- Email: [email protected]
SNPs in the myostatin gene of the mollusk Chlamys farreri: Association with growth traits
Comparative Biochemistry and Physiology, Part B 155 (2010) 327–330
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p b
SNPs in the myostatin gene of the mollusk Chlamys farreri: Association with growth traits Xiuli Wang a,⁎, Xiangying Meng a, Bin Song a, Xuemei Qiu a, Haiying Liu b a b
College of Life Sciences and Biotechnology, Dalian Fisheries University, Dalian 116023, China School of Marine Engineering, Dalian Fisheries University, Dalian 116023, China
a r t i c l e
i n f o
Article history: Received 24 July 2009 Received in revised form 14 December 2009 Accepted 15 December 2009 Available online 22 December 2009 Keywords: Chlamys farreri Growth traits Myostatin SNPs
a b s t r a c t Myostatin (MSTN) is a member of the transforming growth factor-β superfamily which negatively regulates growth of muscle tissue. In this study, 103 cultivated Chlamys farreri individuals were screened for polymorphisms in the MSTN gene using PCR-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing methods. Two mutations were found: A/G at position 327 in exon 2, which caused an amino acid change from Thr to Ala (Thr305Ala), and C/T at position 289 in exon 3, which caused an amino acid change from Cys to Arg (Cys422Arg). One way ANOVA of the SNPs and growth traits showed that genotype GG of primer M5 had significantly higher body mass, soft-tissue mass, adductor muscle mass, shell length, shell height, absolute growth rate of shell height and body mass than those of genotype AG and AA (P < 0.05). Genotype frequencies of genotype AA, AG and GG were 68.94%, 27.18% and 3.88%, respectively. The results present evidence that the C. farreri MSTN gene may be selected as a candidate gene for these growth traits. © 2009 Elsevier Inc. All rights reserved.
1. Introduction Myostatin (MSTN), also known as growth differentiation factor 8 (GDF-8), is a member of the transforming growth factor-β superfamily isolated from murine muscle tissue by McPherron et al. (1997), which negatively regulates growth of skeletal muscle tissue. As a candidate gene, MSTN can be selected on the basis of its participation in the process of muscle development in animal breeding (Bellinge et al., 2005). The MSTN gene mainly expresses itself in skeletal muscle (Hennebry et al., 2009) and cardiac muscle (Sharma et al., 1999). Several polymorphisms have been identified in the gene (Rescan et al., 2001; Rodgers and Weber, 2001) indicating that the MSTN gene is highly variable. Since the identification of the key role of MSTN in skeletal muscle growth and development, increasing numbers of polymorphisms in MSTN have been intensively investigated. In cattle, several breeds show polymorphisms in this gene. These polymorphisms are directly related to the double muscling phenotype (Wiener et al., 2002; Esmailizadeh et al., 2008; Grisolia et al., 2009; Phocas, 2009) one of which is an 11-base pair deletion in the third exon of the gene (Kambadur et al., 1997; Grobet et al., 1998). In sheep, QTL studies showed that MSTN had a major effect on muscular development in Belgian Texel (Marcq et al., 2002) and on muscling depth in New Zealand Romney sheep (Hickford et al., 2009), Norwegian White Sheep (Boman et al., 2009), Charollais sheep (Hadjipavlou et al., 2009)
⁎ Corresponding author. 52th, Heishijiao Street, Shahekou District, Dalian 116023, China. Tel.: +86 411 84763589; fax: +86 411 84786191. E-mail address: [email protected] (X. Wang). 1096-4959/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2009.12.001
and New Zealand Texel sheep (Johnson et al., 2009). Many studies show that the MSTN gene can affect muscle mass in other species, such as mice (McPherron et al., 1997; Whittemore et al., 2003; Tang et al., 2007; Matsakas et al., 2009; Welle et al., 2009), pigs (Yu et al., 2007; Patruno et al., 2008), dogs (Shelton and Engvall, 2007; Mosher et al., 2007) and in chicken (Kim et al., 2007; Ye et al., 2007). The gene encoding for the MSTN peptide is a consolidate candidate for the enhancement of productivity in terrestrial livestock. It potentially represents an important target for growth improvement of cultured finfish (De Santis et al., 2008). In scallop, Kim et al. (2004) cloned an MSTN-like gene (sMSTN) of a bay scallop (Argopecten irradians) and this gene was aligned against the translated Ciona intestinalis genome. Their results indicate that the MSTN gene has been conserved throughout evolution and could play a major role in muscle growth and development in invertebrates, as it does in mammals. Single nucleotide polymorphisms (SNPs) change in a single base pair of the DNA sequence is the most frequently occurring form of variation in the human genome. Many genes have a large number of SNPs which are mainly used in the studies of disease, even in very small samples (Constantine et al., 2008). By choosing “tag” SNPs, the SNPs can also be used to study association between them and the production traits of individuals. This is an increasingly common approach to genetic association studies. An assumption behind this approach is that the variant and its haplotype are relatively in the general population and will be ascertained in this way (Constantine et al., 2008). Chlamys farreri is one of the economic bivalve species farmed widely in the coastal provinces of northern China since 1983 (Xing et al., 2008). In recent years, the scale of cultivated C. farreri has been
328
X. Wang et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 327–330
expanding continuously in China, and much research has been done to study the technique of cultivating them. In our study, correlations analysis of the growth traits of C. farreri was performed using SNPs. The results of our study can offer some useful information to help select and cultivate C. farreri as a molecular marker-assisted breeding method.
2.3. Statistical analysis Absolute growth rate (AGR) of shell height (ASH) and body mass (ABM) of C. farreri was calculated according to the equation described by Gu et al. (2009): AGR = y = t
2. Materials and methods 2.1. Animals and traits Offspring (age 2 years) of a healthy mature male and female of C. farreri were cultured by the method of raft and long-line in a scallop farm in Dalian, China. A total of 103 C. farreri offspring, which came from the same raft, were randomly selected for use in this study. Their body mass, soft-tissue mass, adductor muscle mass, shell width, shell length and shell height were scored according to the methods of Liu et al. (2002). The adductor muscles of each individual were sampled and preserved in 95% ethanol.
