clones 50, 67, and 122 were also analyzed with SPR. These clones were selected for the SPR experiments since they had different CG-content. Kds in 1011 M range were obtained for all the clones. No clear difference was noticed in the calculated binding affinities of different clones (Table 2). Since the clones were all originating from round 8, these results were expected. Cross-reactivity studies were performed by monitoring the binding of the clones 50, 67, and 122 to LXRb, RXRa, and GFP (Fig. 6). GFP did not bind to the aptamer surface. This protein was tested in order to
Fig. 5. Mean abundances (in percent) of nucleotides among 30 aptamer sequences found to bind to LXRa. The outer error bars represent minimum and maximum percent of a nucleotide found in the 30 aptamers. Inner error bars represent 95% confidence limits of mean abundance of a nucleotide. Nucleotides are indicated according to; A = adenine, T = thymine, G = guanidine, and C = cytosine.
Table 2 Apparent Kds calculated with the BIAcore software for different proteins in contact with different aptamers Protein
Aptamer
Kd (M)
LXRa LXRa LXRa LXRb LXRb LXRb RXRa RXRa RXRa GFP GFP GFP
50 67 122 50 67 122 50 67 122 50 67 122
1.9 · 1011 1.84 · 1011 2.42 · 1011 1.11 · 1012 8.02 · 1012 7.9 · 1012 1.51 · 1010 2.48 · 109 2.1 · 109 Not calculable Not calculable Not calculable
Fig. 6. Cross-reactivity studies using aptamer sequences 50, 67, and 122 and the proteins LXRa, LXRb, RXRa, and GFP.
eliminate the possibility of interference from the His6 tag of a protein, which is outside of the class of nuclear receptors. LXRb cross-reacted up to 700% and RXRa cross-reacted up to 50% with the aptamer surface, compared to LXRa, which was calculated to 100% (Table 3). There is 78% homology at amino acid level between LXRa and LXRb. All three proteins share more than 50% homology in the zinc-finger domains. However, the results show that they do not bind with the same strength to the aptamer surface (Table 2). To summarize, we report for the first time the production of aptamers that bind to members of the nuclear receptor superfamily, namely LXRa and LXRb. Crossreactivity studies show that the aptamer sequences, Table 3 Cross-reactivities (%) with aptamers selected against LXRa Aptamer
LXRa
LXRb
RXRa
GFP
50 67 122
100 100 100
583.7 706.33 570.33
44.28 50.37 45.47
0 0 0
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517 Table 4 Cross-reactivities (%) with the aptamers regarded as selected against LXRb Aptamer
LXRa
LXRb
RXRa
GFP
50 67 122
17.13 14.15 17.53
100 100 100
7.58 7.13 7.97
0 0 0
analyzed in this paper, would be more suitable as binders for LXRb (Table 4). In this case, the aptamers crossreacted just 17% with LXRa and 7% with RXRa. In the future, these aptamers will be modified to bind exclusively LXRb. Acknowledgments Ioana Surugiu-Wa¨rnmark was supported by a fellowship from SWEGENE (The Postgenomic Research and Technology Programme in South Western Sweden). We thank Peter Olsson for help with the statistical interpretation of the data.
References [1] M. Evans, A. Rees, The myotoxicity of statins, Curr. Opin. Lipidol. 13 (2002) 415–420. [2] A.D. Attie, J.P. Kastelein, M.R. Hayden, Pivotal role of ABCA1 in reverse cholesterol transport influencing HDL levels and susceptibility to atherosclerosis, J. Lipid Res. 42 (2001) 1717–1726. [3] M. Bodzioch, E. Orso, J. Klucken, T. Langmann, A. Bottcher, W. Diederich, W. Drobnik, S. Barlage, C. Buchler, M. PorschOzcurumez, W.E. Kaminski, H.W. Hahmann, K. Oette, G. Rothe, C. Aslanidis, K.J. Lackner, G. Schmitz, The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease, Nat. Genet. 22 (1999) 347–351. [4] G. Toresson, G.U. Schuster, K.R. Steffensen, M. Bengtsson, J. Ljunggren, K. Dahlman-Wright, J.-A. Gustafsson, Purification of functional full-length liver X receptor beta produced in Escherichia coli, Protein Expr. Purif. 35 (2004) 190–198. [5] A. Berkenstam, M. Farnegardh, J.-A. Gustafsson, Convergence of lipid homeostasis through liver X and thyroid hormone receptors, Mech. Ageing Dev. 125 (2004) 707–717. [6] Y. Watanabe, T. Tanaka, Y. Uchiyama, T. Takeno, A. Izumi, H. Yamashita, J. Kumakura, H. Iwanari, J. Shu-Ying, M. Naito, D.J. Mangelsdorf, T. Hamakubo, T. Kodama, Establishment of a monoclonal antibody for human LXRalpha: detection of LXRalpha protein expression in human macrophages, Nucl. Recept. 1 (2003) 1–6. [7] M. Famulok, G. Mayer, Aptamers as tools in molecular biology and immunology, Curr. Top. Microbiol. Immunol. 243 (1999) 123–136. [8] S.D. Jayasena, Aptamers: an emerging class of molecules that rival antibodies in diagnostics, Clin. Chem. 45 (1999) 1628–1650.
