- Email: [email protected]
Shrimp STAT was hijacked by white spot syndrome virus immediate-early protein IE1 involved in modulation of viral genes
Fish & Shellfish Immunology 59 (2016) 268e275
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Shrimp STAT was hijacked by white spot syndrome virus immediate-early protein IE1 involved in modulation of viral genes Defu Yao a, b, 1, Lingwei Ruan b, *, 1, Huasong Lu b, Hong Shi b, Xun Xu b a
School of Life Science, Xiamen University, Xiamen 361005, People's Republic of China State Key Laboratory Breeding Base of Marine Genetic Resources, Key Laboratory of Marine Genetic Resources of State Oceanic Administration, Third Institute of Oceanography, State Oceanic Administration, Key Laboratory of Marine Genetic Resources of Fujian Province, South China Sea Bio-Resource Exploitation and Utilization Collaborative Innovation Center, Xiamen 361005, People's Republic of China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 July 2016 Received in revised form 18 October 2016 Accepted 30 October 2016 Available online 1 November 2016
STATs are a family of transcription factors that regulate a cascade of cellular processes including cell growth, differentiation, apoptosis and immune responses. However, they are usually targeted by viruses to assist infection. In this study, we identified that white spot syndrome virus (WSSV) immediate-early protein IE1 interacted with Litopenaeus vannamei STAT (LvSTAT) and thereby led to its phosphorylation activation. In addition, we demonstrated that LvSTAT could bind to the promoters of the viral immediateearly genes wsv051 and ie1 through STAT-binding motifs in vitro and vivo, allowing the enhancement of their promoters' activities. Moreover, IE1 could promote the transcriptional activation activity of LvSTAT to augment the transcription of wsv051 and ie1. In conclusion, our findings revealed a novel linkage between WSSV IE1 and shrimp STAT, which was a clue to well understand how WSSV adopted the active strategies to modulate the shrimp signaling pathway. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Shrimp WSSV STAT IE1 Interaction Transcription regulation
1. Introduction Signal transducers and activators of transcription (STATs) are a family of latent cytoplasmic transcription factors that comprise seven members in mammals, named STAT1, STAT2, STAT3, STAT4, STAT5 (STAT5A and STAT5B) and STAT6 [1,2]. Upon activation by tyrosine phosphorylation, STATs can dimerize and translocate into the nucleus where they bind to their cognate DNA response elements and trigger gene transcription. In mammals, STATs are usually the common target of viruses [3]. Several viruses are known to regulate the host STATs activity to enhance replication or oncogenic potential of the viruses. For instance, Hepatitis C virus (HCV) core protein was found to directly interact with and activate the host STAT3, which led to cell growth transformation [4]. Similarly, Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded immediate-early (IE) protein ORF50 and latency-associated nuclear antigen (LANA) could also enhance the transcriptional activation
* Corresponding author. Third Institute of Oceanography, No. 178 Daxue Road, Xiamen, Fujian 361005, People's Republic of China. E-mail address: [email protected] (L. Ruan). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2016.10.051 1050-4648/© 2016 Elsevier Ltd. All rights reserved.
activity of STAT3 by direct binding [5,6]. Previous studies have shown that white spot syndrome virus (WSSV) can induce shrimp STAT activation to facilitate the transcription of the viral gene ie1, suggesting that the activated STAT was conducive to WSSV infection [7,8]. A recent study further confirmed that WSSV replication was inhibited after disrupting STAT activity by gene silencing or addition with specific inhibitor of STAT [9]. Therefore, these results suggested that shrimp STAT was also targeted and exploited by WSSV. However, very little is known regarding the detailed molecular mechanism by which WSSV regulates the STAT activity in shrimp. WSSV is a large circular double-stranded DNA (dsDNA) virus with a genome of approximately 300 kb [10,11]. It is currently the most destructive pathogen and severely threatens the worldwide shrimp farming industries [12]. Like most dsDNA viruses, the WSSV genes can be roughly divided into three categories during the viral replication cycle: IE genes, early genes and late genes [13]. In general, IE genes are often widely investigated because of their critical regulatory roles in the pathogenesis of viral infection [14e16]. Up to date, twenty-one IE genes have been identified from WSSV [17e19]. Among them, IE1, also designated as WSV069, was the focus of studies and its biological functions were frequently reported in recent years. It has been found that IE1 can act as a
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
transcription factor with transactivation, dimerization and DNA binding activities [20]. In addition, IE1 was demonstrated to associate with and hijack shrimp TATA box-binding protein (TBP) and thioredoxin (Trx) to improve its transcriptional activation activity [21,22]. Recently, IE1 has been also shown to bind competitively to shrimp retinoblastoma protein (Rb), which led to releasing the E2F transcription factor from Rb-E2F complex to stimulate the G1/S transition of the cells [23]. To sum up, these data indicated that IE1 was multifaceted in functions with the abilities to regulate the transcription of targets genes, or serve as an adaptor protein involved in recruiting and manipulating host proteins to enhance viral infection. In the present study, we further found that WSSV IE1 could physically interact with Litopenaeus vannamei STAT (LvSTAT), and then induced the phosphorylation activation of LvSTAT. In this way, the activated LvSTAT facilitated the transcription of the viral IE genes wsv051 and ie1 through their STAT binding motifs in the promoters. Hence our results indicated that IE1 could be engaged in the transcription of viral genes by influencing LvSTAT activity. 2. Materials and methods 2.1. Antibodies Rabbit antibody against V5 tag (anti-V5) was purchased from Millipore and used for co-IP assays. Anti-V5 antibody linked with horseradish peroxidase (anti-V5-HRP) from Life Technology was used in the western blot. Mouse antibody anti-EGFP was acquired from Millipore. Mouse antibodies anti-FLAG M2 and anti-tubulin were bought from Sigma. The mouse antibody against LvSTAT was prepared in our lab by immunization with purified recombinant protein. HRP-conjuncted goat anti-mouse and anti-rabbit secondary antibodies were obtained from Thermo Scientific. 2.2. Plasmids construction The empty vector pIZ-V5-His (Life Technology) was used to construct the plasmids for LvSTAT and IE1 expression in insect cells. For LvSTAT expression, the open reading frame (ORF) of LvSTAT were amplified by gene-specific primers and cloned into the pIZV5-His vector to generate the V5-tagged expression plasmid pIZ-
V5-LvSTAT. In co-IP assay, the FLAG-tagged plasmid pIZ-FLAGLvSTAT was also constructed by cloning the ORF of LvSTAT into pIZ-V5-His vector and fusing a FLAG tag to the N-terminus. For IE1 expression, the ORF of IE1 were fused with EGFP at the N-terminus by overlapping PCR. Next, the resulting ORF encoding fusion protein EGFP-IE1 were cloned into the pIZ-V5-His vector that prepared the plasmid pIZ-V5-EGFP-IE1. For luciferase reporter plasmid constructions, the putative promoters upstream from translation start site of wsv051 and ie1 (447 bp in wsv051 and 146 bp in ie1) were amplified by PCR and inserted into pGL3-Basic vector (Promega) to produce plasmids pGL3-wsv051 and pGL3-ie1. Similarly, the wsv051 and ie1 promoters containing mutated STAT-binding motifs were amplified and cloned into pGL3-Basic vector to gain plasmids pGL3-wsv051MUT and pGL3-ie1-MUT. The primers used in these constructions were listed in Table 1. 2.3. Cell culture and transient transfection High Five cells were maintained at 27 C in Express Five SFM medium (Life Technology). Sf9 cells were grown in Sf-900 III SFM medium (Life Technology) supplied with 5% fetal bovine serum (Gibco) at 27 C. For transient transfection, cells were seeded overnight, and then were transfected with the required plasmids by using the Cellfectin reagent (Life Technology) according to the manufacturer's instructions. 2.4. Western blot The whole cell lysates prepared with western and IP cell lysis buffer (Beyotime) were supplemented with 2 SDS-PAGE sample buffer (100 mM Tris, 4% SDS, 20% glycerol, 2% b-mercaptoethanol, 0.2% bromophenol blue, pH 6.8) and boiled for 10 min. The protein samples were electrophoresed in 8%e10% SDSePAGE gels and blotted onto PVDF membranes (GE Healthcare). The membranes were blocked for 1 h at room temperature in 5% skim milk dissolved in TBST buffer (20 mM Tris, 150 mM NaCl, 0.1% Tween 20, pH 7.6), and subsequently incubated with primary antibodies (1:1000) overnight at 4 C. The membranes were then washed for three times with TBST buffer, followed by incubation for 1 h at room temperature with HRP-linked secondary antibodies (1:3000).
Table 1 Primers used for plasmid constructions. Primer name
Sequence (50 e30 )a,b,c
For pIZ-V5-LvSTAT plasmid V5-STAT-F CGGGATCCACCATGGACATGTCGTTGTGGAACAGA V5-STAT-R CCGCTCGAGCGCTGAGGCTTCATGAAGTTGGTCTGAAG For pIZ-FLAG-LvSTAT plasmid FLAG-STAT-F CGGGATCCATGGACTACAAGGACGACGATGACAAGATGTCGTTGTGGAACAGAGCACAG FLAG-STAT-R CCGCTCGAGTCACTGAGGCTTCATGAAGTTGGTCTGAAG For pIZ-V5-EGFP-IE1 plasmid EGFP-F CGGGGTACCATGGTGAGCAAGGGCGAGGAG EGFP-R CTTGTACAGCTCGTCCATGCCGAGAG IE1-F CTCTCGGCATGGACGAGCTGTACAAGATGGCCTTTAATTTTGAAG IE1-R CCGCTCGAGCGTACAAAGAATCCAGAAATCTCATC For pGL3-ie1 and pGL3-ie1-MUT plasmids pGL3-ie1- F CGGGTACCCCTTGTTACTCATTTATTCCTAGAAATGG pGL3-ie1- MUT-F CGGGTACCCCTTGTTACTCATTTAGGCCTAGCCATGG pGL3-ie1-R CCGCTCGAGCTTGAGTGGAGAGAGAGAGC For pGL3-wsv051 and pGL3-wsv051-MUT plasmids pGL3-wsv051-F CGGGTACCCAGTTCCAGGAAGAATGC pGL3-wsv051-MUT-F CGGGTACCCAGGGCCAGGCCGAATGC pGL3-wsv051-R CCGCTCGAGTTTCTCCCAACTTTG a b c
269
Nucleotides in bold were the restriction sites introduced for cloning. Nucleotides encoding FLAG tag were underlined. Nucleotides in italics and bold indicated the mutated STAT binding motif.