2.2. DNA extraction, PCR amplification and sequence annotation The genomic DNA was extracted by the traditional phenol/ chloroform method and dissolved in sterile water with a concentration of 100 ng/ml and stored at − 20 °C. Seven pairs of primers were designed according to the C. farreri MSTN gene (GenBank accession no: DQ988329). Primers' information of the C. farreri MSTN gene was shown in Table 1. PCR amplification was performed in a reaction volume of 25 µl including 50 ng of genomic DNA, 25 pmol of each primer, 2.5 µl 10 × PCR buffer and 1.5 units Taq DNA polymerase. The condition for PCR was as follows: 5 min at 94 °C; 35 cycles of 30 s at 94 °C, 51 °C for 30 s, 30 s at 72 °C; and a final 7 min extension at 72 °C. One microliters of the PCR product was diluted with 5 µl of loading buffer (98% formamide, 10 mM EDTA pH8.0, 0.025% xylene cyanol FF, 0.025% bromophenol blue, 2% glycerol). After denaturing at 98 °C for 10 min, the mixture was immediately placed on ice for 10 min. Next it was loaded on a 15% acrylamide/bisacrylamide (acr:bis = 29:1) gel. After running at 10 v/cm for 14–16 h, the gel was stained using the silver staining method. Each homozygote PCR product was purified, recovered and sequenced. Finally similarity searches of the deduced amino acid sequence from cDNA sequence of C. farreri MSTN gene were done by Blastp.
where y was ASH or ABM, and t the age in days (t = 730 days). The body mass, soft-tissue mass, adductor muscle mass, shell width, shell length shell height, ASH and ABM of the C. farreri were scored and the data was analyzed by one way ANOVA analysis through software SPSS 14.0. Effects of SNPs on growth traits were analyzed through the above method and the SNPs markers, whose genotypes had significant correlation with the growth traits of the C. farreri, were studied through post hoc multiple comparison (Duncan method). A fixed model was adopted according to the factors that affect growth traits using the following equation: yij = μ + Gi + eij where yij is the observed value of jth individual of genotype i, µ is the mean of observed values, Gi is the effective value of the genotype i and eij is the random residual effect corresponding to the observed values. In this study, the effect of the surrounding environment was included in the random error. 3. Results 3.1. PCR results and analysis Three individuals' MSTN fragments having the same genotype through amplification by the same primer had been sequenced three times. The PCR products of primers M5 and M7 presented polymorphism (Fig. 1). Comparison of the sequences with the known C. farreri MSTN gene sequence (GenBank accession no: DQ988329) showed that there were two polymorphic sites. The first, A327G mutation in exon 2 caused an amino acid change from Thr to Ala (Thr305Ala). The second mutation, T289C in exon 3, caused an amino acid change from Cys to Arg (Cys422Arg). To identify the three genotypes generated by primer M5, the PCR fragments' sequence, which has the base ‘A’ at 327nt, was defined as allele A. While the sequence which has the base ‘G’ at 327nt was defined as allele G. For primer M7, the PCR fragments' sequence, which has the base ‘T’ at 289nt, was defined as allele T. While the sequence which has the base ‘C’ at 289nt was defined as allele C. Blastp
Table 1 Primer information of the Chlamys farreri MSTN gene. Locus
Primer sequence (5′ to 3′)a
M1
F: ATAGCTGTCAACGCGAAAGG R: ATTTCCATCACGTCCCAAAG F: CTTTGGGACGTGATGGAAAT R: AATCGTTTAGCCGTGGTGTT F: AACACCACGGCTAAACGATT R: CACTGTAATCACACAAGGACACG F: ACAGTCCCTGCTGATATGAC R: CCGATTTCTCGTTTGGTTGG F: CCAACCAAACGAGAAATCGG R: ACGTATCCGTCATTTACCCC F: ACACCATTGCTCACATTTCC R: GTCCAATTGTTCACCCTTGC F: TATTACTGCGCCGGTGAATG R: CACTTCACCTTCCCGTCTCT
M2 M3 M4 M5 M6 M7
Locationb
Length (bp)
21–256
236
237–468
232
449–768
320
5708–5914
206
5895–6094
200
7518–7820
303
7782–8063
282
a
F is forward primer and R is reverse primer. Location represents the position of the C. farreri myostatin gene sequence (GenBank accession no: DQ988329). b
Fig. 1. Band patterns for the two SNPs. (a) Genotypes of primer M5, and (b) genotypes of primer M7.
X. Wang et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 327–330
329
Table 2 One way ANOVA analysis of the SNP polymorphism of primer M5 of the Chlamys farreri MSTN gene and growth traits. Genotype
N
Genotypes frequencies (%)
Body mass (g)
Soft-tissue mass (g)
Adductor muscle mass (g)
Shell width (cm)
Shell length (cm)
Shell height (cm)
ASH (mm/d)
ABM (g/d)
AA AG GG
71 28 4
68.94 27.18 3.88
29.48 ± 2.281a 29.74 ± 4.994a 47.07 ± 8.161b
14.62 ± 3.192a 14.36 ± 2.894a 23.30 ± 2.709b
3.92 ± 1.017a 3.72 ± 0.902a 5.84 ± 0.682b
1.91 ± 0.198a 1.89 ± 0.138a 1.94 ± 0.394a
5.78 ± 0.454a 5.81 ± 0.403a 6.87 ± 0.446b
6.28 ± 0.443a 6.30 ± 0.368a 7.29 ± 0.269b
0.086 ± 0.006a 0.0863 ± 0.005a 0.0999 ± 0.004b
0.0404 ± 0.009a 0.0407 ± 0.007a 0.0645 ± 0.011b
Mean values ± standard deviation. N is numbers of C. farreri individuals. Means within the same column of each locus with different superscripts are significantly different (P < 0.05).