517
[9] E.N. Brody, L. Gold, Aptamers as therapeutic and diagnostic agents, J. Biotechnol. 74 (2000) 5–13. [10] D.E. Huizenga, J.W. Szostak, A DNA aptamer that binds adenosine and ATP, Biochemistry 34 (1995) 656–665. [11] T. Kato, K. Yano, K. Ikebukuro, I. Karube, Interaction of threeway DNA junctions with steroids, Nucleic Acids Res. 28 (2000) 1963–1968. [12] T. Kato, K. Yano, K. Ikebukuro, I. Karube, Bioassay of bile acids using an enzyme-linked DNA aptamer, Analyst 125 (2000) 1371–1373. [13] J. Kawakami, H. Imanaka, Y. Yokota, N. Sugimoto, In vitro selection of aptamers that act with Zn2+, J. Inorg. Biochem. 82 (2000) 197–206. [14] E. Vianini, M. Palumbo, B. Gatto, In vitro selection of DNA aptamers that bind L-tyrosinamide, Bioorg. Med. Chem. 9 (2001) 2543–2548. [15] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Selection of single-stranded DNA molecules that bind and inhibit human thrombin, Nature 355 (1992) 564–566. [16] D. Sekkai, E. Dausse, C. Di Primo, F. Darfeuille, C. Boiziau, J.J. Toulme, In vitro selection of DNA aptamers against the HIV-1 TAR RNA hairpin, Antisense Nucleic. Acid Drug Dev. 12 (2002) 265–274. [17] D.A. Daniels, H. Chen, B.J. Hicke, K.M. Swiderek, L. Gold, A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment, Proc. Natl. Acad. Sci. USA 100 (2003) 15416–15421. [18] X. Fang, A. Sen, M. Vicens, W. Tan, Synthetic DNA aptamers to detect protein molecular variants in a high-throughput fluorescence quenching assay, Chembiochem 4 (2003) 829–834. [19] M. Moreno, E. Rincon, D. Pineiro, G. Fernandez, A. Domingo, A. Jimenez-Ruiz, M. Salinas, V.M. Gonzalez, Selection of aptamers against KMP-11 using colloidal gold during the SELEX process, Biochem. Biophys. Res. Commun. 308 (2003) 214–218. [20] F. Pileur, M.L. Andreola, E. Dausse, J. Michel, S. Moreau, H. Yamada, S.A. Gaidamakov, R.J. Crouch, J.J. Toulme, C. Cazenave, Selective inhibitory DNA aptamers of the human RNase H1, Nucleic Acids Res. 31 (2003) 5776–5788. [21] K.K. Stanlis, J.R. McIntosh, Single-strand DNA aptamers as probes for protein localization in cells, J. Histochem. Cytochem. 51 (2003) 797–808. [22] D.S. Wilson, A.D. Keefe, Random mutagenesis by PCR, in: Current Protocols in Molecular Biology, John Wiley, New York, 2000, pp. 8.3.1–8.3.9. [23] J.J. Repa, D.J. Mangelsdorf, The liver X receptor gene team: potential new players in atherosclerosis, Nat. Med. 8 (2002) 1243– 1248. [24] E. Fukusaki, T. Hasunuma, S. Kajiyama, A. Okazawa, T.J. Itoh, A. Kobayashi, SELEX for tubulin affords specific T-rich DNA aptamers. Systematic evolution of ligands by exponential enrichment, Bioorg. Med. Chem. Lett. 11 (2001) 2927–2930. [25] A. Tahiri-Alaoui, L. Frigotto, N. Manville, J. Ibrahim, P. Romby, W. James, High affinity nucleic acid aptamers for streptavidin incorporated into bi-specific capture ligands, Nucleic Acids Res. 30 (2002) e45. [26] S.H. Verhelst, P.J. Michiels, G.A. van der Marel, C.A. van Boeckel, J.H. van Boom, Surface plasmon resonance evaluation of various aminoglycoside–RNA hairpin interactions reveals low degree of selectivity, Chembiochem 5 (2004) 937–942.
