TIMPs and uPA system in bovine mammary fibroblasts

+

MODEL

Journal of Microbiology, Immunology and Infection xxx (xxxx) xxx

Available online at www.sciencedirect.com

ScienceDirect journal homepage: www.e-jmii.com

Original Article

Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts Zengqiang Miao a, Yulin Ding a, Yannan Bi a,b, Mengjuan Chen a, Xia Cao a, Fenglong Wang a,* a Inner Mongolia Agricultural University, Key Laboratory of Clinical Diagnosis and Treatment, Technology in Animal Disease, Hohhot, Inner Mongolia, China b Baotou Medical College, Baotou, Inner Mongolia, China

Received 8 April 2019; received in revised form 19 August 2019; accepted 30 September 2019

Available online - - -

KEYWORDS BMFBs; S. aureus; MMPs; TIMPs; uPA system

Abstract Background: Bovine mammary fibrosis is characteristic of chronic in injury in response to diverse pathogens. Staphylococcus aureus (S.aureus) is a frequent cause of mastitis in bovine and is prone to persistent infection. Diverse studies have shown MMPs/TIMPs and uPA system as a potent target for the treatment of fibrosis. However, pathogenesis of S. aureus-induced mammary fibrosis has not been completely defined. Methods: BMFBs treated with heat-inactivated S. aureus (105, 106, and 108 CFU/mL) for 6, 12, 24, and 48 h. Total RNA and protein were isolated from the treatments and controls of BMFBs samples. MMP-1, MMP-2, MMP-3, MMP-9, MMP-13, TIMP-1, TIMP-2, COL I, uPA, uPAR and PAI-1 gene and protein expression were examined by RT-qPCR and Western blot analysis. Gelatin zymography assay was performed to assess the levels of MMP-2 and MMP-9 enzyme secreted. Results: BMFBs treated with heat-inactivated S. aureus increased mRNA and protein expression levels of MMP-1, MMP-2, MMP-3, MMP-9 and MMP-13, and heat-inactivated S. aureus induced TIMP-1, TIMP-2 and COL I expression. There was a clear activation of MMP-2 in the presence of heat-inactivated S. aureus in the conditioned medium from the BMFBs, whereas MMP-9 was no significantly altered. Moreover, uPA system was activated in BMFBs to S. aureus. Conclusion: Activation of the uPA system together with its impact on the MMPs levels could play a significant role in S. aureus-induced BMFBs with mechanism of ECM metabolism, MMPs/TIMPs and uPA system could participate in bovine mammary fibrosis. Copyright ª 2019, Taiwan Society of Microbiology. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).

* Corresponding author. Inner Mongolia Agricultural University, 010018, Hohhot, Inner Mongolia, China. Fax: þ86 4309175. E-mail address: [email protected] (F. Wang). https://doi.org/10.1016/j.jmii.2019.09.008 1684-1182/Copyright ª 2019, Taiwan Society of Microbiology. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