searches showed that there are two domains in the MSTN protein: transforming growth factor-beta propeptide (TGFb_propeptide) and transforming growth factor-beta (TGF-beta). The A327G mutation in exon 2 (Thr305Ala) is located at TGFb_propeptide domain and the T289C in exon 3 (Cys422Arg) mutation is located at TGF-beta domain. 3.2. One way ANOVA analysis of the association between different genotypes of the C. farreri MSTN gene and growth traits The association analysis of the seven loci within the C. farreri MSTN gene, with the growth traits, was carried out using one way ANOVA. Six loci (M1, M2, M3, M4, M6 and M7) did not show any significant effects on the examined traits in the C. farreri. M5 was significantly associated with body mass, soft-tissue mass, adductor muscle mass, shell length, shell height, ASH and ABM. Furthermore, multiple comparison analysis was performed in three genotypes of M5. Results showed that the C. farreri with genotype GG of M5 had significantly higher body mass, soft-tissue mass, adductor muscle mass, shell length, shell height, ASH and ABM than those of genotype AG and AA (Table 2). Frequencies of genotypes and alleles of M5 were also calculated (Table 2). The frequencies of genotype AA, AG and GG were 68.94%, 27.18% and 3.88%, respectively. The frequencies of allele A and G were 82.52 and 17.48, respectively. 4. Discussion Some research results showed that the lack of MSTN gene strongly affects muscle phenotype in humans and other animal species (JouliaEkaza and Cabello, 2007). In mice, the MSTN gene knockout causes a significant increase in muscle mass through muscle cell hypertrophy and hyperplasia (Grobet et al., 2003; Whittemore et al., 2003; Tang et al., 2007; Welle et al., 2007). Although Kim et al. (2004) cloned an MSTN-like gene and performed quantitative RT-PCR in different tissues of bay scallop (A. irradians), there are no published reports about the effect of the MSTN SNPs on the growth traits in scallop. In our study, we examined the presence of two MSTN SNPs in C. farreri. It is, to our knowledge, the first report of significant association of these polymorphisms with growth traits in commercial scallop. By the Blastp searches, the A327G mutation (Thr305Ala) and the T289C (Cys422Arg) mutation are located at two domains (TGF-beta domain and TGFb_propeptide domain, respectively). TGF-beta domain of MSTN protein is a multifunctional peptide that controls proliferation, differentiation, and other functions in many cell types (Padgett et al., 1997; Hoodless and Wrana, 1998). The TGFb_propeptide domain is known as latency associated peptide (LAP) in TGF-beta and is a homodimer which is disulfide linked to TGF-beta binding protein (Saharinen et al., 1996; Munger et al., 1997). We supposed that both of the mutations of the MSTN gene could influence the functional structure of MSTN protein so as to affect the growth performance. The results of the one way ANOVA analysis of relationship between the different genotypes and the growth traits showed that the
A327G mutation was significantly associated with the C. farreri growth traits, while the T289C mutation was not. Many studies showed that SNPs in the MSTN gene can affect muscle mass. Hadjipavlou et al. (2008) found that two SNPs in the MSTN gene have significant association with muscle depth of commercial Charollais sheep. Yu et al. (2007) identified two SNPs in the 5′ regulatory region of the MSTN gene which were associated with early growth traits in Yorkshire pigs. Esmailizadeh et al. (2009) found a SNP (F94L) in the MSTN gene affecting birth, growth, carcass, and beef quality traits of Bos taurus. Thus, different MSTN polymorphisms may contribute to differences in strength gains (Jespersen et al., 2006; Grobet et al., 1998; Hickford et al., 2009). In this study, we found two SNPs of MSTN gene in C. farreri. The results showed that the GG genotype can significantly facilitate muscle growth. In the present study, our objective is to detect the MSTN gene SNPs and its association with C. farreri growth traits. We did not detect the MSTN gene expression (RT-PCR) in adductor muscle of C. farreri with different genotypes. The expression will be studied in the future research. Correlation analysis between markers and traits reaching significant level may indicate the existence of relationship between the markers and certain traits. Thus, the selection breeding based on phenotype can go to genotype-assisted selection (Wang and Wu, 2006).The results in this study showed that the mutations in the coding region of the C. farreri MSTN gene were important reasons for the variance of growth traits. So the MSTN gene can act as a candidate gene for the C. farreri breeding. Acknowledgements This project was supported by the National Science and Technology Planning Project in the Eleventh Five-year (2006BAD09A15) and the grant of Dalian Fisheries University. References Bellinge, R.H., Liberles, D.A., Iaschi, S.P., O'brien, P.A., Tay, G.K., 2005. Myostatin and its implications on animal breeding: a review. Anim. Genet. 36, 1–6. Boman, I.A., Klemetsdal, G., Blichfeldt, T., Nafstad, O., Våge, D.I., 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White Sheep (Ovis aries). Anim. Genet. 40, 418–422. Constantine, C.C., Gurrin, L.C., McLaren, C.E., Bahlo, M., Anderson, G.J., Vulpe, C.D., Forrest, S.M., Allen, K.J., Gertig, D.M., Investigators, HealthIron, 2008. SNP selection for genes of iron metabolism in a study of genetic modifiers of hemochromatosis. BMC Med. Genet. doi:10.1186/1471-2350-9-18. De Santis, C., Evans, B.S., Smith-Keune, C., Jerry, D.R., 2008. Molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer) myostatin gene. BMC Genomics. doi:10.1186/1471-2164-9-82. Esmailizadeh, A.K., Bottema, C.D., Sellick, G.S., Verbyla, A.P., Morris, C.A., Cullen, N.G., Pitchford, W.S., 2008. Effects of the myostatin F94L substitution on beef traits. J. Anim. Sci. 86, 1038–1046. Grisolia, A.B., D'Angelo, G.T., Porto Neto, L.R., Siqueira, F., Garcia, J.F., 2009. Myostatin (GDF8) single nucleotide polymorphisms in Nellore cattle. Genet. Mol. Res. 8, 822–830. Grobet, L., Pirottin, D., Farnir, F., Poncelet, D., Royo, L.J., Brouwers, B., Christians, E., Desmecht, D., Coignoul, F., Kahn, R., Georges, M., 2003. Modulating skeletal muscle mass by postnatal, muscle-specific inactivation of the myostatin gene. Genesis 35, 227–238.