270
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
Immunoreactive bands were detected with enhanced chemiluminescence substrates (Thermo Scientific) and visualized by Xray film (Kodak) according to the manufacturer's instructions. 2.5. Co-IP assay Co-IP assay was performed as described previously with minor modifications [24]. Briefly, High Five cells, seeded on 6-well plate (8 105 cells/well), were transiently transfected with the indicated expression plasmids. At 48 h post transfection, the cells were washed in ice-cold PBS and lysed with 200 ml western and IP cell lysis buffer (Beyotime) at 4 C for 20 min. After centrifugation for 30 min at 13,000 rpm, the clear cell lysates were immunoprecipitated with anti-V5 antibody (2 mg) for 4 h and then incubated with protein A agarose beads (GE Healthcare) overnight at 4 C with gentle rotation. The immunoprecipitates were washed extensively and eluted from beads by boiling with 2 SDS-PAGE sample buffer. The protein preparations were analyzed by western blot as described above with the indicated antibodies. 2.6. GST pull-down assay The full length ORF of IE1 was acquired by PCR amplification and ligated into pGX-4T-2 vector to construct the plasmid pGX-4T-2IE1. Primers used for this PCR were listed in Table 1. The plasmids pGX-4T-2-IE1 and pGX-4T-2 were transformed into Escherichia coli BL21 bacteria for the expression of GST-IE1 and GST proteins. The transformed bacteria were cultured in Luria-Bertani medium (100 ml) in the presence of 100 mg/ml ampicillin at 37 C. When the cultures density reached an OD600 of 0.8, the bacteria cultures were supplemented with 0.5 mM IPTG (isopropyl-b-D-thiogalactopyranoside) and then maintained overnight at 16 C to induce the protein expression. The induced bacteria were harvested by centrifugation and the pelleted bacteria were resuspended with 5 ml PBS containing 1% TrionX-100 and 1 mM PMSF. After sonication and centrifugation, the clear supernatant (200 ml) containing soluble GST-IE1 and GST proteins were incubated with glutathione sepharose beads (GE Healcare) for 1 h at 4 C, followed by five washes with PBS to remove the unconjugated proteins. In the GST Pull-down assay, the lystates from High Five cells transiently transfected with pIZ-V5-LvSTAT plasmid were prepared by sonication in PBS containing 1% TrionX-100 and 1 mM PMSF. Subsequently, the clear supernatant was incubated with the glutathione sepharose beads bound with the above GST-IE1 or GST protein overnight at 4 C with gentle shaking. The beads were washed five times with PBS and the proteins were then eluted by boiling with 2 SDS-PAGE sample buffer. The yielded protein samples were checked by SDS-PAGE with coomassie staining and western blot with the anti-V5-HRP antiboby, respectively. 2.7. Phosphorylation analysis of LvSTAT
of wsv051 and ie1 promoters were designed and listed in Table 2. The synthesized oligonucleotides were labeled with biotin and annealed to double-stranded probes according to the protocols described in biotin end-labeling kit (Beyotime Biotechnology). Cell lysates were prepared from High Five cells transfected with pIZ-V5LvSTAT plasmid using cell lysis buffer (50 mM Tris, pH 7.8; 150 mM NaCl and 1% Nonidet P-40) by addition with protease inhibitors (Calbiochem). In the EMSA, biotin-labeled DNA probes were incubated with cell extracts containing LvSTAT at room temperature in the presence of binding buffer from EMSA/gel-shift kit (Beyotime Biotechnology). For competition experiment, cell extracts were preincubated with the wild or mutant cold probes (unlabeled) for 10 min before addition of the biotin-labeled probes. After the binding reactions, DNA-protein complexes were resolved by electrophoresis in 4% native acrylamide gel and transferred to a nylon membrane (GE Healthcare). The membrane was immediately cross-linked with UV-light and detected with LightShift Chemiluminescent EMSA Kit from Thermo Scientific. 2.9. Shrimp and WSSV challenge Healthy L. vannamei (average 10 g) were purchased from a supermarket in Xiamen, China, and reared in tanks filled with airpumped sea water at 25 C. WSSV stock was prepared from viral infected crayfish and quantified as previous protocol [25]. For viral challenge, each shrimp was intramuscularly injected with 100 ml virions inoculum (approximately 1 106 virions). 2.10. Chromatin immunoprecipitation assay (ChIP) ChIP assays were performed according to the instructions of EZChIP kit (Millipore). At 48 h after WSSV infection, the gill tissues of L. vannamei were first fixed with 1% formaldehyde and quenched with 10 Glycine buffer. Then the gills were sequentially lysed with ChIP cell lysis buffer and SDS lysis buffer to extract cell nuclear proteins. Next, the nuclear extracts were sonicated twelve times for 10 s each at the 30% setting, and the samples were pelleted by centrifugation for 10 min at 13000 g. The supernatants were incubated with anti-LvSTAT antibody or normal mouse IgG (control) and then precipitated with protein G magnetic beads at 4 C overnight. The cross-links of the protein-DNA complex were reversed by incubation at 62 C for 2 h, followed by heating at 95 C for 10 min. The resulting DNA was purified with cycle-pure kit (Qiagen) and used for semi-quantitative PCR analysis. Primers listed in Table 2 were designed to amplify the promoters of wsv051 and ie1 covering the STAT-binding motifs.
Table 2 Primers used for EMSA probes and ChIP PCR analysis. Primer name
The phosphorylation level of LvSTAT was measured by using phos-tag SDS-PAGE gel (Wako) according to the producer's instructions. Protein samples prepared with RIPA lysis buffer (Beyotime) were resolved by 8% Phos-tag SDS-PAGE gel. After the electrophoresis, the gel was washed two times for 10 min in transfer buffer (39 mM glycine, 48 mM Tris) containing 10 mM EDTA and one more round in transfer buffer without EDTA. Next, the gel was blotted onto PVDF membrane for western blot analysis by using anti-V5-HRP antibody (1:5000) as described above. 2.8. Electrophoretic mobility shift assay (EMSA) The oligonucleotides covering the putative STAT binding motifs
For EMSA assays Probe-ie1-WT-F Probe-ie1-WT-R Probe-ie1-MUT-F Probe-ie1-MUT-R Probe-wsv051-WT-F Probe-wsv051-WT-R Probe-wsv051-MUT-F Probe-wsv051-MUT-R For ChIP assays ChIP-ie1-F ChIP-ie1-F ChIP-wsv051-F ChIP-wsv051-R a
Sequence (50 e30 )a CTCATTTATTCCTAGAAATGGTGTA TACACCATTTCTAGGAATAAATGAG CTCATTTAGGCCTAGCCATGGTGTA TACACCATGGCTAGGCCTAAATGAG CCCACCAGTTCCAGGAAGAATGCGG CCGCATTCTTCCTGGAACTGGTGGG CCCACCAGGGCCAGGCCGAATGCGG CCGCATTCGGCCTGGCCCTGGTGGG TCTTGAGGGGTATCAACCACACAG CTTGAGTGGAGAGAGAGAGCTAGT GGACTTTATTGGCATCTGGAGAGG TTCTTCTTCGCAGTCGTCGTCTTC
Nucleotides in bold and underline indicated the mutated STAT binding motif.
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
2.11. Luciferase reporter assay Sf9 cells were plated at a density of 2 105 cells per well of a 24well plate. The firefly luciferase reporter plasmids driven by the wsv051 and ie1 promoters and the internal control plasmid pRL-TK (Promega) expressing Renilla luciferase together with the indicated effector expression plasmids were co-transfected into the cells. After transfection for 48 h, cells were harvested and lysed according to luciferase reporter assay system kit (Promega). The activities of firefly and Renilla luciferase were measured by using Luminometers (Promega). Each transfection was conducted at least three times. 3. Results 3.1. WSSV IE1 interacted with LvSTAT In this study, we performed coimmunoprecipitation (co-IP) and GST pull-down assays to examine the interaction between WSSV
271
IE1 and LvSTAT. For co-IP assay, High Five cells were transiently cotransfected with pIZ-FLAG-LvSTAT and pIZ-V5-EGFP-IE1 plasmids. Negative control was included, in which an EGFP expression plasmid without V5 tag (pIZ-EGFP) was transiently co-transfected with pIZ-FLAG-LvSTAT plasmid. At 48 h post transfection, cells were lysed and subjected to immunoprecipitation with an anti-V5 antibody. The immunoprecipitates were then used in western blot analysis with anti-FLAG antibody. The result showed that LvSTAT was immunoprecipitated and detectable when co-expressed with IE1, but no signals were observed in the negative control (Fig. 1A). In the GST pull-down experiment, lysates from High Five cells transiently transfected with pIZ-V5-LvSTAT plasmid were prepared and incubated with GST or GST-IE1 proteins bound to glutathione sepharose beads. The eluted protein samples were analyzing by western blot using anti-V5-HRP antibody. As shown in Fig. 1B, GSTIE1 protein but not GST protein could be immunoprecipitated with LvSTAT. Therefore, both the co-IP and GST pull-down results proved that WSSV IE1 interacted physically with LvSTAT.
Fig. 1. Interaction between WSSV IE1 and LvSTAT. (A) co-IP analysis of IE1 and LvSTAT interaction. High Five cells were transiently co-transfected with the FLAG-tagged LvSTAT and V5-tagged IE1 expression plasmids. In the negative control, the LvSTAT expression plasmid was transiently co-transfected with an EGFP expression plasmid. At 48 h after transfection, cells were lysed and subjected to immunoprecipitation (IP) with anti-V5 antibody, followed by western blot (WB) analysis with anti-FLAG antibody. The whole cell lysates (Input) were used to confirm the successful expression of LvSTAT and IE1 in cells. (B) GST pull-down analysis of IE1 and LvSTAT interaction. GST and GST-IE1 proteins were expressed and purified by bounding to glutathione sepharose beads (left panel). The LvSTAT expression construct pIZ-V5-LvSTAT was transiently transfected into High Five cells. After transfection for 48 h, cell lysates were prepared and incubated with glutathione sepharose beads coupled with GST or GST-IE1 proteins. The immunoprecipitates eluted from the beads were analyzing by western blot using anti-V5-HRP antibody (right panel).