2

Introduction Bovine mammary fibrosis is a disease characterized by excessive deposition of extracellular matrix (ECM) and the accumulation of myofibroblasts. Staphylococcus aureus (S.aureus) induces the release of damage associated molecular patterns (DAMPs) in a persistent infection of the bovine mammary gland.1,2 During the process, fibroblasts can be differentiated into myofibroblasts, activated myofibroblasts migrate and secrete the cytokines and chemokines,3,4 which induces collagen (COL) production that leads ECM deposition, and they also upregulate matrix metalloproteinases (MMPs), tissue inhibitors of metalloproteinases (TIMPs) and activate urokinase-type plasminogen activator (uPA) system. MMPs are a kind of important proteinases in many biological and pathological processes5,6 such as embryogenesis,7 tissue remodeling,8 angiogenesis9 and more, because of their ability to degrade ECM in serious diseases such as arthritis, fibrosis, tumor growth and metastasis, rendering the MMPs attractive targets for inhibition therapy.10e13 Studies have shown that the activity of these enzymes changes during the formation and regression of fibrosis. TIMPs, as natural endogenous tissue suppressors, include four subtypes: TIMP-1, -2, -3 and -4.14 TIMPs can specifically bind to the active form of MMPs to form the MMP-TIMP complex and block the binding between MMPs and substrate, thus playing a role in inhibiting the activity of MMPs.15 Under pathological conditions associated with unbalanced MMP activities, changes of TIMPs levels are considered to be important because they directly affect the level of MMP activity. At the same time, it plays an important role in cell proliferation and differentiation without depending on its inhibition of MMPs activity.16 In the present study, MMPs/TIMPs mainly focus on lung, liver, renal and myocardial fibrosis, and a possible role for MMPs/TIMPs in S. aureus-induced bovine mammary fibrosis has not been documented. Although we do not yet know precisely how MMPs function during mammary fibrosis, some MMPs are indeed anti-fibrotic, whereas others can have pro-fibrotic functions in other tissue fibrosis.5 The therapeutic potential of antibodies targeting the catalytic zinc complex of activated matrix metalloproteinases has been demonstrated with relevant mouse models of inflammatory bowel disease.17 It is generally believed that MMPs are activated by cascaded enzymatic coupling activated by plasminogen activators (PAs).18 The uPA system is composed of uPA, uPA receptor (uPAR) and physiologic inhibitor, PA inhibitor-1 (PAI-1).19 The uPA can convert plasminogen into plasmin, also signal through uPAR directly, where secreted MMPs play an important role.20 On the other hand, PAI-1 regulates tissue homeostasis by inhibiting MMP activation. Multiple reports using models of lung, liver, and kidney fibrosis suggest that PAI-1 deficiency or inhibition of PAI-1 activity attenuates fibrosis.21 Nebulized uPA attenuated development of lung fibrosis in a model of bleomycin-induced lung injury in rabbits.22 PAI-1 RNAi attenuated fibrosis in a mouse model of bleomycin-induced lung injury when administered by intranasal instillation.23 Functional blocking antibodies for uPA and/or uPAR have also been evaluated in pre-

Z. Miao et al. clinical studies of cancer, hepatic fibrinolysis and acute lung injury, providing evidence for the feasibility of targeting uPA or uPA-uPAR interactions using antibody-based strategies.24e26 To date, the role of uPA system in fibrosis of other organs has been studied broadly, but the contribution of bovine mammary fibrosis has been less assessed. Studies of ECM catabolism in other organs fibrosis provide evidences for MMPs gene expression and activity. However, to our best knowledge, there are no studies between MMPs/TIMPs and uPA system in the bovine mammary gland fibrosis. Currently, our work is the first systematic study of MMPs/TIMPs and uPA system in bovine mammary gland fibrosis, include its role in dynamic changes in BMFBs to S. aureus. Therefore, the main objectives of this study were to elucidate whether MMPs/TIMPs and uPA system participate in bovine mammary fibrosis, and to demonstrate the dynamic change correlation of the MMPs/TIMPs and uPA system in BMFBs to S. aureus.

Materials and methods Preparation of heat-inactivated S.aureus The S. aureus strain was isolated and identified by our laboratory and cultured in nutrient broth medium for 24 h at 37  C, sub-cultured in the high salt mannitol medium at 37  C for 24 h, and amplified at 37  C for 18 h. The colony forming units (CFU) were confirmed using the colony counting method in serial dilution to obtain concentrations of 105, 106, and 108 CFU/mL in Dulbecco’s modified Eagles medium (DMEM)/F12 (Gibco, Life Technologies). They were then inactivated at 70  C for 30 min. The heat-inactivated bacteria were plated on agar plates overnight at 37  C, no bacterial colonies were observed.

Cell treatment BMFBs were extracted from the mammary glands of late pregnancy bovine. Growth medium for fibroblasts culture was DMEM/F12 supplemented with 10% fetal bovine serum (FBS; ExCell Biolog) and 1% penicillin/streptomycin solution. Fibroblasts were cultured in 25 cm3 plates and grown to 80e90% confluence. Before stimulation with heatinactivated S. aureus, the cell culture supernatants were removed, and washed three times with D’Hanks. The cells were treated with fresh DMEM/F12 supplemented with 1% penicillin/streptomycin solution without FBS starvation for 24 h. Cells were stimulated with serum-free media (Controls) and heat-inactivated bacteria at 105, 106, and 108 CFU/mL (Treatments) for 6, 12, 24, and 48 h, respectively. The supernatant was collected and stored at 80  C until use. The BMFBs were then harvested for qPCR and Western blot analysis.