Selection of DNA aptamers against rat liver X receptors Ioana Surugiu-Wa¨rnmark a,*, Anette Wa¨rnmark b, Gudrun Toresson b, ˚ ke Gustafsson b, Leif Bu¨low a Jan-A a
Department of Pure and Applied Biochemistry, Center for Chemistry and Chemical Engineering, Lund University, SE-221 00 Lund, Sweden b Department of Biosciences, NOVUM, Karolinska Institute, Huddinge SE-141 57, Sweden Received 28 April 2005 Available online 5 May 2005
Abstract Liver X receptors alpha and beta (LXRa; LXRb) are members of the nuclear hormone receptor superfamily of ligand-activated transcription factors. LXRs play an important role in the reverse cholesterol transport and govern the expression of many of the proteins that are indispensable for the regulation of normal cholesterol levels in the body. SELEX, an in vitro selection technology, was used on a single stranded DNA library harboring a 12 randomized nucleotide sequence in order to isolate aptamers showing affinity for LXRa. Enzyme-linked assays and surface plasmon resonance measurements showed that the selected aptamers had strong affinities for LXRa with apparent dissociation constants, Kds, in nanomolar range. All clones carried CG-repeats, indicating a probability for a similar manner of binding to LXRa. Very high cross-reactivities were observed when testing the aptamers with LXRb (up to 700%) and RXRa (up to 50%). If instead we regard the aptamer sequences as selected against LXRb, the cross-reactivities decrease considerably, to 17% for LXRa and 7% for RXRa. Therefore, in the future we are planning to use the obtained aptamers as binders for LXRb. 2005 Elsevier Inc. All rights reserved. Keywords: SELEX; Aptamer; LXRa; LXRb; SPR
Atherosclerotic cardiovascular disease is the main cause of death in developed countries. Many studies of this disease target the high levels of serum low-density lipoprotein (LDL) and low levels of high-density lipoprotein (HDL) cholesterol. It has been shown that statins are efficient in lowering high levels of LDL [1]. It appears that an essential function of HDL is linked with reverse cholesterol transport (RCT) [2,3]. Two sterol-responsive transcription factors, LXRa and LXRb, are directly involved in RCT. LXRa and LXRb share a high degree of amino acid similarity (78% in their DNA- and ligand-binding domains), but differ in their tissue distribution. LXRa was first identified in the liver (hence the name liver X *
Corresponding author. Fax: +46 46 2224611. E-mail address: [email protected] (I. SurugiuWa¨rnmark). 0006-291X/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.04.147
receptor), but is also expressed in other metabolically active tissues such as kidney, intestine, adipose tissue, and macrophages; in contrast, LXRb is ubiquitously expressed. LXRs govern the expression of many proteins essential for maintenance of normal cholesterol levels in the body. LXR activation is preceded by an increase in cholesterol levels. Since, neither free cholesterol nor cholesterol ester is capable of binding and activating LXRs, it is believed that elevated intracellular cholesterol levels lead to increased formation of oxysterols, which in return serve as LXR ligands [4,5]. It has turned out to be quite difficult to monitor the LXR proteins directly; monoclonal antibodies have been raised against LXRa but the immunoreactive LXRa protein levels were very low rendering their detection difficult [6]. In this paper, we present the selection and use of small ssDNAs as alternative binders for these proteins.
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
The ssDNAs were obtained with the SELEX (Systematic evolution of ligands by exponential enrichment) method [7–9]. SELEX emerged 14 years ago as a simple technique for randomly selecting short DNAs, RNAs or peptides that selectively bind target molecules, from small organic molecules [10–14] to large proteins [15–21]. Aptamers are antibody analogs in terms of both specificity and affinity with an apparent advantage over antibodies in that they may be produced by automated chemical synthesis. The stability of aptamer–protein complexes is characterized by the apparent dissociation constants (Kd), which vary within the 1–100 nM range and therefore are in a similar affinity and specificity range as antigen-antibody complexes [8].