272
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
3.2. IE1 upregulated the phosphorylation level of LvSTAT In mammals, STATs are activated by tyrosine phosphorylation prior to execute their biological roles in gene transcriptional activation. To analyze whether IE1 could regulate the phosphorylation of LvSTAT, plasmid encoding LvSTAT was transfected into High Five cells along with IE1 expression construct. Due to the lack of the phosphotyrosine antibody specific for LvSTAT, the total phosphorylation status of LvSTAT was analyzed by using phos-tag SDS-PAGE gel which could separate the phosphorylated and unphosphorylated proteins. Whole cell lysates of the transfected cells were resolved in conventional and phos-tag SDS-PAGE gels, respectively. After the electrophoresis, the gels were transferred onto PVDF membranes for western blot analysis. In contrast to the signal bands acquired in conventional gel (Fig. 2A), a shift band above the total LvSTAT was observed in phos-tag SDS-PAGE gel (Fig. 2B), suggesting that LvSTAT could be phosphorylated in High Five cells. Moreover, IE1 could significantly stimulate the phosphorylation of LvSTAT (Fig. 2B). 3.3. LvSTAT bound to the STAT binding motifs in wsv051 and ie1 promoters It was previously validated that shrimp STAT could bind to and activate the promoter of WSSV IE gene ie1 through the STATbinding motif (50 -TTCCTAGAAA-30 ) [8]. In this study, we found that another IE gene wsv051 also contained a putative STAT-binding motif (50 -TTCCAGGAA-30 ) in its promoter (Fig. 3A). To determine whether LvSTAT could also bind to the STAT-binding motif of wsv051 promoter, the biotin-labeled probes containing the predicted STAT binding motifs of wsv051 and ie1 (as positive control) promoters were prepared and used for EMSA. The results showed that shift bands of protein-DNA complex were detected when cell lysates containing recombinant LvSTAT were incubated with biotin-labeled DNA probes (Fig. 3B, lane 1 and 6). In addition, the shift bands could be competitively reduced by the unlabeled wild
cold probes at a 10 , 50 or 100 molar excess (Fig. 3B, lane 2, 3, 4, 7, 8 and 9), but not affected by the unlabeled mutant cold probes at a 100 molar excess (Fig. 3B, lane 5 and 10). The EMSA results demonstrated that recombinant LvSTAT could bind to the STATbinding motifs of wsv051 and ie1 promoters. Next, we further explored whether endogenous LvSTAT could bind to the promoters of wsv051 and ie1. The gill tissues derived from WSSV infected shrimp were subjected to ChIP assays with anti-LvSTAT antibody. The immunoprecipitated DNA products were purified and detected by semi-quantitative PCR. The Fig. 3C showed that the wsv051 and ie1 promoters could be visibly detected in the anti-LvSTAT antibody immunoprecipitates, whereas the control immunoprecipitation with normal IgG antibody gave a little amplification signal. In conclusion, our data clearly suggested that LvSTAT could bind to the wsv051 and ie1 promoters in vitro and vivo. 3.4. LvSTAT transactivated the wsv051 and ie1 promoters To further investigate the effect of LvSTAT on the activities of wsv051 and ie1 promoters, the promoters of wsv051 and ie1 containing the wild type and mutated STAT-binding motifs were cloned into pGL3-Basic luciferase reporter vector (Fig. 4A and B), and the luciferase acitivities of wsv051 and ie1 promoters were measured after co-expression with LvSTAT in Sf9 cells. As shown in Fig. 4C and D, over-expression of LvSTAT dramatically enhanced the activities of wsv051 and ie1 promoters, whereas it displayed no induction of the STAT-binding motif mutated promoters. In addition, we transfected different amounts of LvSTAT expression plasmid in the transactivity assays, and the results showed that the induction effect of wsv051 and ie1 promoters was dose-dependent of LvSTAT expression (Fig. 4E and F). 3.5. IE1 enhanced the transcriptional activation activity of LvSTAT The present data demonstrated that IE1 could interact with and
Fig. 2. Effects of IE1 on LvSTAT phosphorylation. (A) Analysis of LvSTAT expression by conventional SDS-PAGE gel. High Five cells were co-transfected with V5-tagged LvSTAT in combination with EGFP-IE1. At 48 h post transfection, cell lysates prepared by RIPA lysis buffer were separated by conventional SDS-PAGE gel and transferred onto PVDF membranes for western blot. Equal protein loading was established with anti-tubulin antibody. (B) Analysis of LvSTAT phosphorylation by phos-tag SDS-PAGE gel. Cell lysates were resolved by phos-tag SDS-PAGE gel and blotted onto PVDF membrane for western blot analysis.
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
273
Fig. 3. Binding of LvSTAT to wsv051 and ie1 promoters. (A) Illustration of EMSA probes of ie1 and wsv051 promoters. (B) EMSA analysis of the binding of LvSTAT to putative STAT binding motifs in wsv051 and ie1 promoters. The biotin-labeled DNA probes containing the STAT binding motifs of wsv051 and ie1 promoters were synthesized and incubated with the LvSTAT protein extracts prepared from the transfected High Five cells (lane 1 and 6). Unlabled wild cold probes with various concentrations (lane 2, 3, 4, 7, 8 and 9) and mutant cold probes (lane 5 and 10) were adding for competition assays. (C) ChIP assays using anti-LvSTAT antibody in shrimp. At 48 h after WSSV infection, the collected gill tissues were fixed with formaldehyde followed by cell lysis and sonication. Next, the resulting supernatants were used for immunoprecipitation with anti-LvSTAT antibody. The finally precipitated DNA products were purified and subjected to PCR analysis.
induce the phosphorylation of LvSTAT. In this analysis, we further assessed the effect of IE1-LvSTAT interaction on the activities of wsv051 and ie1 promoters. Results determined by luciferase reporter assays found that LvSTAT co-expressed with IE1 showed a stronger stimulatory effect on the activities of wsv051 and ie1 promoters compared to the sole over-expression of LvSTAT (Fig. 5A and B). In addition, our results showed that over-expression of IE1 failed to activate the transcription of wsv051 and ie1 promoters (Fig. 5A and B). These results exactly indicated that IE1 could promote the transcriptional activation activity of LvSTAT and participated in the transcription of viral genes wsv051 and ie1 via LvSTAT. 4. Discussion STATs play a vital role in numerous cellular processes including cell growth, differentiation, apoptosis and immune responses [26]. During viral infection, STATs usually participate in host defenses that restrict viral replication in both vertebrates and invertebrates [27e29]. However, viruses are adept at manipulating the host cellular signals to their advantage. Increasing evidences showed that viral proteins such as Tip and STP-A encoded by Herpesvirus saimiri (HVS) [30e32] and Epstein-Barr nuclear antigen 2 (EBNA2) [33] of Epstein-Barr virus (EBV) could modulate the host STATs activity by direct interaction, resulting in the enhancement of viral replication or oncogenicity. It has previously been shown that WSSV can also activate shrimp STAT and exploit it to promote the transcription of viral gene ie1 [8]. But, to date, the potential molecular mechanism used by WSSV to regulate the shrimp STAT activity was largely unknown. In this study, we firstly identified that WSSV IE1, critical for viral
pathogenesis, could interact with LvSTAT by co-IP and GST pulldown experiments. In mammals, it has been widely documented that viral proteins could interact with the host STATs and regulate the STATs activity at various steps including phosphorylation, dimmerization, nuclear localization and DNA binding. For example, KSHV ORF50 induced the nuclear translocalization and dimmerization of STAT3 without affecting its tyrosine phosphorylation [5], while HVS STP-A could enhance the tyrosine phosphorylation of STAT3 and thereby led to the nuclear localization of STAT3 [32,34]. In the case of EBV infection, EBNA2 exerted no significant effect on the phosphorylation and nuclear accumulation of STAT3 but augmented its DNA binding activity [33]. In shrimp, it was previously demonstrated that WSSV infection could stimulate the tyrosine phosphorylation of shrimp STAT in vivo [7,8]. Our result determined by phos-tag gel analysis further demonstrated that over-expression of IE1 was able to markedly increase the phosphorylation level of LvSTAT in vitro. This result suggested that WSSV could also modulate the shrimp STAT activity by encoding STAT-interactive protein as other viruses [4e6,30e33]. It is well established that shrimp STAT is a pivotal transcriptional regulator in the process of WSSV infection. Previous data showed that WSSV IE gene ie1 contained a STAT binding motif in its promoter, which could be recognized and activated by shrimp STAT [8]. In this paper, the promoters of available WSSV IE genes were analyzed, and the results found that besides ie1, the IE gene wsv051 also included a putative STAT-binding motif in its promoter. Further experiments by EMSA and ChIP confirmed that recombinant and endogenous LvSTAT could bind to the wsv051 and ie1 promoters. Meanwhile, LvSTAT could transactivate the wsv051 and ie1 promoters through their STAT-binding motifs. Moreover, this LvSTAT-
274
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
Fig. 4. Transactivation of wsv051 and ie1 promoters by LvSTAT. (A) Schematic representation of ie1 promoter luciferase reporter plasmid. (B) Schematic representation of wsv051 promoter luciferase reporter plasmid. (C) Effect of the over-expression of LvSTAT on the ie1 promoter activity. (D) Effect of the over-expression of LvSTAT on the wsv051 promoter activity. The Sf9 cells were co-transfected with the effector plasmids (pIZ-V5-LvSTAT or pIZ-V5-His), the reporter plasmids (pGL3-ie1 and pGL3-ie1-MUT or pGL3-wsv051 and pGL3wsv051-MUT) and the internal plasmid pRL-TK. (E) Dose-dependent transactivation of the WSSV ie1 promoter by LvSTAT. (F) Dose-dependent transactivation of the WSSV wsv051 promoter by LvSTAT. The Sf9 cells were co-transfected with various amounts of effector plasmids (pIZ-V5-LvSTAT or pIZ-V5-His), the reporter plasmids (pGL3-ie1 or pGL3-wsv051) together with the internal plasmid pRL-TK. At 48 h post transfection, cells were lysed and applied to the luciferase activity measurement with the dual luciferase kit. The relative luciferase activity was obtained by dividing firefly luciferase activity with the internal Renilla luciferase activity. The bars indicated the means and standard deviations from three independent experiments. The asterisks determined by Student's t-test indicated the significant differences (**p < 0.01) compared with pIZ-V5-His group.