Total RNA extraction and RT-qPCR analysis Total RNA was performed from BMFBs using kit (AXYGEN), as described by the manufacturer. Reverse transcription was carried out using a Prime Script RT Reagent Kit (TaKaRa BIO INC). The purity of the total RNA were measured using the

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

MMPs/TIMPs and uPA system in bovine mammary fibroblasts 260/280 nm ratio. The reaction conditions were 15 min at 37  C followed by 5 s at 85  C. The cDNA samples were stored at 80  C.We used the expression of b-actin, as a “house-keeping” gene. The qPCR conditions were as follows: 95  C 30 s, 95  C 5 s, 60.8  C 34 s. The reaction system was carried out according to the standard protocol provided with the TB Green protocol (TaKaRa BIO INC). Primers used are presented in Table 1.

Western blot analysis The samples were harvested according to the tissue or cell total protein extraction kit instructions (Sangon Biotech). The protein concentrations were detected using the BCA protein assay kit (Beyotime Biotechnology). Samples were denatured at 100  C for 5 min, blotted on to Nitrocellulose (NC) membranes by electrophoresis on 8%e10% SDS-PAGE gradient gel, and blocked in 5% BSA for 3 h at room temperature. Membranes were incubated with specific antibody: mouse-anti b-actin (Abcam; 1:10000); rabbit-anti MMP-1 (Bioworld Technology; 1:300); rabbit-anti MMP-2, -3,-9,-13, TIMP-1, -2, uPA, uPAR, PAI-1 (ProteinTech Group; 1:500); mouse-anti COL I (ProteinTech Group; 1:1000) for 12 h at 4  C. Subsequently, the membranes were washed with TBST for 5  10 min, then incubated with secondary antibody (goat anti-rabbit antibody at a 1:3000 dilution and goat anti-mouse antibody at a 1:4000 dilution) for 1 h. Immunoblot signals used ECL Western blot detection kit (Thermo Scientific) according to the manufacturer’s instruction.

3

Gelatin zymography Gelatin zymography assay was performed on conditioned media collected from untreated and heat-inactivated S. aureus-treated cells to assess the levels of MMP-2 and MMP9 enzyme secreted. A volume of 15 mL of zymography sample was mixed with 2 SDS-PAGE non-reducing buffer (4% SDS, 100 mM TriseHCl (pH 6.8), 20% glycerol and 0.02% bromophenol blue) without boiling. The whole samples were loaded on an 8% SDS-PAGE gel containing 0.1% gelatin, followed by electrophoresing at 120 V for 90 min at 4  C. The gels were rinsed in distilled water and washed twice in 2.5% Triton-X 100 solution to remove SDS with shaking for 2 h at room temperature, then incubated in 10 mL incubation buffer (50 mM TriseHCl pH 8, 0.5 mM CaCl2, 5 mM ZnCl2) for 12 h at 37  C. Bands were stained by Coomassie blue R-250 for 2 h at room temperature, then destained in methanol-acetic acid-water (7:5:88) (V:V:V) for 2 h. The images were captured on a SynGene G (Hercules, CA).

Statistical analysis The mRNAs were standardized to the value of b-actin according to 2DCT method. The statistical analysis used SPSS 22. Western blot band quantifications were performed with Image J and GraphPad Prism 5. Gelatin zymography bands were analyzed by Image J software. The activities of all samples were normalized by setting the activity of the relevant control to one at least triplicates. The results are expressed with two-way ANOVA as means  SD (*P < 0.05, **P < 0.01).