330
X. Wang et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 327–330
Grobet, L., Poncelet, D., Royo, L.J., Brouwers, B., Pirottin, D., Michaux, C., Ménissier, F., Zanotti, M., Dunner, S., Georges, M., 1998. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mamm. Genome 9, 210–213. Gu, Z.F., Wang, Q.Y., Fang, J.G., Ye, N.H., Mao, Y.Z., Shi, Y.H., Wang, Y., Wang, A.M., 2009. Growth of cultured pearl oyster (Pinctada martensii) in Li'an Lagoon, Hainan Island, China. J. Shellfish Res. 28, 465–470. Hadjipavlou, G., Matika, O., Clop, A., Bishop, S.C., 2008. Two single nucleotide polymorphisms in the myostatin (GDF8) gene have significant association with muscle depth of commercial Charollais sheep. Anim. Genet. 39, 346–353. Hennebry, A., Berry, C., Siriett, V., O'Callaghan, P., Chau, L., Watson, T., Sharma, M., Kambadur, R., 2009. Myostatin regulates fiber-type composition of skeletal muscle by regulating MEF2 and MyoD gene expression. Am. J. Physiol. Cell Physiol. 296, C525–534. Hickford, J.G., Forrest, R.H., Zhou, H., Fang, Q., Han, J., Frampton, C.M., Horrell, A.L., 2009. Polymorphisms in the ovine myostatin gene (MSTN) and their association with growth and carcass traits in New Zealand Romney sheep. Anim. Genet. doi:10.1111/ j.1365-2052.2009.01965.x. Hoodless, P.A., Wrana, J.L., 1998. Mechanism and function of signaling by the TGF beta superfamily. Curr. Top. Microbiol. Immunol. 228, 235–272. Jespersen, J., Kjaer, M., Schjerling, P., 2006. The possible role of myostatin in skeletal muscle atrophy and cachexia. Scand. J. Med. Sci. Sports 16, 74–82. Johnson, P.L., Dodds, K.G., Bain, W.E., Greer, G.J., McLean, N.J., McLaren, R.J., Galloway, S.M., van Stijn, T.C., McEwan, J.C., 2009. Investigations into the GDF8 g+ 6723G–A polymorphism in New Zealand Texel sheep. J. Anim. Sci. 87, 1856–1864. Joulia-Ekaza, D., Cabello, G., 2007. The myostatin gene: physiology and pharmacological relevance. Curr. Opin. Pharmacol. 7, 310–315. Kambadur, R., Sharma, M., Smith, T.P.L., Bass, J.J., 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7, 910–915. Kim, H.W., Mykles, D.L., Goetz, F.W., Roberts, S.B., 2004. Characterization of a myostatin-like gene from the bay scallop, Argopecten irradians. Biochim. Biophys. Acta 1679, 174–179. Kim, Y.S., Bobbili, N.K., Lee, Y.K., Jin, H.J., Dunn, M.A., 2007. Production of a polyclonal anti-myostatin antibody and the effects of in ovo administration of the antibody on posthatch broiler growth and muscle mass. Poult. Sci. 86, 1196–1205. Liu, X.L., Chang, Y.Q., Xiang, J.H., Song, J., Ding, J., 2002. Analysis of effects of shell size characters on live weight in Chinese scallop Chlamys farreri. Oceanol. Limnol. Sinica. 33, 673–678. Marcq, F., Larzul, C., Marot, V., Bouix, J., Eychenne, F., Laville, E., Bibe, B., Leroy, P.L., Georges, M., Elsen, J.M., 2002. Preliminary results of a whole-genome scan targeting QTL for carcass traits in a Texel Romanov intercross. Proceedings of the 7th World Congress on Applied Livestock Production. Montpellier, pp. 19–23. Matsakas, A., Foster, K., Otto, A., Macharia, R., Elashry, M.I., Feist, S., Graham, I., Foster, H., Yaworsky, P., Walsh, F., Dickson, G., Patel, K., 2009. Molecular, cellular and physiological investigation of myostatin propeptide-mediated muscle growth in adult mice. Neuromuscul. Disord. 19, 489–499. Mosher, D.S., Quignon, P., Bustamante, C.D., Sutter, N.B., Mellersh, C.S., Parker, H.G., Ostrander, E.A., 2007. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. doi:10.1371/ journal.pgen.0030079. McPherron, A.C., Lawler, A.M., Lee, S.J., 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83–90. Munger, J.S., Harpel, J.G., Gleizes, P.E., Mazzieri, R., Nunes, I., Rifkin, D.B., 1997. Latent transforming growth factor-beta: structural features and mechanisms of activation. Kidney Int. 51, 1376–1382.
Padgett, R.W., Savage, C., Das, P., 1997. Genetic and biochemical analysis of TGF beta signal transduction. Cytokine Growth Factor Rev. 8, 1–9. Patruno, M., Caliaro, F., Maccatrozzo, L., Sacchetto, R., Martinello, T., Toniolo, L., Reggiani, C., Mascarello, F., 2008. Myostatin shows a specific expression pattern in pig skeletal and extraocular muscles during pre- and post-natal growth. Differentiation 76, 168–181. Phocas, F., 2009. Genetic analysis of breeding traits in a Charolais cattle population segregating an inactive myostatin allele. J. Anim. Sci. 87, 1865–1871. Rescan, P.Y., Jutel, I., Rallière, C., 2001. Two myostatin genes are differentially expressed in myotomal muscles of the trout (Oncorhynchus mykiss). J. Exp. Biol. 204, 3523–3529. Rodgers, B.D., Weber, G.M., 2001. Sequence conservation among fish myostatin orthologues and the characterization of two additional cDNA clones from Morone saxatilis and Morone americana. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 129, 597–603. Saharinen, J., Taipale, J., Keski-Oja, J., 1996. Association of the small latent transforming growth factor-beta with an eight cysteine repeat of its binding protein LTBP-1. EMBO J. 15, 245–253. Sharma, M., Kambadur, R., Matthews, K.G., Somers, W.G., Devlin, G.P., Conaglen, J.V., Fowke, P.J., Bass, J.J., 1999. Myostatin, a transforming growth factor-beta superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. J. Cell Physiol. 180, 1–9. Shelton, G.D., Engvall, E., 2007. Gross muscle hypertrophy in whippet dogs is caused by a mutation in the myostatin gene. Neuromuscul. Disord. 17, 721–722. Tang, L., Yan, Z., Wan, Y., Han, W., Zhang, Y., 2007. Myostatin DNA vaccine increases skeletal muscle mass and endurance in mice. Muscle Nerve 36, 342–348. Wang, G.F., Wu, D.J., 2006. Correlation analysis of microsatellite DNA markers with wool traits in liangshan semi-fine wool sheep. Hereditas 28, 1505–1512. Welle, S., Bhatt, K., Pinkert, C.A., Tawil, R., Thornton, C.A., 2007. Muscle growth after postdevelopmental myostatin gene knockout. Am. J. Physiol. Endocrinol. Metab. 292, E985–E991. Whittemore, L.A., Song, K., Li, X., Aghajanian, J., Davies, M., Girgenrath, S., Hill, J.J., Jalenak, M., Kelley, P., Knight, A., Maylor, R., O'Hara, D., Pearson, A., Quazi, A., Ryerson, S., Tan, X.Y., Tomkinson, K.N., Veldman, G.M., Widom, A., Wright, J.F., Wudyka, S., Zhao, L., Wolfman, N.M., 2003. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem. Biophys. Res. Commun. 300, 965–971. Welle, S., Burgess, K., Thornton, C.A., Tawil, R., 2009. Relation between extent of myostatin depletion and muscle growth in mature mice. Am. J. Physiol. Endocrinol. Metab. 297, E935–E940. Wiener, P., Smith, J.A., Lewis, A.M., Woolliams, J.A., Williams, J.L., 2002. Muscle-related traits in cattle: the role of the myostatin gene in the South Devon breed. Genet Sel. Evol. 34, 221–232. Xing, J., Lin, T., Zhan, W., 2008. Variations of enzyme activities in the haemocytes of scallop Chlamys farreri after infection with the acute virus necrobiotic virus (AVNV). Fish Shellfish Immunol. 25, 847–852. Ye, X., Brown, S.R., Nones, K., Coutinho, L.L., Dekkers, J.C., Lamont, S.J., 2007. Associations of myostatin gene polymorphisms with performance and mortality traits in broiler chickens. Genet Sel. Evol. 39, 73–89. Yu, L., Tang, H., Wang, J., Wu, Y., Zou, L., Jiang, Y., Wu, C., Li, N., 2007. Polymorphisms in the 5' regulatory region of myostatin gene are associated with early growth traits in Yorkshire pigs. Sci. China C Life Sci. 50, 642–647.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p b
SNPs in the myostatin gene of the mollusk Chlamys farreri: Association with growth traits Xiuli Wang a,⁎, Xiangying Meng a, Bin Song a, Xuemei Qiu a, Haiying Liu b a b
College of Life Sciences and Biotechnology, Dalian Fisheries University, Dalian 116023, China School of Marine Engineering, Dalian Fisheries University, Dalian 116023, China
a r t i c l e
i n f o
Article history: Received 24 July 2009 Received in revised form 14 December 2009 Accepted 15 December 2009 Available online 22 December 2009 Keywords: Chlamys farreri Growth traits Myostatin SNPs
a b s t r a c t Myostatin (MSTN) is a member of the transforming growth factor-β superfamily which negatively regulates growth of muscle tissue. In this study, 103 cultivated Chlamys farreri individuals were screened for polymorphisms in the MSTN gene using PCR-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing methods. Two mutations were found: A/G at position 327 in exon 2, which caused an amino acid change from Thr to Ala (Thr305Ala), and C/T at position 289 in exon 3, which caused an amino acid change from Cys to Arg (Cys422Arg). One way ANOVA of the SNPs and growth traits showed that genotype GG of primer M5 had significantly higher body mass, soft-tissue mass, adductor muscle mass, shell length, shell height, absolute growth rate of shell height and body mass than those of genotype AG and AA (P < 0.05). Genotype frequencies of genotype AA, AG and GG were 68.94%, 27.18% and 3.88%, respectively. The results present evidence that the C. farreri MSTN gene may be selected as a candidate gene for these growth traits. © 2009 Elsevier Inc. All rights reserved.