Fig. 5. Role of IE1 in the LvSTAT-induced activation of ie1 and wsv051 promoters. (A) Effect of co-expression of IE1 and LvSTAT on the activity of ie1 promoter. (B) Effect of coexpression of IE1 and LvSTAT on the activity of wsv051 promoter. The Sf9 cells were transiently transfected with effector plasmids pIZ-V5-His (control), pIZ-V5-EGFP-IE1, pIZV5-LvSTAT, or pIZ-V5-LvSTAT and pIZ-V5-EGFP-IE1, respectively. The reporter plasmids (pGL3-ie1 or pGL3-wsv051) and the internal plasmid pRL-TK were also transfected into the cells. At 48 h post transfection, cells were harvested and lysed for luciferase activity assays. The means and standard deviations from three independent experiments were indicated as bars. The asterisks determined by Student's t-test indicated the significant differences (* indicates p < 0.05 and ** indicates p < 0.01).
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
induced activation of the wsv051 and ie1 promoters was remarkably augmented by IE1 expression. The results indicated that WSSV IE1 could annex LvSTAT to regulate the transcription of the viral genes. In conclusion, our data presented here suggested a model whereby IE1 encoded by WSSV could interact with and activate the LvSTAT. After that, the activated LvSTAT could promote the transcription of the viral IE genes wsv051 and ie1. Our findings would help us to better understand the biological roles of LvSTAT and IE1 in the pathogenesis of WSSV. Acknowledgements This work was funded by the Projects under Major State Basic Research Development Program of China (973 Program) (No. 2012CB114403), the China Agriculture Research System-47, the National Natural Science Foundation of China (Nos. 31001125, 31302209 and 31472297), the Scientific Research Foundation of Third Institute of Oceanography, SOA (No. 2014020) and Fujian Science and Technology Project (2015J05068). References [1] J.E. Darnell, STATs and gene regulation, Science 277 (5332) (1997) 1630e1635. [2] C.M. Horvath, STAT proteins and transcriptional responses to extracellular signals, Trends Biochem. Sci. 25 (10) (2000) 496e502. [3] S.V. Kuchipudi, The complex role of STAT3 in viral infections, J. Immunol. Res. 2015 (2015) 272359. [4] T. Yoshida, T. Hanada, T. Tokuhisa, K.-i. Kosai, M. Sata, M. Kohara, A. Yoshimura, Activation of STAT3 by the hepatitis C virus core protein leads to cellular transformation, J. Exp. Med. 196 (5) (2002) 641e653. [5] Y. Gwack, S. Hwang, C. Lim, Y.S. Won, C.H. Lee, J. Choe, Kaposi's sarcomaassociated herpesvirus open reading frame 50 stimulates the transcriptional activity of STAT3, J. Biol. Chem. 277 (8) (2002) 6438e6442. [6] R. Muromoto, K. Okabe, M. Fujimuro, K. Sugiyama, H. Yokosawa, T. Seya, T. Matsuda, Physical and functional interactions between STAT3 and Kaposi's sarcoma-associated herpesvirus-encoded LANA, FEBS Lett. 580 (1) (2006) 93e98. [7] W. Chen, K. Ho, J. Leu, K. Liu, H. Wang, G. Kou, C. Lo, WSSV infection activates STAT in shrimp, Dev. Comp. Immunol. 32 (10) (2008) 1142e1150. [8] W.J. Liu, Y.S. Chang, A.H. Wang, G.H. Kou, C.F. Lo, White spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1, J. virology 81 (3) (2007) 1461e1471. [9] R. Wen, F. Li, S. Li, J. Xiang, Function of shrimp STAT during WSSV infection, Fish shellfish Immunol. 38 (2) (2014) 354e360. [10] F. Yang, J. He, X. Lin, Q. Li, D. Pan, X. Zhang, X. Xu, Complete genome sequence of the shrimp white spot bacilliform virus, J. virology 75 (23) (2001) 11811e11820. [11] A. Sanchez-Paz, White spot syndrome virus: an overview on an emergent concern, Veterinary Res. 41 (6) (2010) 43. [12] C. Escobedobonilla, M. Wille, P. Sorgeloos, M. Pensaert, H. Nauwynck, A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus, J. fish Dis. 31 (1) (2008) 1e18. [13] H. Marks, O. Vorst, A. Van Houwelingen, M. Van Hulten, J. Vlak, Geneexpression profiling of White spot syndrome virus in vivo, J. general virology 86 (7) (2005) 2081e2100.
275
[14] V. Lacoste, C. de la Fuente, F. Kashanchi, A. Pumfery, Kaposi's sarcomaassociated herpesvirus immediate early gene activity, Front. Biosci. a J. virtual Libr. 9 (2004) 2245e2272. [15] T. Murata, Regulation of Epstein-Barr virus reactivation from latency, Microbiol. Immunol. 58 (6) (2014) 307e317. [16] M. Smith, C. Boutell, D. Davido, HSV-1 ICP0: Paving the Way for Viral Replication, 2011. [17] W.J. Liu, Y.S. Chang, C.H. Wang, G.H. Kou, C.F. Lo, Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp, Virology 334 (2) (2005) 327e341. [18] F. Li, M. Li, W. Ke, Y. Ji, X. Bian, X. Yan, Identification of the immediate-early genes of white spot syndrome virus, Virology 385 (1) (2009) 267e274. [19] F. Lin, H. Huang, L. Xu, F. Li, F. Yang, Identification of three immediate-early genes of white spot syndrome virus, Archives virology 156 (9) (2011) 1611e1614. [20] W.J. Liu, Y.S. Chang, H.C. Wang, J.H. Leu, G.H. Kou, C.F. Lo, Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate-early protein IE1, J. virology 82 (22) (2008) 11362e11373. [21] W.J. Liu, Y.S. Chang, W.T. Huang, I.T. Chen, K.C. Wang, G.H. Kou, C.F. Lo, Penaeus monodon TATA box-binding protein interacts with the white spot syndrome virus transactivator IE1 and promotes its transcriptional activity, J. virology 85 (13) (2011) 6535e6547. [22] J.Y. Huang, W.J. Liu, H.C. Wang, D.Y. Lee, J.H. Leu, M.H. Tsai, S.T. Kang, I.T. Chen, G.H. Kou, G.D. Chang, C.F. Lo, Penaeus monodon thioredoxin restores the DNA binding activity of oxidized white spot syndrome virus IE1, Antioxidants redox Signal. 17 (6) (2012) 914e926. [23] X. Ran, X. Bian, Y. Ji, X. Yan, F. Yang, F. Li, White spot syndrome virus IE1 and WSV056 modulate the G1/S transition by binding to the host retinoblastoma protein, J. virology 87 (23) (2013) 12576e12582. [24] D. Yao, L. Ruan, X. Xu, H. Shi, Identification of a c-Jun homolog from Litopenaeus vannamei as a downstream substrate of JNK in response to WSSV infection, Dev. Comp. Immunol. 49 (2) (2015) 282e289. [25] X. Xie, H. Li, L. Xu, F. Yang, A simple and efficient method for purification of intact white spot syndrome virus (WSSV) viral particles, Virus Res. 108 (1) (2005) 63e67. [26] D.E. Levy, J.E. Darnell Jr., Stats: transcriptional control and biological impact, Nature reviews, Mol. Cell Biol. 3 (9) (2002) 651e662. [27] George R. Stark, James E. Darnell, The JAK-STAT pathway at twenty, Immunity 36 (4) (2012) 503e514. [28] C. Dostert, E. Jouanguy, P. Irving, L. Troxler, D. Galiana-Arnoux, C. Hetru, J.A. Hoffmann, J.L. Imler, The Jak-STAT signaling pathway is required but not sufficient for the antiviral response of drosophila, Nat. Immunol. 6 (9) (2005) 946e953. [29] J.A. Souza-Neto, S. Sim, G. Dimopoulos, An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense, Proc. Natl. Acad. Sci. 106 (42) (2009) 17841e17846. [30] D.A. Hartley, G.M. Cooper, Direct binding and activation of STAT transcription factors by the herpesvirus saimiri protein tip, J. Biol. Chem. 275 (22) (2000) 16925e16932. [31] Y. Kim, E.K. Kwon, J.H. Jeon, I. So, I.G. Kim, M.S. Choi, I.S. Kim, J.K. Choi, J.U. Jung, N.H. Cho, Activation of the STAT6 transcription factor in Jurkat Tcells by the herpesvirus saimiri Tip protein, J. general virology 93 (Pt 2) (2012) 330e340. [32] Y.H. Chung, N.H. Cho, M.I. Garcia, S.H. Lee, P. Feng, J.U. Jung, Activation of Stat3 transcription factor by Herpesvirus saimiri STP-A oncoprotein, J. virology 78 (12) (2004) 6489e6497. [33] R. Muromoto, O. Ikeda, K. Okabe, S. Togi, S. Kamitani, M. Fujimuro, S. Harada, K. Oritani, T. Matsuda, EpsteineBarr virus-derived EBNA2 regulates STAT3 activation, Biochem. biophysical Res. Commun. 378 (3) (2009) 439e443. [34] J. Park, T. Seo, J. Jung, J. Choe, Herpesvirus saimiri STP A11 protein interacts with STAT3 and stimulates its transcriptional activity, Biochem. biophysical Res. Commun. 320 (1) (2004) 279e285.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Shrimp STAT was hijacked by white spot syndrome virus immediate-early protein IE1 involved in modulation of viral genes Defu Yao a, b, 1, Lingwei Ruan b, *, 1, Huasong Lu b, Hong Shi b, Xun Xu b a
School of Life Science, Xiamen University, Xiamen 361005, People's Republic of China State Key Laboratory Breeding Base of Marine Genetic Resources, Key Laboratory of Marine Genetic Resources of State Oceanic Administration, Third Institute of Oceanography, State Oceanic Administration, Key Laboratory of Marine Genetic Resources of Fujian Province, South China Sea Bio-Resource Exploitation and Utilization Collaborative Innovation Center, Xiamen 361005, People's Republic of China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 July 2016 Received in revised form 18 October 2016 Accepted 30 October 2016 Available online 1 November 2016
STATs are a family of transcription factors that regulate a cascade of cellular processes including cell growth, differentiation, apoptosis and immune responses. However, they are usually targeted by viruses to assist infection. In this study, we identified that white spot syndrome virus (WSSV) immediate-early protein IE1 interacted with Litopenaeus vannamei STAT (LvSTAT) and thereby led to its phosphorylation activation. In addition, we demonstrated that LvSTAT could bind to the promoters of the viral immediateearly genes wsv051 and ie1 through STAT-binding motifs in vitro and vivo, allowing the enhancement of their promoters' activities. Moreover, IE1 could promote the transcriptional activation activity of LvSTAT to augment the transcription of wsv051 and ie1. In conclusion, our findings revealed a novel linkage between WSSV IE1 and shrimp STAT, which was a clue to well understand how WSSV adopted the active strategies to modulate the shrimp signaling pathway. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Shrimp WSSV STAT IE1 Interaction Transcription regulation
1. Introduction Signal transducers and activators of transcription (STATs) are a family of latent cytoplasmic transcription factors that comprise seven members in mammals, named STAT1, STAT2, STAT3, STAT4, STAT5 (STAT5A and STAT5B) and STAT6 [1,2]. Upon activation by tyrosine phosphorylation, STATs can dimerize and translocate into the nucleus where they bind to their cognate DNA response elements and trigger gene transcription. In mammals, STATs are usually the common target of viruses [3]. Several viruses are known to regulate the host STATs activity to enhance replication or oncogenic potential of the viruses. For instance, Hepatitis C virus (HCV) core protein was found to directly interact with and activate the host STAT3, which led to cell growth transformation [4]. Similarly, Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded immediate-early (IE) protein ORF50 and latency-associated nuclear antigen (LANA) could also enhance the transcriptional activation
* Corresponding author. Third Institute of Oceanography, No. 178 Daxue Road, Xiamen, Fujian 361005, People's Republic of China. E-mail address: [email protected] (L. Ruan). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2016.10.051 1050-4648/© 2016 Elsevier Ltd. All rights reserved.