Materials and methods Materials. The binding buffer consisted of 20 mM Tris, 5 mM MgCl2, and 150 mM NaCl at pH 7.5. Three hundred millimolar imidazole was added to the Tris binding buffer to form the elution buffer. The DNA library and the PCR primers were synthesized by MWG Biotech A/S (Risskov, Denmark). The DNA library consisted of two 20-base primer regions and a 12-base random region (5 0 -ATG ACC ATG ACC CTC CAC AC—N12—TCA GAC TGT GGC AGG GAA AC-3 0 ). The forward primer used for PCR was P1 (5 0 -ATGACCATGACCCTCCACAC-3 0 ) and the reverse primer was P2 (5 0 -GTTTCCCTGCCACAGTCTGA-3 0 ). Biotin 5 0 -end modified forward primer P3 was used in the PCR in order to label the aptamer library. For cloning, a P1c 5 0 primer was used (5 0 -ATT AGG ATC CAT GAC CAT GAC CCT CCA C-3 0 ) and a P2c reverse primer (5 0 -TCT AGG TAC CCT AGT TTC CCT GCC ACA GTC TGA-3 0 ). Rat LXRa and LXRb, including N-terminal His6 tag, were cloned, expressed, and purified according to the protocol described by Toresson et al. [4]. His6 tagged green fluorescent protein (GFP) was provided by Florent Bernaudat, Pure and Applied Biochemistry, Lund University, Sweden. Error-prone PCR. An error-prone PCR was performed in order to mutate and hence to further diverge the pool of DNA fragments. The protocol used to mutate the library was based on the use of MnCl2, non-equivalent amounts of dNTPs, high amount of MgCl2, and low fidelity Taq polymerase as described [22]. By performing this errorprone PCR, it was hoped that further mutations would be achieved in 1.5% of the nucleotide positions in the DNA library. The mutated random library was used as the initial library and termed ‘‘Round 0.’’ PCR and ssDNA production. In the PCR 10 pmol of DNA template, 0.2 mM dNTPs (Fermentas), 1· PCR buffer, 1.25 U/50 ll pfu polymerase (Promega), 8 lM P1 primer, and 8 lM P2 primer were used. Denaturation was performed for 5 min at 94 C. A total of 25 cycles of denaturation (45 s, 94 C), annealing (30 s, 59.3 C), and extension (3 min, 72 C) were performed and followed by a final extension for 10 min at 72 C. ssDNA sequences were produced by using the same PCR parameters, as described above, except that only the P1 primer was used. Aptamer selection. The mutated random library ‘‘Round 0’’ was used for ssDNA production. Two hundred microliters of Ni–NTA agarose gel (Qiagen, CA, USA) was mixed in an Eppendorf tube with 200 ll Tris buffer and 1 lM LxRa protein. The mixture was incubated for 3 h at 4 C. The unbound protein was washed out with 3· 400 ll Tris buffer. The ssDNA pool was heated at 94 C for 3 min, cooled slowly to room temperature, and then mixed with 200 ll Ni–NTA agarose gel (negative selection) for 30 min on a rocking table at RT. The unbound ssDNA was then eluted with a Bio Spin column and
513
mixed with the Ni–NTA–LxRa matrix. After 30 min incubation on a rocking table in RT, the unbound ssDNA was washed out with 5· 400 ll Tris buffer. To the Ni–NTA agarose–LXRa–ssDNA matrix was added 400 ll Tris imidazole buffer and the mixture was incubated for 30 min on a rocking table at RT. The LXRa–ssDNA complexes were eluted with a Bio Spin column into an Eppendorf tube. To the column was applied an additional 400 ll Tris imidazole buffer and the eluate was collected as fraction 2. This latter procedure was repeated until fraction 6 was collected. The fractions were precipitated with 2.5 volumes of 95.5% ethanol and left in the freezer at 20 C for at least 1 h. The samples were then centrifuged at maximum speed for 15 min. The DNA pellets were washed with an additional 200 ll ethanol and left to air-dry on the lab bench. The ssDNA was then solubilized with 40 ll pure water. The retrieval of ssDNA molecules after each cycle was demonstrated by performing PCR with both primers and products were visualized on a 2% agarose gel. This dsDNA was then used as the input DNA for the next selection round. Eight selection rounds were performed in total. Enzyme-linked analyses. The P3 primer was used in the PCR in order to biotinylate the aptamer rounds. To a Ni–NTA 96-well plate (Qiagen) were applied different LXRa dilutions in a 50 ll volume. After a 3 h incubation time at 4 C, the unbound LXRa was removed by applying 3· 100 ll Tris buffer. The denatured biotinylated aptamer rounds (100 nM) (94 C, 3 min) were then applied to the plate and binding was allowed for 2 h at 4 C. The plate was washed with 3· 100 ll Tris buffer and then Streptavidin–HRP (DAKOPATTS AB, Sweden) (1:500) was added to the plate. After 1 h incubation at 4 C, the plate was washed 3· 100 ll Tris buffer. The substrate for HRP (25 mg o-phenylenediamine dihydrochloride, 3.13 ll H2O2 30% in 8.33 ml of 44 mM citrate buffer at pH 5.5) was added to the plate and the color reaction was read at 450 nM using a Multiscan MCC/340 microtiter plate reader (Labsystems, Helsinki, Finland). SPR analyses. SPR analyses were performed using a BIAcore 3000 instrument (BIAcore AB, Uppsala, Sweden). The experiments were carried out at a flow rate of 5 ll/min in 10 mM Hepes, 150 mM NaCl, and 0.005% P20 surfactant at pH 7.4. The P3 primer was used in a linear PCR to biotinylate the aptamer rounds. The rounds (100 nM) were immobilized to saturation, each on a separate flow channel on streptavidin coated chip (BIAcore AB, Uppsala, Sweden). The surface was then blocked with 0.5 mg/ml mannose–biotin and then a series of dilution of LXRa was passed over the immobilized aptamer rounds. Between injections the surface of the chip was regenerated with 0.03% SDS and, if applicable, with 50 mM NaOH containing 0.5 M NaCl. The responses for each individual round were subtracted from the responses obtained for the initial library (negative control). For cross-reactivity studies, the biotinylated clones 50, 67, and 122 were immobilized onto the streptavidin surface and responses were monitored when the clones interacted with LXRa, LXRb, RXRa and GFP. Cloning and sequencing. Round 8 of aptamer selection was further amplified with P1c and P2c primers. Both PCR product and vector pQE-30Xa (Qiagen) were enzymatically digested with the restriction enzymes, BamHI and KpnI (Promega). Different amounts of round 8 and vector were ligated with T4 DNA ligase (Fermentas). The resulting pQE-30 Xa derivatives carrying the eight rounds DNA sequences were transformed into CaCl2-competent TG1 Escherichia coli cells. Plasmids from individual bacterial clones were sequenced using Big Dye Terminator v 3.1 kit (Applied Biosystems).
Results and discussion LXRa and LXRb are members of the nuclear hormone receptor superfamily of ligand-activated tran-
514
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
scription factors. The nuclear receptors (NRs) are characterized by several conserved domains. The DNA-binding domain which is located at the N-terminus is highly conserved and is characterized by a double zinc-finger structure formed by nine Cys residues. The homology between different NRs at this domain is always greater than 50%. The ligand-binding domain of the NRs is less conserved, in the range of 15–40% identity.
LXRa and LXRb are two highly homologous NRs that sense cholesterol excess and regulate multiple genes of lipid metabolism. The phenotypes of LXR knockout mice strongly suggest that the two subtypes have different biological functions. Specifically, LXRa is expressed most abundantly in liver and intestine where it appears to control fatty acid synthesis, whereas LXRb is ubiquitously expressed and appears to control ABC1 expression, and therefore high-density lipoprotein assembly.
Fig. 1. Scheme of aptamer production. The degree of randomization of the DNA library is increased by performing an EP-PCR. The products of the EP-PCR are used to produce the ssDNA, which is then mixed with Ni–NTA agarose in order to eliminate the sequences that bind to the carrier. The unbound ssDNA is then mixed with a Ni–NTA–LXRa matrix. The ssDNA–LXRa complexes are eluted, collected with ethanol precipitation, and the ssDNA amplified with both primers. The obtained dsDNA is used further for ssDNA production and the cycle is repeated eight times. N, nucleotides.
Fig. 2. Enzyme-linked analyses for aptamer rounds. Round 0 (s), round 1 (d), round 4 (m), round 6 (h), and round 8 (j).
Fig. 3. SPR analyses of aptamer binding. LXRa (0.6 lM) was injected onto flow cells covered with immobilized 5 0 biotinylated rounds on a streptavidin coated sensorchip. The arrow indicates the increase in the SPR response for the enriched aptamer rounds (0 fi 8).
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
Fig. 4. SPR analyses of aptamer binding. A streptavidin sensorchip was coated with 5 0 biotinylated aptamer rounds and a series of LXRa dilutions was passed on the chip. Round 0 was used as a negative reference, which was subtracted from the sensorgrams obtained for the other rounds. Round 1 (d), round 4 (n), round 6 (h), and round 8 (j).