1. Introduction Myostatin (MSTN), also known as growth differentiation factor 8 (GDF-8), is a member of the transforming growth factor-β superfamily isolated from murine muscle tissue by McPherron et al. (1997), which negatively regulates growth of skeletal muscle tissue. As a candidate gene, MSTN can be selected on the basis of its participation in the process of muscle development in animal breeding (Bellinge et al., 2005). The MSTN gene mainly expresses itself in skeletal muscle (Hennebry et al., 2009) and cardiac muscle (Sharma et al., 1999). Several polymorphisms have been identified in the gene (Rescan et al., 2001; Rodgers and Weber, 2001) indicating that the MSTN gene is highly variable. Since the identification of the key role of MSTN in skeletal muscle growth and development, increasing numbers of polymorphisms in MSTN have been intensively investigated. In cattle, several breeds show polymorphisms in this gene. These polymorphisms are directly related to the double muscling phenotype (Wiener et al., 2002; Esmailizadeh et al., 2008; Grisolia et al., 2009; Phocas, 2009) one of which is an 11-base pair deletion in the third exon of the gene (Kambadur et al., 1997; Grobet et al., 1998). In sheep, QTL studies showed that MSTN had a major effect on muscular development in Belgian Texel (Marcq et al., 2002) and on muscling depth in New Zealand Romney sheep (Hickford et al., 2009), Norwegian White Sheep (Boman et al., 2009), Charollais sheep (Hadjipavlou et al., 2009)
⁎ Corresponding author. 52th, Heishijiao Street, Shahekou District, Dalian 116023, China. Tel.: +86 411 84763589; fax: +86 411 84786191. E-mail address: [email protected] (X. Wang). 1096-4959/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2009.12.001
and New Zealand Texel sheep (Johnson et al., 2009). Many studies show that the MSTN gene can affect muscle mass in other species, such as mice (McPherron et al., 1997; Whittemore et al., 2003; Tang et al., 2007; Matsakas et al., 2009; Welle et al., 2009), pigs (Yu et al., 2007; Patruno et al., 2008), dogs (Shelton and Engvall, 2007; Mosher et al., 2007) and in chicken (Kim et al., 2007; Ye et al., 2007). The gene encoding for the MSTN peptide is a consolidate candidate for the enhancement of productivity in terrestrial livestock. It potentially represents an important target for growth improvement of cultured finfish (De Santis et al., 2008). In scallop, Kim et al. (2004) cloned an MSTN-like gene (sMSTN) of a bay scallop (Argopecten irradians) and this gene was aligned against the translated Ciona intestinalis genome. Their results indicate that the MSTN gene has been conserved throughout evolution and could play a major role in muscle growth and development in invertebrates, as it does in mammals. Single nucleotide polymorphisms (SNPs) change in a single base pair of the DNA sequence is the most frequently occurring form of variation in the human genome. Many genes have a large number of SNPs which are mainly used in the studies of disease, even in very small samples (Constantine et al., 2008). By choosing “tag” SNPs, the SNPs can also be used to study association between them and the production traits of individuals. This is an increasingly common approach to genetic association studies. An assumption behind this approach is that the variant and its haplotype are relatively in the general population and will be ascertained in this way (Constantine et al., 2008). Chlamys farreri is one of the economic bivalve species farmed widely in the coastal provinces of northern China since 1983 (Xing et al., 2008). In recent years, the scale of cultivated C. farreri has been
328
X. Wang et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 327–330
expanding continuously in China, and much research has been done to study the technique of cultivating them. In our study, correlations analysis of the growth traits of C. farreri was performed using SNPs. The results of our study can offer some useful information to help select and cultivate C. farreri as a molecular marker-assisted breeding method.
2.3. Statistical analysis Absolute growth rate (AGR) of shell height (ASH) and body mass (ABM) of C. farreri was calculated according to the equation described by Gu et al. (2009): AGR = y = t
2. Materials and methods 2.1. Animals and traits Offspring (age 2 years) of a healthy mature male and female of C. farreri were cultured by the method of raft and long-line in a scallop farm in Dalian, China. A total of 103 C. farreri offspring, which came from the same raft, were randomly selected for use in this study. Their body mass, soft-tissue mass, adductor muscle mass, shell width, shell length and shell height were scored according to the methods of Liu et al. (2002). The adductor muscles of each individual were sampled and preserved in 95% ethanol.