Results Table 1 Gene

Primer sequences for qPCR. Primer sequence (50 to 30 )

MMP-1 F: TCAACTCTGGAGCAATGTCACACC R: ATGAGCGTCTCCTCCGATACCTG MMP-2 F: GACCAGAGCACCATTGAGACCATG R: GAGCGAAGGCATCATCCACTGTC MMP-3 F: AGAGTCTTCCGATTCTGCTGTTGC R: GCTCCATGGTGTCTTCCTTGTCC MMP-9 F: GGTGCTGGCTTGCTGCTCTG R: TTGGTGAGGTTGGTTCGTGGTTC MMP-13 F: CATCCTCAGCAGGTTGAAGCAGAG R: TCATAGGCGGCATCAATACGGTTG TIMP-1 F: CCTGTTGCTGCTGTGGCTCAC R: GACGACATCGGAGTTGCAGAAGG TIMP-2 F: ACGAGTGCCTCTGGATGGACTG R: GAGCCGTCGCTTCTCTTGATGC COL I F: AGGAATGCCTGGTGAACGA R: CACCTTTGGGACCAGCATC uPA F: CAGGTCACCAACGCCGAGAAC R: CTGATGAGGCTGCCACCACAC uPAR F: GCCAACCGCTGCTGCTACTG R: ACGTTCATCTCATTGCCACCTTCC PAI-1 F: GAGAGCCAGGTTCATCGTCAACG R: GGTGCTGCCATCGGACTTGTG b-actin F: TCTGGCACCACACCTTCTACAAC R: GGACAGCACAGCCTGGAT

Product length 175 bp

Expression of MMPs gene and protein after treatments with different concentrations of heatinactivated S.aureus

169 bp 93 bp 87 bp 83 bp 91 bp 91 bp 77 bp 98 bp 175 bp 199 bp 170 bp

To quantitatively measure the expression of MMP-1, MMP-2, MMP-3, MMP-9 and MMP-13 mRNAs in BMFBs after heatinactivated S. aureus treatment, qPCR was performed. Unlike in untreated BMFBs, stimulation of the cells with heat-inactivated S. aureus increased MMP-1, MMP-2, MMP3, MMP-9 and MMP-13 mRNA levels. To find optimal time for S. aureus treatment, we measured the expression of MMPs after treatment of heat-inactivated S. aureus (105, 106, and 108 CFU/mL) for 6, 12, 24, and 48 h. The expression of MMP-1 increased compared to the control, especially 108 CFU/mL heat-inactivated S. aureus treated (Fig. 1a). The expression of MMP-2 and MMP-3 increased in a concentration-dependent manner until 24 h, and then declined compared to the control (Fig. 1c, e). Moreover, the MMP-2 mRNA expression decreased in the 105 and 106 CFU/mL S. aureus treatments (Fig. 1c). However, the expression of MMP-9 and MMP-13 increased in a timedependent manner until 12 h, and then declined compared to the controls, especially the treatment of heatinactivated S. aureus for 48 h (Fig. 1g,i). To determine the zymogen activation of MMP-1, MMP-2, MMP-3, MMP-9 and MMP-13 regulation by different

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

4

Z. Miao et al.

Figure 1. BMFBs were cultured under unstimulated conditions and the heat-inactivated S. aureus at 105, 106, and 108 CFU/mL treated for 6, 12, 24, and 48 h, respectively. a, c, e, g, i. After treatments, the MMP-1, MMP-2, MMP-3, MMP-9 and MMP-13 mRNA levels were determined by qPCR, respectively. b, d, f, h, j. the MMP-1, MMP-2, MMP-3, MMP-9 and MMP-13 protein levels were determined by Western blot, respectively. k. Gelatin zymography of MMP-2 (72 kDa) and MMP-9 (92 kDa) in different concentrations of heat-inactivated S. aureus-treated group. The activity of all samples were normalized by setting the activity of the relevant control to one at least triplicates. The mRNA were standardized to the value of b-actin according to 2DCT method. Data are expressed with two-way ANOVA as means  SD (*P < 0.05, **P < 0.01, ***P < 0.001).