LXRa and LXRb function as heterodimers with retinoid X receptor (RXR) and together they bind to response elements that are formed by two hexameric directly repeated (DR) motifs spaced by four nucleotides: AGGTCAXXXXAGGTCA (‘‘DR 4’’) [4,23].
515
This study has started with the selection of a series of short ssDNAs that bind to LXRa. These ssDNAs, named aptamers, were generated using the SELEX method. The method usually starts with a random library containing a core of 25–100 random nucleotides. We wished to simplify the protocol and investigated if we could explore a library with a random core of only 12 nucleotides. Since a 12-nucleotide random core does not provide sufficient number of variants in the library, an error-prone PCR was performed on the ssDNA library that resulted in further mutations in 1.5% of the nucleotide positions. Eight rounds of selection were performed in total and binding analyses were used to monitor the enrichment of binding sequences between selections (Fig. 1). Two methods were used for this purpose, enzyme-linked analyses [12] and SPR measurements [24–26]. Enzyme-linked analyses were carried out in a similar manner as the selection rounds, utilizing the N-terminal His6 tag. To the immobilized proteins were applied the biotinylated aptamers and the binding was monitored with the help of streptavidin–HRP. Fig. 2 shows a clear enrichment between aptamer selections. SPR was used as an alternative method to measure the affinities between aptamer rounds and LXRa.
Table 1 Sequence analysis of 30 DNA aptamers Clone
Sequence 5 0 –3 0
50 53 55 58 61 62 63 67 725 94 96 98 103 122 124 126 132 134 135 1311 1315 1325 1382 151 152 155 156 1516 1537 1555
ATGACCATGACCCTCCACACACCCTACGCGTGTCAGACTGTGGCAGGGAAAC . . .AACGTGCGACGA. . . . . .CACCCGCGTGCA. . . . . .TCGGCGGGCTGA. . . . . .CACGCGAGCTGA. . . . . .CGCATGCACGAA. . . . . .TGCGCGGTGGGA. . . . . .ATGACGATGGGA. . . . . .AATGCGCCGTCA. . . . . .ACCGGGGTACGA. . . . . .ATTGCGAACGGG. . . . . .CGCACCGGATCA. . . . . .CACGCGAGCTGA. . . . . .AATGCGCCGTCA. . . . . .CACTTCACCGTG. . . . . .CCCGCTCGACAA. . . . . .CGACTTGTCGCA. . . . . .GTGCTGGGTGGA. . . . . .TCAGGGCGACGG. . . . . .TGTTGCGACCAA. . . . . .GTCGTGGGAAGT. . . . . .TTGGGCCCGGTG. . . . . .TACCCGCGCATG. . . . . .TGCGCAATGTGG. . . . . .ACGCGCGGACAA. . . . . .CCGGCATGCGAA. . . . . .TCGTTGCGCAGG. . . . . .TCCAGGGCGCAA. . . . . .CGCACCGGATCA. . . . . .ACGGCGATGATG. . .
Primer regions are shown in boldface type. CG repeats are shown underlined.
516
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517
In the SPR measurements, a reverse system was employed where the biotinylated aptamer rounds were immobilized on a streptavidin chip. After immobilization of biotinylated aptamer rounds on an SPR-chip, sensorgrams (response versus time) were recorded in the presence of LXRa solutions with concentrations up to 2.77 lM. Round 0 was used as a negative reference and the sensogram obtained for this channel was subtracted from the results obtained for the other rounds (Fig. 4). Enrichment was noticed also with the help of SPR measurements, however, round 0 exhibited a rather high background/binding compared to the results obtained with the enzyme-linked method. Fig. 3 depicts the sensograms obtained for different rounds for an LXRa concentration of 0.6 lM. Apparent Kds could be calculated and, for round 1, were in the 1010 M range while for the rest of the analyzed rounds were in the 1011 M range. Table 1 shows a series of aptamer sequences. It is apparent that they all have in common CG-repeats (underlined in the table), however, thymine was the only nucleotide showing a statistically significant difference and thus lower abundance compared to the others (A, C, and G) (Fig. 5). Clones 50, 67, and 122 were also analyzed with SPR. These clones were selected for the SPR experiments since they had different CG-content. Kds in 1011 M range were obtained for all the clones. No clear difference was noticed in the calculated binding affinities of different clones (Table 2). Since the clones were all originating from round 8, these results were expected. Cross-reactivity studies were performed by monitoring the binding of the clones 50, 67, and 122 to LXRb, RXRa, and GFP (Fig. 6). GFP did not bind to the aptamer surface. This protein was tested in order to
Fig. 5. Mean abundances (in percent) of nucleotides among 30 aptamer sequences found to bind to LXRa. The outer error bars represent minimum and maximum percent of a nucleotide found in the 30 aptamers. Inner error bars represent 95% confidence limits of mean abundance of a nucleotide. Nucleotides are indicated according to; A = adenine, T = thymine, G = guanidine, and C = cytosine.