2.2. DNA extraction, PCR amplification and sequence annotation The genomic DNA was extracted by the traditional phenol/ chloroform method and dissolved in sterile water with a concentration of 100 ng/ml and stored at − 20 °C. Seven pairs of primers were designed according to the C. farreri MSTN gene (GenBank accession no: DQ988329). Primers' information of the C. farreri MSTN gene was shown in Table 1. PCR amplification was performed in a reaction volume of 25 µl including 50 ng of genomic DNA, 25 pmol of each primer, 2.5 µl 10 × PCR buffer and 1.5 units Taq DNA polymerase. The condition for PCR was as follows: 5 min at 94 °C; 35 cycles of 30 s at 94 °C, 51 °C for 30 s, 30 s at 72 °C; and a final 7 min extension at 72 °C. One microliters of the PCR product was diluted with 5 µl of loading buffer (98% formamide, 10 mM EDTA pH8.0, 0.025% xylene cyanol FF, 0.025% bromophenol blue, 2% glycerol). After denaturing at 98 °C for 10 min, the mixture was immediately placed on ice for 10 min. Next it was loaded on a 15% acrylamide/bisacrylamide (acr:bis = 29:1) gel. After running at 10 v/cm for 14–16 h, the gel was stained using the silver staining method. Each homozygote PCR product was purified, recovered and sequenced. Finally similarity searches of the deduced amino acid sequence from cDNA sequence of C. farreri MSTN gene were done by Blastp.
where y was ASH or ABM, and t the age in days (t = 730 days). The body mass, soft-tissue mass, adductor muscle mass, shell width, shell length shell height, ASH and ABM of the C. farreri were scored and the data was analyzed by one way ANOVA analysis through software SPSS 14.0. Effects of SNPs on growth traits were analyzed through the above method and the SNPs markers, whose genotypes had significant correlation with the growth traits of the C. farreri, were studied through post hoc multiple comparison (Duncan method). A fixed model was adopted according to the factors that affect growth traits using the following equation: yij = μ + Gi + eij where yij is the observed value of jth individual of genotype i, µ is the mean of observed values, Gi is the effective value of the genotype i and eij is the random residual effect corresponding to the observed values. In this study, the effect of the surrounding environment was included in the random error. 3. Results 3.1. PCR results and analysis Three individuals' MSTN fragments having the same genotype through amplification by the same primer had been sequenced three times. The PCR products of primers M5 and M7 presented polymorphism (Fig. 1). Comparison of the sequences with the known C. farreri MSTN gene sequence (GenBank accession no: DQ988329) showed that there were two polymorphic sites. The first, A327G mutation in exon 2 caused an amino acid change from Thr to Ala (Thr305Ala). The second mutation, T289C in exon 3, caused an amino acid change from Cys to Arg (Cys422Arg). To identify the three genotypes generated by primer M5, the PCR fragments' sequence, which has the base ‘A’ at 327nt, was defined as allele A. While the sequence which has the base ‘G’ at 327nt was defined as allele G. For primer M7, the PCR fragments' sequence, which has the base ‘T’ at 289nt, was defined as allele T. While the sequence which has the base ‘C’ at 289nt was defined as allele C. Blastp
Table 1 Primer information of the Chlamys farreri MSTN gene. Locus
Primer sequence (5′ to 3′)a
M1
F: ATAGCTGTCAACGCGAAAGG R: ATTTCCATCACGTCCCAAAG F: CTTTGGGACGTGATGGAAAT R: AATCGTTTAGCCGTGGTGTT F: AACACCACGGCTAAACGATT R: CACTGTAATCACACAAGGACACG F: ACAGTCCCTGCTGATATGAC R: CCGATTTCTCGTTTGGTTGG F: CCAACCAAACGAGAAATCGG R: ACGTATCCGTCATTTACCCC F: ACACCATTGCTCACATTTCC R: GTCCAATTGTTCACCCTTGC F: TATTACTGCGCCGGTGAATG R: CACTTCACCTTCCCGTCTCT
M2 M3 M4 M5 M6 M7
Locationb
Length (bp)
21–256
236
237–468
232
449–768
320
5708–5914
206
5895–6094
200
7518–7820
303
7782–8063
282
a
F is forward primer and R is reverse primer. Location represents the position of the C. farreri myostatin gene sequence (GenBank accession no: DQ988329). b
Fig. 1. Band patterns for the two SNPs. (a) Genotypes of primer M5, and (b) genotypes of primer M7.
X. Wang et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 327–330
329
Table 2 One way ANOVA analysis of the SNP polymorphism of primer M5 of the Chlamys farreri MSTN gene and growth traits. Genotype
N
Genotypes frequencies (%)
Body mass (g)
Soft-tissue mass (g)
Adductor muscle mass (g)
Shell width (cm)
Shell length (cm)
Shell height (cm)
ASH (mm/d)
ABM (g/d)
AA AG GG
71 28 4
68.94 27.18 3.88
29.48 ± 2.281a 29.74 ± 4.994a 47.07 ± 8.161b
14.62 ± 3.192a 14.36 ± 2.894a 23.30 ± 2.709b
3.92 ± 1.017a 3.72 ± 0.902a 5.84 ± 0.682b
1.91 ± 0.198a 1.89 ± 0.138a 1.94 ± 0.394a
5.78 ± 0.454a 5.81 ± 0.403a 6.87 ± 0.446b
6.28 ± 0.443a 6.30 ± 0.368a 7.29 ± 0.269b
0.086 ± 0.006a 0.0863 ± 0.005a 0.0999 ± 0.004b
0.0404 ± 0.009a 0.0407 ± 0.007a 0.0645 ± 0.011b
Mean values ± standard deviation. N is numbers of C. farreri individuals. Means within the same column of each locus with different superscripts are significantly different (P < 0.05).