activity of STAT3 by direct binding [5,6]. Previous studies have shown that white spot syndrome virus (WSSV) can induce shrimp STAT activation to facilitate the transcription of the viral gene ie1, suggesting that the activated STAT was conducive to WSSV infection [7,8]. A recent study further confirmed that WSSV replication was inhibited after disrupting STAT activity by gene silencing or addition with specific inhibitor of STAT [9]. Therefore, these results suggested that shrimp STAT was also targeted and exploited by WSSV. However, very little is known regarding the detailed molecular mechanism by which WSSV regulates the STAT activity in shrimp. WSSV is a large circular double-stranded DNA (dsDNA) virus with a genome of approximately 300 kb [10,11]. It is currently the most destructive pathogen and severely threatens the worldwide shrimp farming industries [12]. Like most dsDNA viruses, the WSSV genes can be roughly divided into three categories during the viral replication cycle: IE genes, early genes and late genes [13]. In general, IE genes are often widely investigated because of their critical regulatory roles in the pathogenesis of viral infection [14e16]. Up to date, twenty-one IE genes have been identified from WSSV [17e19]. Among them, IE1, also designated as WSV069, was the focus of studies and its biological functions were frequently reported in recent years. It has been found that IE1 can act as a
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
transcription factor with transactivation, dimerization and DNA binding activities [20]. In addition, IE1 was demonstrated to associate with and hijack shrimp TATA box-binding protein (TBP) and thioredoxin (Trx) to improve its transcriptional activation activity [21,22]. Recently, IE1 has been also shown to bind competitively to shrimp retinoblastoma protein (Rb), which led to releasing the E2F transcription factor from Rb-E2F complex to stimulate the G1/S transition of the cells [23]. To sum up, these data indicated that IE1 was multifaceted in functions with the abilities to regulate the transcription of targets genes, or serve as an adaptor protein involved in recruiting and manipulating host proteins to enhance viral infection. In the present study, we further found that WSSV IE1 could physically interact with Litopenaeus vannamei STAT (LvSTAT), and then induced the phosphorylation activation of LvSTAT. In this way, the activated LvSTAT facilitated the transcription of the viral IE genes wsv051 and ie1 through their STAT binding motifs in the promoters. Hence our results indicated that IE1 could be engaged in the transcription of viral genes by influencing LvSTAT activity. 2. Materials and methods 2.1. Antibodies Rabbit antibody against V5 tag (anti-V5) was purchased from Millipore and used for co-IP assays. Anti-V5 antibody linked with horseradish peroxidase (anti-V5-HRP) from Life Technology was used in the western blot. Mouse antibody anti-EGFP was acquired from Millipore. Mouse antibodies anti-FLAG M2 and anti-tubulin were bought from Sigma. The mouse antibody against LvSTAT was prepared in our lab by immunization with purified recombinant protein. HRP-conjuncted goat anti-mouse and anti-rabbit secondary antibodies were obtained from Thermo Scientific. 2.2. Plasmids construction The empty vector pIZ-V5-His (Life Technology) was used to construct the plasmids for LvSTAT and IE1 expression in insect cells. For LvSTAT expression, the open reading frame (ORF) of LvSTAT were amplified by gene-specific primers and cloned into the pIZV5-His vector to generate the V5-tagged expression plasmid pIZ-
V5-LvSTAT. In co-IP assay, the FLAG-tagged plasmid pIZ-FLAGLvSTAT was also constructed by cloning the ORF of LvSTAT into pIZ-V5-His vector and fusing a FLAG tag to the N-terminus. For IE1 expression, the ORF of IE1 were fused with EGFP at the N-terminus by overlapping PCR. Next, the resulting ORF encoding fusion protein EGFP-IE1 were cloned into the pIZ-V5-His vector that prepared the plasmid pIZ-V5-EGFP-IE1. For luciferase reporter plasmid constructions, the putative promoters upstream from translation start site of wsv051 and ie1 (447 bp in wsv051 and 146 bp in ie1) were amplified by PCR and inserted into pGL3-Basic vector (Promega) to produce plasmids pGL3-wsv051 and pGL3-ie1. Similarly, the wsv051 and ie1 promoters containing mutated STAT-binding motifs were amplified and cloned into pGL3-Basic vector to gain plasmids pGL3-wsv051MUT and pGL3-ie1-MUT. The primers used in these constructions were listed in Table 1. 2.3. Cell culture and transient transfection High Five cells were maintained at 27 C in Express Five SFM medium (Life Technology). Sf9 cells were grown in Sf-900 III SFM medium (Life Technology) supplied with 5% fetal bovine serum (Gibco) at 27 C. For transient transfection, cells were seeded overnight, and then were transfected with the required plasmids by using the Cellfectin reagent (Life Technology) according to the manufacturer's instructions. 2.4. Western blot The whole cell lysates prepared with western and IP cell lysis buffer (Beyotime) were supplemented with 2 SDS-PAGE sample buffer (100 mM Tris, 4% SDS, 20% glycerol, 2% b-mercaptoethanol, 0.2% bromophenol blue, pH 6.8) and boiled for 10 min. The protein samples were electrophoresed in 8%e10% SDSePAGE gels and blotted onto PVDF membranes (GE Healthcare). The membranes were blocked for 1 h at room temperature in 5% skim milk dissolved in TBST buffer (20 mM Tris, 150 mM NaCl, 0.1% Tween 20, pH 7.6), and subsequently incubated with primary antibodies (1:1000) overnight at 4 C. The membranes were then washed for three times with TBST buffer, followed by incubation for 1 h at room temperature with HRP-linked secondary antibodies (1:3000).
Table 1 Primers used for plasmid constructions. Primer name
Sequence (50 e30 )a,b,c
For pIZ-V5-LvSTAT plasmid V5-STAT-F CGGGATCCACCATGGACATGTCGTTGTGGAACAGA V5-STAT-R CCGCTCGAGCGCTGAGGCTTCATGAAGTTGGTCTGAAG For pIZ-FLAG-LvSTAT plasmid FLAG-STAT-F CGGGATCCATGGACTACAAGGACGACGATGACAAGATGTCGTTGTGGAACAGAGCACAG FLAG-STAT-R CCGCTCGAGTCACTGAGGCTTCATGAAGTTGGTCTGAAG For pIZ-V5-EGFP-IE1 plasmid EGFP-F CGGGGTACCATGGTGAGCAAGGGCGAGGAG EGFP-R CTTGTACAGCTCGTCCATGCCGAGAG IE1-F CTCTCGGCATGGACGAGCTGTACAAGATGGCCTTTAATTTTGAAG IE1-R CCGCTCGAGCGTACAAAGAATCCAGAAATCTCATC For pGL3-ie1 and pGL3-ie1-MUT plasmids pGL3-ie1- F CGGGTACCCCTTGTTACTCATTTATTCCTAGAAATGG pGL3-ie1- MUT-F CGGGTACCCCTTGTTACTCATTTAGGCCTAGCCATGG pGL3-ie1-R CCGCTCGAGCTTGAGTGGAGAGAGAGAGC For pGL3-wsv051 and pGL3-wsv051-MUT plasmids pGL3-wsv051-F CGGGTACCCAGTTCCAGGAAGAATGC pGL3-wsv051-MUT-F CGGGTACCCAGGGCCAGGCCGAATGC pGL3-wsv051-R CCGCTCGAGTTTCTCCCAACTTTG a b c
269
Nucleotides in bold were the restriction sites introduced for cloning. Nucleotides encoding FLAG tag were underlined. Nucleotides in italics and bold indicated the mutated STAT binding motif.