Table 2 Apparent Kds calculated with the BIAcore software for different proteins in contact with different aptamers Protein
Aptamer
Kd (M)
LXRa LXRa LXRa LXRb LXRb LXRb RXRa RXRa RXRa GFP GFP GFP
50 67 122 50 67 122 50 67 122 50 67 122
1.9 · 1011 1.84 · 1011 2.42 · 1011 1.11 · 1012 8.02 · 1012 7.9 · 1012 1.51 · 1010 2.48 · 109 2.1 · 109 Not calculable Not calculable Not calculable
Fig. 6. Cross-reactivity studies using aptamer sequences 50, 67, and 122 and the proteins LXRa, LXRb, RXRa, and GFP.
eliminate the possibility of interference from the His6 tag of a protein, which is outside of the class of nuclear receptors. LXRb cross-reacted up to 700% and RXRa cross-reacted up to 50% with the aptamer surface, compared to LXRa, which was calculated to 100% (Table 3). There is 78% homology at amino acid level between LXRa and LXRb. All three proteins share more than 50% homology in the zinc-finger domains. However, the results show that they do not bind with the same strength to the aptamer surface (Table 2). To summarize, we report for the first time the production of aptamers that bind to members of the nuclear receptor superfamily, namely LXRa and LXRb. Crossreactivity studies show that the aptamer sequences, Table 3 Cross-reactivities (%) with aptamers selected against LXRa Aptamer
LXRa
LXRb
RXRa
GFP
50 67 122
100 100 100
583.7 706.33 570.33
44.28 50.37 45.47
0 0 0
I. Surugiu-Wa¨rnmark et al. / Biochemical and Biophysical Research Communications 332 (2005) 512–517 Table 4 Cross-reactivities (%) with the aptamers regarded as selected against LXRb Aptamer
LXRa
LXRb
RXRa
GFP
50 67 122
17.13 14.15 17.53
100 100 100
7.58 7.13 7.97
0 0 0
analyzed in this paper, would be more suitable as binders for LXRb (Table 4). In this case, the aptamers crossreacted just 17% with LXRa and 7% with RXRa. In the future, these aptamers will be modified to bind exclusively LXRb. Acknowledgments Ioana Surugiu-Wa¨rnmark was supported by a fellowship from SWEGENE (The Postgenomic Research and Technology Programme in South Western Sweden). We thank Peter Olsson for help with the statistical interpretation of the data.
References [1] M. Evans, A. Rees, The myotoxicity of statins, Curr. Opin. Lipidol. 13 (2002) 415–420. [2] A.D. Attie, J.P. Kastelein, M.R. Hayden, Pivotal role of ABCA1 in reverse cholesterol transport influencing HDL levels and susceptibility to atherosclerosis, J. Lipid Res. 42 (2001) 1717–1726. [3] M. Bodzioch, E. Orso, J. Klucken, T. Langmann, A. Bottcher, W. Diederich, W. Drobnik, S. Barlage, C. Buchler, M. PorschOzcurumez, W.E. Kaminski, H.W. Hahmann, K. Oette, G. Rothe, C. Aslanidis, K.J. Lackner, G. Schmitz, The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease, Nat. Genet. 22 (1999) 347–351. [4] G. Toresson, G.U. Schuster, K.R. Steffensen, M. Bengtsson, J. Ljunggren, K. Dahlman-Wright, J.-A. Gustafsson, Purification of functional full-length liver X receptor beta produced in Escherichia coli, Protein Expr. Purif. 35 (2004) 190–198. [5] A. Berkenstam, M. Farnegardh, J.-A. Gustafsson, Convergence of lipid homeostasis through liver X and thyroid hormone receptors, Mech. Ageing Dev. 125 (2004) 707–717. [6] Y. Watanabe, T. Tanaka, Y. Uchiyama, T. Takeno, A. Izumi, H. Yamashita, J. Kumakura, H. Iwanari, J. Shu-Ying, M. Naito, D.J. Mangelsdorf, T. Hamakubo, T. Kodama, Establishment of a monoclonal antibody for human LXRalpha: detection of LXRalpha protein expression in human macrophages, Nucl. Recept. 1 (2003) 1–6. [7] M. Famulok, G. Mayer, Aptamers as tools in molecular biology and immunology, Curr. Top. Microbiol. Immunol. 243 (1999) 123–136. [8] S.D. Jayasena, Aptamers: an emerging class of molecules that rival antibodies in diagnostics, Clin. Chem. 45 (1999) 1628–1650.