searches showed that there are two domains in the MSTN protein: transforming growth factor-beta propeptide (TGFb_propeptide) and transforming growth factor-beta (TGF-beta). The A327G mutation in exon 2 (Thr305Ala) is located at TGFb_propeptide domain and the T289C in exon 3 (Cys422Arg) mutation is located at TGF-beta domain. 3.2. One way ANOVA analysis of the association between different genotypes of the C. farreri MSTN gene and growth traits The association analysis of the seven loci within the C. farreri MSTN gene, with the growth traits, was carried out using one way ANOVA. Six loci (M1, M2, M3, M4, M6 and M7) did not show any significant effects on the examined traits in the C. farreri. M5 was significantly associated with body mass, soft-tissue mass, adductor muscle mass, shell length, shell height, ASH and ABM. Furthermore, multiple comparison analysis was performed in three genotypes of M5. Results showed that the C. farreri with genotype GG of M5 had significantly higher body mass, soft-tissue mass, adductor muscle mass, shell length, shell height, ASH and ABM than those of genotype AG and AA (Table 2). Frequencies of genotypes and alleles of M5 were also calculated (Table 2). The frequencies of genotype AA, AG and GG were 68.94%, 27.18% and 3.88%, respectively. The frequencies of allele A and G were 82.52 and 17.48, respectively. 4. Discussion Some research results showed that the lack of MSTN gene strongly affects muscle phenotype in humans and other animal species (JouliaEkaza and Cabello, 2007). In mice, the MSTN gene knockout causes a significant increase in muscle mass through muscle cell hypertrophy and hyperplasia (Grobet et al., 2003; Whittemore et al., 2003; Tang et al., 2007; Welle et al., 2007). Although Kim et al. (2004) cloned an MSTN-like gene and performed quantitative RT-PCR in different tissues of bay scallop (A. irradians), there are no published reports about the effect of the MSTN SNPs on the growth traits in scallop. In our study, we examined the presence of two MSTN SNPs in C. farreri. It is, to our knowledge, the first report of significant association of these polymorphisms with growth traits in commercial scallop. By the Blastp searches, the A327G mutation (Thr305Ala) and the T289C (Cys422Arg) mutation are located at two domains (TGF-beta domain and TGFb_propeptide domain, respectively). TGF-beta domain of MSTN protein is a multifunctional peptide that controls proliferation, differentiation, and other functions in many cell types (Padgett et al., 1997; Hoodless and Wrana, 1998). The TGFb_propeptide domain is known as latency associated peptide (LAP) in TGF-beta and is a homodimer which is disulfide linked to TGF-beta binding protein (Saharinen et al., 1996; Munger et al., 1997). We supposed that both of the mutations of the MSTN gene could influence the functional structure of MSTN protein so as to affect the growth performance. The results of the one way ANOVA analysis of relationship between the different genotypes and the growth traits showed that the
A327G mutation was significantly associated with the C. farreri growth traits, while the T289C mutation was not. Many studies showed that SNPs in the MSTN gene can affect muscle mass. Hadjipavlou et al. (2008) found that two SNPs in the MSTN gene have significant association with muscle depth of commercial Charollais sheep. Yu et al. (2007) identified two SNPs in the 5′ regulatory region of the MSTN gene which were associated with early growth traits in Yorkshire pigs. Esmailizadeh et al. (2009) found a SNP (F94L) in the MSTN gene affecting birth, growth, carcass, and beef quality traits of Bos taurus. Thus, different MSTN polymorphisms may contribute to differences in strength gains (Jespersen et al., 2006; Grobet et al., 1998; Hickford et al., 2009). In this study, we found two SNPs of MSTN gene in C. farreri. The results showed that the GG genotype can significantly facilitate muscle growth. In the present study, our objective is to detect the MSTN gene SNPs and its association with C. farreri growth traits. We did not detect the MSTN gene expression (RT-PCR) in adductor muscle of C. farreri with different genotypes. The expression will be studied in the future research. Correlation analysis between markers and traits reaching significant level may indicate the existence of relationship between the markers and certain traits. Thus, the selection breeding based on phenotype can go to genotype-assisted selection (Wang and Wu, 2006).The results in this study showed that the mutations in the coding region of the C. farreri MSTN gene were important reasons for the variance of growth traits. So the MSTN gene can act as a candidate gene for the C. farreri breeding. Acknowledgements This project was supported by the National Science and Technology Planning Project in the Eleventh Five-year (2006BAD09A15) and the grant of Dalian Fisheries University. References Bellinge, R.H., Liberles, D.A., Iaschi, S.P., O'brien, P.A., Tay, G.K., 2005. Myostatin and its implications on animal breeding: a review. Anim. Genet. 36, 1–6. Boman, I.A., Klemetsdal, G., Blichfeldt, T., Nafstad, O., Våge, D.I., 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White Sheep (Ovis aries). Anim. Genet. 40, 418–422. Constantine, C.C., Gurrin, L.C., McLaren, C.E., Bahlo, M., Anderson, G.J., Vulpe, C.D., Forrest, S.M., Allen, K.J., Gertig, D.M., Investigators, HealthIron, 2008. SNP selection for genes of iron metabolism in a study of genetic modifiers of hemochromatosis. BMC Med. Genet. doi:10.1186/1471-2350-9-18. De Santis, C., Evans, B.S., Smith-Keune, C., Jerry, D.R., 2008. Molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer) myostatin gene. BMC Genomics. doi:10.1186/1471-2164-9-82. Esmailizadeh, A.K., Bottema, C.D., Sellick, G.S., Verbyla, A.P., Morris, C.A., Cullen, N.G., Pitchford, W.S., 2008. Effects of the myostatin F94L substitution on beef traits. J. Anim. Sci. 86, 1038–1046. Grisolia, A.B., D'Angelo, G.T., Porto Neto, L.R., Siqueira, F., Garcia, J.F., 2009. Myostatin (GDF8) single nucleotide polymorphisms in Nellore cattle. Genet. Mol. Res. 8, 822–830. Grobet, L., Pirottin, D., Farnir, F., Poncelet, D., Royo, L.J., Brouwers, B., Christians, E., Desmecht, D., Coignoul, F., Kahn, R., Georges, M., 2003. Modulating skeletal muscle mass by postnatal, muscle-specific inactivation of the myostatin gene. Genesis 35, 227–238.
330
X. Wang et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 327–330