270
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
Immunoreactive bands were detected with enhanced chemiluminescence substrates (Thermo Scientific) and visualized by Xray film (Kodak) according to the manufacturer's instructions. 2.5. Co-IP assay Co-IP assay was performed as described previously with minor modifications [24]. Briefly, High Five cells, seeded on 6-well plate (8 105 cells/well), were transiently transfected with the indicated expression plasmids. At 48 h post transfection, the cells were washed in ice-cold PBS and lysed with 200 ml western and IP cell lysis buffer (Beyotime) at 4 C for 20 min. After centrifugation for 30 min at 13,000 rpm, the clear cell lysates were immunoprecipitated with anti-V5 antibody (2 mg) for 4 h and then incubated with protein A agarose beads (GE Healthcare) overnight at 4 C with gentle rotation. The immunoprecipitates were washed extensively and eluted from beads by boiling with 2 SDS-PAGE sample buffer. The protein preparations were analyzed by western blot as described above with the indicated antibodies. 2.6. GST pull-down assay The full length ORF of IE1 was acquired by PCR amplification and ligated into pGX-4T-2 vector to construct the plasmid pGX-4T-2IE1. Primers used for this PCR were listed in Table 1. The plasmids pGX-4T-2-IE1 and pGX-4T-2 were transformed into Escherichia coli BL21 bacteria for the expression of GST-IE1 and GST proteins. The transformed bacteria were cultured in Luria-Bertani medium (100 ml) in the presence of 100 mg/ml ampicillin at 37 C. When the cultures density reached an OD600 of 0.8, the bacteria cultures were supplemented with 0.5 mM IPTG (isopropyl-b-D-thiogalactopyranoside) and then maintained overnight at 16 C to induce the protein expression. The induced bacteria were harvested by centrifugation and the pelleted bacteria were resuspended with 5 ml PBS containing 1% TrionX-100 and 1 mM PMSF. After sonication and centrifugation, the clear supernatant (200 ml) containing soluble GST-IE1 and GST proteins were incubated with glutathione sepharose beads (GE Healcare) for 1 h at 4 C, followed by five washes with PBS to remove the unconjugated proteins. In the GST Pull-down assay, the lystates from High Five cells transiently transfected with pIZ-V5-LvSTAT plasmid were prepared by sonication in PBS containing 1% TrionX-100 and 1 mM PMSF. Subsequently, the clear supernatant was incubated with the glutathione sepharose beads bound with the above GST-IE1 or GST protein overnight at 4 C with gentle shaking. The beads were washed five times with PBS and the proteins were then eluted by boiling with 2 SDS-PAGE sample buffer. The yielded protein samples were checked by SDS-PAGE with coomassie staining and western blot with the anti-V5-HRP antiboby, respectively. 2.7. Phosphorylation analysis of LvSTAT
of wsv051 and ie1 promoters were designed and listed in Table 2. The synthesized oligonucleotides were labeled with biotin and annealed to double-stranded probes according to the protocols described in biotin end-labeling kit (Beyotime Biotechnology). Cell lysates were prepared from High Five cells transfected with pIZ-V5LvSTAT plasmid using cell lysis buffer (50 mM Tris, pH 7.8; 150 mM NaCl and 1% Nonidet P-40) by addition with protease inhibitors (Calbiochem). In the EMSA, biotin-labeled DNA probes were incubated with cell extracts containing LvSTAT at room temperature in the presence of binding buffer from EMSA/gel-shift kit (Beyotime Biotechnology). For competition experiment, cell extracts were preincubated with the wild or mutant cold probes (unlabeled) for 10 min before addition of the biotin-labeled probes. After the binding reactions, DNA-protein complexes were resolved by electrophoresis in 4% native acrylamide gel and transferred to a nylon membrane (GE Healthcare). The membrane was immediately cross-linked with UV-light and detected with LightShift Chemiluminescent EMSA Kit from Thermo Scientific. 2.9. Shrimp and WSSV challenge Healthy L. vannamei (average 10 g) were purchased from a supermarket in Xiamen, China, and reared in tanks filled with airpumped sea water at 25 C. WSSV stock was prepared from viral infected crayfish and quantified as previous protocol [25]. For viral challenge, each shrimp was intramuscularly injected with 100 ml virions inoculum (approximately 1 106 virions). 2.10. Chromatin immunoprecipitation assay (ChIP) ChIP assays were performed according to the instructions of EZChIP kit (Millipore). At 48 h after WSSV infection, the gill tissues of L. vannamei were first fixed with 1% formaldehyde and quenched with 10 Glycine buffer. Then the gills were sequentially lysed with ChIP cell lysis buffer and SDS lysis buffer to extract cell nuclear proteins. Next, the nuclear extracts were sonicated twelve times for 10 s each at the 30% setting, and the samples were pelleted by centrifugation for 10 min at 13000 g. The supernatants were incubated with anti-LvSTAT antibody or normal mouse IgG (control) and then precipitated with protein G magnetic beads at 4 C overnight. The cross-links of the protein-DNA complex were reversed by incubation at 62 C for 2 h, followed by heating at 95 C for 10 min. The resulting DNA was purified with cycle-pure kit (Qiagen) and used for semi-quantitative PCR analysis. Primers listed in Table 2 were designed to amplify the promoters of wsv051 and ie1 covering the STAT-binding motifs.
Table 2 Primers used for EMSA probes and ChIP PCR analysis. Primer name
The phosphorylation level of LvSTAT was measured by using phos-tag SDS-PAGE gel (Wako) according to the producer's instructions. Protein samples prepared with RIPA lysis buffer (Beyotime) were resolved by 8% Phos-tag SDS-PAGE gel. After the electrophoresis, the gel was washed two times for 10 min in transfer buffer (39 mM glycine, 48 mM Tris) containing 10 mM EDTA and one more round in transfer buffer without EDTA. Next, the gel was blotted onto PVDF membrane for western blot analysis by using anti-V5-HRP antibody (1:5000) as described above. 2.8. Electrophoretic mobility shift assay (EMSA) The oligonucleotides covering the putative STAT binding motifs
For EMSA assays Probe-ie1-WT-F Probe-ie1-WT-R Probe-ie1-MUT-F Probe-ie1-MUT-R Probe-wsv051-WT-F Probe-wsv051-WT-R Probe-wsv051-MUT-F Probe-wsv051-MUT-R For ChIP assays ChIP-ie1-F ChIP-ie1-F ChIP-wsv051-F ChIP-wsv051-R a
Sequence (50 e30 )a CTCATTTATTCCTAGAAATGGTGTA TACACCATTTCTAGGAATAAATGAG CTCATTTAGGCCTAGCCATGGTGTA TACACCATGGCTAGGCCTAAATGAG CCCACCAGTTCCAGGAAGAATGCGG CCGCATTCTTCCTGGAACTGGTGGG CCCACCAGGGCCAGGCCGAATGCGG CCGCATTCGGCCTGGCCCTGGTGGG TCTTGAGGGGTATCAACCACACAG CTTGAGTGGAGAGAGAGAGCTAGT GGACTTTATTGGCATCTGGAGAGG TTCTTCTTCGCAGTCGTCGTCTTC
Nucleotides in bold and underline indicated the mutated STAT binding motif.
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
2.11. Luciferase reporter assay Sf9 cells were plated at a density of 2 105 cells per well of a 24well plate. The firefly luciferase reporter plasmids driven by the wsv051 and ie1 promoters and the internal control plasmid pRL-TK (Promega) expressing Renilla luciferase together with the indicated effector expression plasmids were co-transfected into the cells. After transfection for 48 h, cells were harvested and lysed according to luciferase reporter assay system kit (Promega). The activities of firefly and Renilla luciferase were measured by using Luminometers (Promega). Each transfection was conducted at least three times. 3. Results 3.1. WSSV IE1 interacted with LvSTAT In this study, we performed coimmunoprecipitation (co-IP) and GST pull-down assays to examine the interaction between WSSV
271
IE1 and LvSTAT. For co-IP assay, High Five cells were transiently cotransfected with pIZ-FLAG-LvSTAT and pIZ-V5-EGFP-IE1 plasmids. Negative control was included, in which an EGFP expression plasmid without V5 tag (pIZ-EGFP) was transiently co-transfected with pIZ-FLAG-LvSTAT plasmid. At 48 h post transfection, cells were lysed and subjected to immunoprecipitation with an anti-V5 antibody. The immunoprecipitates were then used in western blot analysis with anti-FLAG antibody. The result showed that LvSTAT was immunoprecipitated and detectable when co-expressed with IE1, but no signals were observed in the negative control (Fig. 1A). In the GST pull-down experiment, lysates from High Five cells transiently transfected with pIZ-V5-LvSTAT plasmid were prepared and incubated with GST or GST-IE1 proteins bound to glutathione sepharose beads. The eluted protein samples were analyzing by western blot using anti-V5-HRP antibody. As shown in Fig. 1B, GSTIE1 protein but not GST protein could be immunoprecipitated with LvSTAT. Therefore, both the co-IP and GST pull-down results proved that WSSV IE1 interacted physically with LvSTAT.
Fig. 1. Interaction between WSSV IE1 and LvSTAT. (A) co-IP analysis of IE1 and LvSTAT interaction. High Five cells were transiently co-transfected with the FLAG-tagged LvSTAT and V5-tagged IE1 expression plasmids. In the negative control, the LvSTAT expression plasmid was transiently co-transfected with an EGFP expression plasmid. At 48 h after transfection, cells were lysed and subjected to immunoprecipitation (IP) with anti-V5 antibody, followed by western blot (WB) analysis with anti-FLAG antibody. The whole cell lysates (Input) were used to confirm the successful expression of LvSTAT and IE1 in cells. (B) GST pull-down analysis of IE1 and LvSTAT interaction. GST and GST-IE1 proteins were expressed and purified by bounding to glutathione sepharose beads (left panel). The LvSTAT expression construct pIZ-V5-LvSTAT was transiently transfected into High Five cells. After transfection for 48 h, cell lysates were prepared and incubated with glutathione sepharose beads coupled with GST or GST-IE1 proteins. The immunoprecipitates eluted from the beads were analyzing by western blot using anti-V5-HRP antibody (right panel).