517
[9] E.N. Brody, L. Gold, Aptamers as therapeutic and diagnostic agents, J. Biotechnol. 74 (2000) 5–13. [10] D.E. Huizenga, J.W. Szostak, A DNA aptamer that binds adenosine and ATP, Biochemistry 34 (1995) 656–665. [11] T. Kato, K. Yano, K. Ikebukuro, I. Karube, Interaction of threeway DNA junctions with steroids, Nucleic Acids Res. 28 (2000) 1963–1968. [12] T. Kato, K. Yano, K. Ikebukuro, I. Karube, Bioassay of bile acids using an enzyme-linked DNA aptamer, Analyst 125 (2000) 1371–1373. [13] J. Kawakami, H. Imanaka, Y. Yokota, N. Sugimoto, In vitro selection of aptamers that act with Zn2+, J. Inorg. Biochem. 82 (2000) 197–206. [14] E. Vianini, M. Palumbo, B. Gatto, In vitro selection of DNA aptamers that bind L-tyrosinamide, Bioorg. Med. Chem. 9 (2001) 2543–2548. [15] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Selection of single-stranded DNA molecules that bind and inhibit human thrombin, Nature 355 (1992) 564–566. [16] D. Sekkai, E. Dausse, C. Di Primo, F. Darfeuille, C. Boiziau, J.J. Toulme, In vitro selection of DNA aptamers against the HIV-1 TAR RNA hairpin, Antisense Nucleic. Acid Drug Dev. 12 (2002) 265–274. [17] D.A. Daniels, H. Chen, B.J. Hicke, K.M. Swiderek, L. Gold, A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment, Proc. Natl. Acad. Sci. USA 100 (2003) 15416–15421. [18] X. Fang, A. Sen, M. Vicens, W. Tan, Synthetic DNA aptamers to detect protein molecular variants in a high-throughput fluorescence quenching assay, Chembiochem 4 (2003) 829–834. [19] M. Moreno, E. Rincon, D. Pineiro, G. Fernandez, A. Domingo, A. Jimenez-Ruiz, M. Salinas, V.M. Gonzalez, Selection of aptamers against KMP-11 using colloidal gold during the SELEX process, Biochem. Biophys. Res. Commun. 308 (2003) 214–218. [20] F. Pileur, M.L. Andreola, E. Dausse, J. Michel, S. Moreau, H. Yamada, S.A. Gaidamakov, R.J. Crouch, J.J. Toulme, C. Cazenave, Selective inhibitory DNA aptamers of the human RNase H1, Nucleic Acids Res. 31 (2003) 5776–5788. [21] K.K. Stanlis, J.R. McIntosh, Single-strand DNA aptamers as probes for protein localization in cells, J. Histochem. Cytochem. 51 (2003) 797–808. [22] D.S. Wilson, A.D. Keefe, Random mutagenesis by PCR, in: Current Protocols in Molecular Biology, John Wiley, New York, 2000, pp. 8.3.1–8.3.9. [23] J.J. Repa, D.J. Mangelsdorf, The liver X receptor gene team: potential new players in atherosclerosis, Nat. Med. 8 (2002) 1243– 1248. [24] E. Fukusaki, T. Hasunuma, S. Kajiyama, A. Okazawa, T.J. Itoh, A. Kobayashi, SELEX for tubulin affords specific T-rich DNA aptamers. Systematic evolution of ligands by exponential enrichment, Bioorg. Med. Chem. Lett. 11 (2001) 2927–2930. [25] A. Tahiri-Alaoui, L. Frigotto, N. Manville, J. Ibrahim, P. Romby, W. James, High affinity nucleic acid aptamers for streptavidin incorporated into bi-specific capture ligands, Nucleic Acids Res. 30 (2002) e45. [26] S.H. Verhelst, P.J. Michiels, G.A. van der Marel, C.A. van Boeckel, J.H. van Boom, Surface plasmon resonance evaluation of various aminoglycoside–RNA hairpin interactions reveals low degree of selectivity, Chembiochem 5 (2004) 937–942.