Grobet, L., Poncelet, D., Royo, L.J., Brouwers, B., Pirottin, D., Michaux, C., Ménissier, F., Zanotti, M., Dunner, S., Georges, M., 1998. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mamm. Genome 9, 210–213. Gu, Z.F., Wang, Q.Y., Fang, J.G., Ye, N.H., Mao, Y.Z., Shi, Y.H., Wang, Y., Wang, A.M., 2009. Growth of cultured pearl oyster (Pinctada martensii) in Li'an Lagoon, Hainan Island, China. J. Shellfish Res. 28, 465–470. Hadjipavlou, G., Matika, O., Clop, A., Bishop, S.C., 2008. Two single nucleotide polymorphisms in the myostatin (GDF8) gene have significant association with muscle depth of commercial Charollais sheep. Anim. Genet. 39, 346–353. Hennebry, A., Berry, C., Siriett, V., O'Callaghan, P., Chau, L., Watson, T., Sharma, M., Kambadur, R., 2009. Myostatin regulates fiber-type composition of skeletal muscle by regulating MEF2 and MyoD gene expression. Am. J. Physiol. Cell Physiol. 296, C525–534. Hickford, J.G., Forrest, R.H., Zhou, H., Fang, Q., Han, J., Frampton, C.M., Horrell, A.L., 2009. Polymorphisms in the ovine myostatin gene (MSTN) and their association with growth and carcass traits in New Zealand Romney sheep. Anim. Genet. doi:10.1111/ j.1365-2052.2009.01965.x. Hoodless, P.A., Wrana, J.L., 1998. Mechanism and function of signaling by the TGF beta superfamily. Curr. Top. Microbiol. Immunol. 228, 235–272. Jespersen, J., Kjaer, M., Schjerling, P., 2006. The possible role of myostatin in skeletal muscle atrophy and cachexia. Scand. J. Med. Sci. Sports 16, 74–82. Johnson, P.L., Dodds, K.G., Bain, W.E., Greer, G.J., McLean, N.J., McLaren, R.J., Galloway, S.M., van Stijn, T.C., McEwan, J.C., 2009. Investigations into the GDF8 g+ 6723G–A polymorphism in New Zealand Texel sheep. J. Anim. Sci. 87, 1856–1864. Joulia-Ekaza, D., Cabello, G., 2007. The myostatin gene: physiology and pharmacological relevance. Curr. Opin. Pharmacol. 7, 310–315. Kambadur, R., Sharma, M., Smith, T.P.L., Bass, J.J., 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7, 910–915. Kim, H.W., Mykles, D.L., Goetz, F.W., Roberts, S.B., 2004. Characterization of a myostatin-like gene from the bay scallop, Argopecten irradians. Biochim. Biophys. Acta 1679, 174–179. Kim, Y.S., Bobbili, N.K., Lee, Y.K., Jin, H.J., Dunn, M.A., 2007. Production of a polyclonal anti-myostatin antibody and the effects of in ovo administration of the antibody on posthatch broiler growth and muscle mass. Poult. Sci. 86, 1196–1205. Liu, X.L., Chang, Y.Q., Xiang, J.H., Song, J., Ding, J., 2002. Analysis of effects of shell size characters on live weight in Chinese scallop Chlamys farreri. Oceanol. Limnol. Sinica. 33, 673–678. Marcq, F., Larzul, C., Marot, V., Bouix, J., Eychenne, F., Laville, E., Bibe, B., Leroy, P.L., Georges, M., Elsen, J.M., 2002. Preliminary results of a whole-genome scan targeting QTL for carcass traits in a Texel Romanov intercross. Proceedings of the 7th World Congress on Applied Livestock Production. Montpellier, pp. 19–23. Matsakas, A., Foster, K., Otto, A., Macharia, R., Elashry, M.I., Feist, S., Graham, I., Foster, H., Yaworsky, P., Walsh, F., Dickson, G., Patel, K., 2009. Molecular, cellular and physiological investigation of myostatin propeptide-mediated muscle growth in adult mice. Neuromuscul. Disord. 19, 489–499. Mosher, D.S., Quignon, P., Bustamante, C.D., Sutter, N.B., Mellersh, C.S., Parker, H.G., Ostrander, E.A., 2007. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. doi:10.1371/ journal.pgen.0030079. McPherron, A.C., Lawler, A.M., Lee, S.J., 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83–90. Munger, J.S., Harpel, J.G., Gleizes, P.E., Mazzieri, R., Nunes, I., Rifkin, D.B., 1997. Latent transforming growth factor-beta: structural features and mechanisms of activation. Kidney Int. 51, 1376–1382.
Padgett, R.W., Savage, C., Das, P., 1997. Genetic and biochemical analysis of TGF beta signal transduction. Cytokine Growth Factor Rev. 8, 1–9. Patruno, M., Caliaro, F., Maccatrozzo, L., Sacchetto, R., Martinello, T., Toniolo, L., Reggiani, C., Mascarello, F., 2008. Myostatin shows a specific expression pattern in pig skeletal and extraocular muscles during pre- and post-natal growth. Differentiation 76, 168–181. Phocas, F., 2009. Genetic analysis of breeding traits in a Charolais cattle population segregating an inactive myostatin allele. J. Anim. Sci. 87, 1865–1871. Rescan, P.Y., Jutel, I., Rallière, C., 2001. Two myostatin genes are differentially expressed in myotomal muscles of the trout (Oncorhynchus mykiss). J. Exp. Biol. 204, 3523–3529. Rodgers, B.D., Weber, G.M., 2001. Sequence conservation among fish myostatin orthologues and the characterization of two additional cDNA clones from Morone saxatilis and Morone americana. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 129, 597–603. Saharinen, J., Taipale, J., Keski-Oja, J., 1996. Association of the small latent transforming growth factor-beta with an eight cysteine repeat of its binding protein LTBP-1. EMBO J. 15, 245–253. Sharma, M., Kambadur, R., Matthews, K.G., Somers, W.G., Devlin, G.P., Conaglen, J.V., Fowke, P.J., Bass, J.J., 1999. Myostatin, a transforming growth factor-beta superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. J. Cell Physiol. 180, 1–9. Shelton, G.D., Engvall, E., 2007. Gross muscle hypertrophy in whippet dogs is caused by a mutation in the myostatin gene. Neuromuscul. Disord. 17, 721–722. Tang, L., Yan, Z., Wan, Y., Han, W., Zhang, Y., 2007. Myostatin DNA vaccine increases skeletal muscle mass and endurance in mice. Muscle Nerve 36, 342–348. Wang, G.F., Wu, D.J., 2006. Correlation analysis of microsatellite DNA markers with wool traits in liangshan semi-fine wool sheep. Hereditas 28, 1505–1512. Welle, S., Bhatt, K., Pinkert, C.A., Tawil, R., Thornton, C.A., 2007. Muscle growth after postdevelopmental myostatin gene knockout. Am. J. Physiol. Endocrinol. Metab. 292, E985–E991. Whittemore, L.A., Song, K., Li, X., Aghajanian, J., Davies, M., Girgenrath, S., Hill, J.J., Jalenak, M., Kelley, P., Knight, A., Maylor, R., O'Hara, D., Pearson, A., Quazi, A., Ryerson, S., Tan, X.Y., Tomkinson, K.N., Veldman, G.M., Widom, A., Wright, J.F., Wudyka, S., Zhao, L., Wolfman, N.M., 2003. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem. Biophys. Res. Commun. 300, 965–971. Welle, S., Burgess, K., Thornton, C.A., Tawil, R., 2009. Relation between extent of myostatin depletion and muscle growth in mature mice. Am. J. Physiol. Endocrinol. Metab. 297, E935–E940. Wiener, P., Smith, J.A., Lewis, A.M., Woolliams, J.A., Williams, J.L., 2002. Muscle-related traits in cattle: the role of the myostatin gene in the South Devon breed. Genet Sel. Evol. 34, 221–232. Xing, J., Lin, T., Zhan, W., 2008. Variations of enzyme activities in the haemocytes of scallop Chlamys farreri after infection with the acute virus necrobiotic virus (AVNV). Fish Shellfish Immunol. 25, 847–852. Ye, X., Brown, S.R., Nones, K., Coutinho, L.L., Dekkers, J.C., Lamont, S.J., 2007. Associations of myostatin gene polymorphisms with performance and mortality traits in broiler chickens. Genet Sel. Evol. 39, 73–89. Yu, L., Tang, H., Wang, J., Wu, Y., Zou, L., Jiang, Y., Wu, C., Li, N., 2007. Polymorphisms in the 5' regulatory region of myostatin gene are associated with early growth traits in Yorkshire pigs. Sci. China C Life Sci. 50, 642–647.