272
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
3.2. IE1 upregulated the phosphorylation level of LvSTAT In mammals, STATs are activated by tyrosine phosphorylation prior to execute their biological roles in gene transcriptional activation. To analyze whether IE1 could regulate the phosphorylation of LvSTAT, plasmid encoding LvSTAT was transfected into High Five cells along with IE1 expression construct. Due to the lack of the phosphotyrosine antibody specific for LvSTAT, the total phosphorylation status of LvSTAT was analyzed by using phos-tag SDS-PAGE gel which could separate the phosphorylated and unphosphorylated proteins. Whole cell lysates of the transfected cells were resolved in conventional and phos-tag SDS-PAGE gels, respectively. After the electrophoresis, the gels were transferred onto PVDF membranes for western blot analysis. In contrast to the signal bands acquired in conventional gel (Fig. 2A), a shift band above the total LvSTAT was observed in phos-tag SDS-PAGE gel (Fig. 2B), suggesting that LvSTAT could be phosphorylated in High Five cells. Moreover, IE1 could significantly stimulate the phosphorylation of LvSTAT (Fig. 2B). 3.3. LvSTAT bound to the STAT binding motifs in wsv051 and ie1 promoters It was previously validated that shrimp STAT could bind to and activate the promoter of WSSV IE gene ie1 through the STATbinding motif (50 -TTCCTAGAAA-30 ) [8]. In this study, we found that another IE gene wsv051 also contained a putative STAT-binding motif (50 -TTCCAGGAA-30 ) in its promoter (Fig. 3A). To determine whether LvSTAT could also bind to the STAT-binding motif of wsv051 promoter, the biotin-labeled probes containing the predicted STAT binding motifs of wsv051 and ie1 (as positive control) promoters were prepared and used for EMSA. The results showed that shift bands of protein-DNA complex were detected when cell lysates containing recombinant LvSTAT were incubated with biotin-labeled DNA probes (Fig. 3B, lane 1 and 6). In addition, the shift bands could be competitively reduced by the unlabeled wild
cold probes at a 10 , 50 or 100 molar excess (Fig. 3B, lane 2, 3, 4, 7, 8 and 9), but not affected by the unlabeled mutant cold probes at a 100 molar excess (Fig. 3B, lane 5 and 10). The EMSA results demonstrated that recombinant LvSTAT could bind to the STATbinding motifs of wsv051 and ie1 promoters. Next, we further explored whether endogenous LvSTAT could bind to the promoters of wsv051 and ie1. The gill tissues derived from WSSV infected shrimp were subjected to ChIP assays with anti-LvSTAT antibody. The immunoprecipitated DNA products were purified and detected by semi-quantitative PCR. The Fig. 3C showed that the wsv051 and ie1 promoters could be visibly detected in the anti-LvSTAT antibody immunoprecipitates, whereas the control immunoprecipitation with normal IgG antibody gave a little amplification signal. In conclusion, our data clearly suggested that LvSTAT could bind to the wsv051 and ie1 promoters in vitro and vivo. 3.4. LvSTAT transactivated the wsv051 and ie1 promoters To further investigate the effect of LvSTAT on the activities of wsv051 and ie1 promoters, the promoters of wsv051 and ie1 containing the wild type and mutated STAT-binding motifs were cloned into pGL3-Basic luciferase reporter vector (Fig. 4A and B), and the luciferase acitivities of wsv051 and ie1 promoters were measured after co-expression with LvSTAT in Sf9 cells. As shown in Fig. 4C and D, over-expression of LvSTAT dramatically enhanced the activities of wsv051 and ie1 promoters, whereas it displayed no induction of the STAT-binding motif mutated promoters. In addition, we transfected different amounts of LvSTAT expression plasmid in the transactivity assays, and the results showed that the induction effect of wsv051 and ie1 promoters was dose-dependent of LvSTAT expression (Fig. 4E and F). 3.5. IE1 enhanced the transcriptional activation activity of LvSTAT The present data demonstrated that IE1 could interact with and
Fig. 2. Effects of IE1 on LvSTAT phosphorylation. (A) Analysis of LvSTAT expression by conventional SDS-PAGE gel. High Five cells were co-transfected with V5-tagged LvSTAT in combination with EGFP-IE1. At 48 h post transfection, cell lysates prepared by RIPA lysis buffer were separated by conventional SDS-PAGE gel and transferred onto PVDF membranes for western blot. Equal protein loading was established with anti-tubulin antibody. (B) Analysis of LvSTAT phosphorylation by phos-tag SDS-PAGE gel. Cell lysates were resolved by phos-tag SDS-PAGE gel and blotted onto PVDF membrane for western blot analysis.
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
273
Fig. 3. Binding of LvSTAT to wsv051 and ie1 promoters. (A) Illustration of EMSA probes of ie1 and wsv051 promoters. (B) EMSA analysis of the binding of LvSTAT to putative STAT binding motifs in wsv051 and ie1 promoters. The biotin-labeled DNA probes containing the STAT binding motifs of wsv051 and ie1 promoters were synthesized and incubated with the LvSTAT protein extracts prepared from the transfected High Five cells (lane 1 and 6). Unlabled wild cold probes with various concentrations (lane 2, 3, 4, 7, 8 and 9) and mutant cold probes (lane 5 and 10) were adding for competition assays. (C) ChIP assays using anti-LvSTAT antibody in shrimp. At 48 h after WSSV infection, the collected gill tissues were fixed with formaldehyde followed by cell lysis and sonication. Next, the resulting supernatants were used for immunoprecipitation with anti-LvSTAT antibody. The finally precipitated DNA products were purified and subjected to PCR analysis.
induce the phosphorylation of LvSTAT. In this analysis, we further assessed the effect of IE1-LvSTAT interaction on the activities of wsv051 and ie1 promoters. Results determined by luciferase reporter assays found that LvSTAT co-expressed with IE1 showed a stronger stimulatory effect on the activities of wsv051 and ie1 promoters compared to the sole over-expression of LvSTAT (Fig. 5A and B). In addition, our results showed that over-expression of IE1 failed to activate the transcription of wsv051 and ie1 promoters (Fig. 5A and B). These results exactly indicated that IE1 could promote the transcriptional activation activity of LvSTAT and participated in the transcription of viral genes wsv051 and ie1 via LvSTAT. 4. Discussion STATs play a vital role in numerous cellular processes including cell growth, differentiation, apoptosis and immune responses [26]. During viral infection, STATs usually participate in host defenses that restrict viral replication in both vertebrates and invertebrates [27e29]. However, viruses are adept at manipulating the host cellular signals to their advantage. Increasing evidences showed that viral proteins such as Tip and STP-A encoded by Herpesvirus saimiri (HVS) [30e32] and Epstein-Barr nuclear antigen 2 (EBNA2) [33] of Epstein-Barr virus (EBV) could modulate the host STATs activity by direct interaction, resulting in the enhancement of viral replication or oncogenicity. It has previously been shown that WSSV can also activate shrimp STAT and exploit it to promote the transcription of viral gene ie1 [8]. But, to date, the potential molecular mechanism used by WSSV to regulate the shrimp STAT activity was largely unknown. In this study, we firstly identified that WSSV IE1, critical for viral
pathogenesis, could interact with LvSTAT by co-IP and GST pulldown experiments. In mammals, it has been widely documented that viral proteins could interact with the host STATs and regulate the STATs activity at various steps including phosphorylation, dimmerization, nuclear localization and DNA binding. For example, KSHV ORF50 induced the nuclear translocalization and dimmerization of STAT3 without affecting its tyrosine phosphorylation [5], while HVS STP-A could enhance the tyrosine phosphorylation of STAT3 and thereby led to the nuclear localization of STAT3 [32,34]. In the case of EBV infection, EBNA2 exerted no significant effect on the phosphorylation and nuclear accumulation of STAT3 but augmented its DNA binding activity [33]. In shrimp, it was previously demonstrated that WSSV infection could stimulate the tyrosine phosphorylation of shrimp STAT in vivo [7,8]. Our result determined by phos-tag gel analysis further demonstrated that over-expression of IE1 was able to markedly increase the phosphorylation level of LvSTAT in vitro. This result suggested that WSSV could also modulate the shrimp STAT activity by encoding STAT-interactive protein as other viruses [4e6,30e33]. It is well established that shrimp STAT is a pivotal transcriptional regulator in the process of WSSV infection. Previous data showed that WSSV IE gene ie1 contained a STAT binding motif in its promoter, which could be recognized and activated by shrimp STAT [8]. In this paper, the promoters of available WSSV IE genes were analyzed, and the results found that besides ie1, the IE gene wsv051 also included a putative STAT-binding motif in its promoter. Further experiments by EMSA and ChIP confirmed that recombinant and endogenous LvSTAT could bind to the wsv051 and ie1 promoters. Meanwhile, LvSTAT could transactivate the wsv051 and ie1 promoters through their STAT-binding motifs. Moreover, this LvSTAT-
274
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
Fig. 4. Transactivation of wsv051 and ie1 promoters by LvSTAT. (A) Schematic representation of ie1 promoter luciferase reporter plasmid. (B) Schematic representation of wsv051 promoter luciferase reporter plasmid. (C) Effect of the over-expression of LvSTAT on the ie1 promoter activity. (D) Effect of the over-expression of LvSTAT on the wsv051 promoter activity. The Sf9 cells were co-transfected with the effector plasmids (pIZ-V5-LvSTAT or pIZ-V5-His), the reporter plasmids (pGL3-ie1 and pGL3-ie1-MUT or pGL3-wsv051 and pGL3wsv051-MUT) and the internal plasmid pRL-TK. (E) Dose-dependent transactivation of the WSSV ie1 promoter by LvSTAT. (F) Dose-dependent transactivation of the WSSV wsv051 promoter by LvSTAT. The Sf9 cells were co-transfected with various amounts of effector plasmids (pIZ-V5-LvSTAT or pIZ-V5-His), the reporter plasmids (pGL3-ie1 or pGL3-wsv051) together with the internal plasmid pRL-TK. At 48 h post transfection, cells were lysed and applied to the luciferase activity measurement with the dual luciferase kit. The relative luciferase activity was obtained by dividing firefly luciferase activity with the internal Renilla luciferase activity. The bars indicated the means and standard deviations from three independent experiments. The asterisks determined by Student's t-test indicated the significant differences (**p < 0.01) compared with pIZ-V5-His group.
Fig. 5. Role of IE1 in the LvSTAT-induced activation of ie1 and wsv051 promoters. (A) Effect of co-expression of IE1 and LvSTAT on the activity of ie1 promoter. (B) Effect of coexpression of IE1 and LvSTAT on the activity of wsv051 promoter. The Sf9 cells were transiently transfected with effector plasmids pIZ-V5-His (control), pIZ-V5-EGFP-IE1, pIZV5-LvSTAT, or pIZ-V5-LvSTAT and pIZ-V5-EGFP-IE1, respectively. The reporter plasmids (pGL3-ie1 or pGL3-wsv051) and the internal plasmid pRL-TK were also transfected into the cells. At 48 h post transfection, cells were harvested and lysed for luciferase activity assays. The means and standard deviations from three independent experiments were indicated as bars. The asterisks determined by Student's t-test indicated the significant differences (* indicates p < 0.05 and ** indicates p < 0.01).
D. Yao et al. / Fish & Shellfish Immunology 59 (2016) 268e275
induced activation of the wsv051 and ie1 promoters was remarkably augmented by IE1 expression. The results indicated that WSSV IE1 could annex LvSTAT to regulate the transcription of the viral genes. In conclusion, our data presented here suggested a model whereby IE1 encoded by WSSV could interact with and activate the LvSTAT. After that, the activated LvSTAT could promote the transcription of the viral IE genes wsv051 and ie1. Our findings would help us to better understand the biological roles of LvSTAT and IE1 in the pathogenesis of WSSV. Acknowledgements This work was funded by the Projects under Major State Basic Research Development Program of China (973 Program) (No. 2012CB114403), the China Agriculture Research System-47, the National Natural Science Foundation of China (Nos. 31001125, 31302209 and 31472297), the Scientific Research Foundation of Third Institute of Oceanography, SOA (No. 2014020) and Fujian Science and Technology Project (2015J05068). References [1] J.E. Darnell, STATs and gene regulation, Science 277 (5332) (1997) 1630e1635. [2] C.M. Horvath, STAT proteins and transcriptional responses to extracellular signals, Trends Biochem. Sci. 25 (10) (2000) 496e502. [3] S.V. Kuchipudi, The complex role of STAT3 in viral infections, J. Immunol. Res. 2015 (2015) 272359. [4] T. Yoshida, T. Hanada, T. Tokuhisa, K.-i. Kosai, M. Sata, M. Kohara, A. Yoshimura, Activation of STAT3 by the hepatitis C virus core protein leads to cellular transformation, J. Exp. Med. 196 (5) (2002) 641e653. [5] Y. Gwack, S. Hwang, C. Lim, Y.S. Won, C.H. Lee, J. Choe, Kaposi's sarcomaassociated herpesvirus open reading frame 50 stimulates the transcriptional activity of STAT3, J. Biol. Chem. 277 (8) (2002) 6438e6442. [6] R. Muromoto, K. Okabe, M. Fujimuro, K. Sugiyama, H. Yokosawa, T. Seya, T. Matsuda, Physical and functional interactions between STAT3 and Kaposi's sarcoma-associated herpesvirus-encoded LANA, FEBS Lett. 580 (1) (2006) 93e98. [7] W. Chen, K. Ho, J. Leu, K. Liu, H. Wang, G. Kou, C. Lo, WSSV infection activates STAT in shrimp, Dev. Comp. Immunol. 32 (10) (2008) 1142e1150. [8] W.J. Liu, Y.S. Chang, A.H. Wang, G.H. Kou, C.F. Lo, White spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1, J. virology 81 (3) (2007) 1461e1471. [9] R. Wen, F. Li, S. Li, J. Xiang, Function of shrimp STAT during WSSV infection, Fish shellfish Immunol. 38 (2) (2014) 354e360. [10] F. Yang, J. He, X. Lin, Q. Li, D. Pan, X. Zhang, X. Xu, Complete genome sequence of the shrimp white spot bacilliform virus, J. virology 75 (23) (2001) 11811e11820. [11] A. Sanchez-Paz, White spot syndrome virus: an overview on an emergent concern, Veterinary Res. 41 (6) (2010) 43. [12] C. Escobedobonilla, M. Wille, P. Sorgeloos, M. Pensaert, H. Nauwynck, A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus, J. fish Dis. 31 (1) (2008) 1e18. [13] H. Marks, O. Vorst, A. Van Houwelingen, M. Van Hulten, J. Vlak, Geneexpression profiling of White spot syndrome virus in vivo, J. general virology 86 (7) (2005) 2081e2100.
275
[14] V. Lacoste, C. de la Fuente, F. Kashanchi, A. Pumfery, Kaposi's sarcomaassociated herpesvirus immediate early gene activity, Front. Biosci. a J. virtual Libr. 9 (2004) 2245e2272. [15] T. Murata, Regulation of Epstein-Barr virus reactivation from latency, Microbiol. Immunol. 58 (6) (2014) 307e317. [16] M. Smith, C. Boutell, D. Davido, HSV-1 ICP0: Paving the Way for Viral Replication, 2011. [17] W.J. Liu, Y.S. Chang, C.H. Wang, G.H. Kou, C.F. Lo, Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp, Virology 334 (2) (2005) 327e341. [18] F. Li, M. Li, W. Ke, Y. Ji, X. Bian, X. Yan, Identification of the immediate-early genes of white spot syndrome virus, Virology 385 (1) (2009) 267e274. [19] F. Lin, H. Huang, L. Xu, F. Li, F. Yang, Identification of three immediate-early genes of white spot syndrome virus, Archives virology 156 (9) (2011) 1611e1614. [20] W.J. Liu, Y.S. Chang, H.C. Wang, J.H. Leu, G.H. Kou, C.F. Lo, Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate-early protein IE1, J. virology 82 (22) (2008) 11362e11373. [21] W.J. Liu, Y.S. Chang, W.T. Huang, I.T. Chen, K.C. Wang, G.H. Kou, C.F. Lo, Penaeus monodon TATA box-binding protein interacts with the white spot syndrome virus transactivator IE1 and promotes its transcriptional activity, J. virology 85 (13) (2011) 6535e6547. [22] J.Y. Huang, W.J. Liu, H.C. Wang, D.Y. Lee, J.H. Leu, M.H. Tsai, S.T. Kang, I.T. Chen, G.H. Kou, G.D. Chang, C.F. Lo, Penaeus monodon thioredoxin restores the DNA binding activity of oxidized white spot syndrome virus IE1, Antioxidants redox Signal. 17 (6) (2012) 914e926. [23] X. Ran, X. Bian, Y. Ji, X. Yan, F. Yang, F. Li, White spot syndrome virus IE1 and WSV056 modulate the G1/S transition by binding to the host retinoblastoma protein, J. virology 87 (23) (2013) 12576e12582. [24] D. Yao, L. Ruan, X. Xu, H. Shi, Identification of a c-Jun homolog from Litopenaeus vannamei as a downstream substrate of JNK in response to WSSV infection, Dev. Comp. Immunol. 49 (2) (2015) 282e289. [25] X. Xie, H. Li, L. Xu, F. Yang, A simple and efficient method for purification of intact white spot syndrome virus (WSSV) viral particles, Virus Res. 108 (1) (2005) 63e67. [26] D.E. Levy, J.E. Darnell Jr., Stats: transcriptional control and biological impact, Nature reviews, Mol. Cell Biol. 3 (9) (2002) 651e662. [27] George R. Stark, James E. Darnell, The JAK-STAT pathway at twenty, Immunity 36 (4) (2012) 503e514. [28] C. Dostert, E. Jouanguy, P. Irving, L. Troxler, D. Galiana-Arnoux, C. Hetru, J.A. Hoffmann, J.L. Imler, The Jak-STAT signaling pathway is required but not sufficient for the antiviral response of drosophila, Nat. Immunol. 6 (9) (2005) 946e953. [29] J.A. Souza-Neto, S. Sim, G. Dimopoulos, An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense, Proc. Natl. Acad. Sci. 106 (42) (2009) 17841e17846. [30] D.A. Hartley, G.M. Cooper, Direct binding and activation of STAT transcription factors by the herpesvirus saimiri protein tip, J. Biol. Chem. 275 (22) (2000) 16925e16932. [31] Y. Kim, E.K. Kwon, J.H. Jeon, I. So, I.G. Kim, M.S. Choi, I.S. Kim, J.K. Choi, J.U. Jung, N.H. Cho, Activation of the STAT6 transcription factor in Jurkat Tcells by the herpesvirus saimiri Tip protein, J. general virology 93 (Pt 2) (2012) 330e340. [32] Y.H. Chung, N.H. Cho, M.I. Garcia, S.H. Lee, P. Feng, J.U. Jung, Activation of Stat3 transcription factor by Herpesvirus saimiri STP-A oncoprotein, J. virology 78 (12) (2004) 6489e6497. [33] R. Muromoto, O. Ikeda, K. Okabe, S. Togi, S. Kamitani, M. Fujimuro, S. Harada, K. Oritani, T. Matsuda, EpsteineBarr virus-derived EBNA2 regulates STAT3 activation, Biochem. biophysical Res. Commun. 378 (3) (2009) 439e443. [34] J. Park, T. Seo, J. Jung, J. Choe, Herpesvirus saimiri STP A11 protein interacts with STAT3 and stimulates its transcriptional activity, Biochem. biophysical Res. Commun. 320 (1) (2004) 279e285.