concentrations of heat-inactivated S. aureus, we examined its effect on the induction of the protein of the five MMPs. Firstly, MMP-1 protein expression was higher compared to the controls, and peaking at 105 CFU/mL at 12 h, 106 CFU/ mL at 24 h and 108 CFU/mL at 48 h, respectively, rather than 6 h (Fig. 1b). Western blot demonstrated the increased expression of MMP-2 in the stimulatory effect of heatinactivated S. aureus compared with unstimulated BMFBs. The heat-inactivated S. aureus stimulates MMP-2 expression in a dose- and time-dependent manner (Fig. 1d). The expression of MMP-3 decreased in a time-dependent manner until 12 h, and then increased compared to the controls, with significant increase at the S. aureus treatments and peaking at 105 CFU/mL at 48 h, 106 CFU/mL at 24 h (Fig. 1f). MMP-9 and MMP-13 were upregulated in a dose-dependent manner by heat-inactivated S. aureus, but it was suppressed at 48 h (Fig. 1h,j).

Heat-inactivated S.aureus-induced activation of MMP-2 and MMP-9 in BMFBs The secreted levels of MMP-2 and MMP-9 were determined by gelatin zymography of conditioned media at 6, 12, 24, 48 h. There was a clear activation of MMP-2 in the presence of heat-inactivated S. aureus in the conditioned medium from the BMFBs. Zymography showed an upregulation of MMP-2 by 1.09, 1.12, 1.18, 1.21-fold 6e48 h following infection of BMFBs with 108 CFU/mL heat-inactivated S. aureus, reaching the maximum level at 48 h, but which was not apparent in with 105 CFU/mL heat-inactivated S. aureus (Fig. 1k). The change of MMP-9 was not as profound as MMP2. When the conditioned medium from heat-inactivated S. aureus was applied to zymography gels, slight MMP-9 activation was observed as seen. Despite the lack of apparent activation of MMP-9 in BMFBs, by zymography quantitation

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

MMPs/TIMPs and uPA system in bovine mammary fibroblasts

Figure 1.

of MMP-9 activity demonstrated a 1.17-fold and 1.24-fold increase in MMP-9 activity in BMFBs following 24-h exposure to 108 CFU/mL heat-inactivated S. aureus, but which was not apparent in with 105 CFU/mL heat-inactivated S. aureus (Fig. 1k). Nevertheless, they still showed a similar pattern, reaching the maximum at 48 h. Interestingly, the MMP-2 stayed in a relatively higher level than MMP-9, the difference may be due to the fact that zymography underestimated the relatively weak MMP-9 activation by S. aureus in BMFBs.

Expression of TIMPs gene and protein after treatments with different concentrations of heatinactivated S.aureus Based on increased MMPs mRNA expression, we next examined mRNA expression of the TIMP-1 and TIMP-2. The

5

(continued).

expression of TIMP-1 increased in a time-dependent manner until 12 h, while the treatment of 108 CFU/mL heat-inactivated S. aureus until 48 h (Fig. 2a). There were a few differences of TIMP-2 expression compared with TIMP1. The mRNA expression level of TIMP-2 was upregulated in the 108 CFU/mL S. aureus treatment until 24 h, it was downregulated in the 105 and 106 CFU/mL S. aureus treatments (Fig. 2c). However, heat-inactivated S. aureus treatments demonstrated a significant effect for TIMP-1 and TIMP-2 protein expression. The level of TIMP-1 was increased in a heat-inactivated S. aureus dose-dependent manner, except for 6 h (Fig. 2b). The difference was significant for TIMP-2, protein expression of TIMP-2 was decreased compared with the control group, especially effects of 106 and 108 CFU/mL heat-inactivated S. aureus (Fig. 2d). Overall, these experiments indicate that heat-inactivated S. aureus has an effect on the expression of TIMPs in BMFBs.

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

6

Z. Miao et al.

Figure 2. BMFBs were cultured under unstimulated conditions and the heat-inactivated S. aureus at 105, 106, and 108 CFU/mL treated for 6, 12, 24, and 48 h, respectively. a, c. After treatments, the TIMP-1 and TIMP-2 mRNA levels were determined by qPCR, respectively. b, d. TIMP-1 and TIMP-2 protein levels were determined by Western blot, respectively. The mRNA were standardized to the value of b-actin according to 2DCT method. Data are expressed with two-way ANOVA as means  SD (*P < 0.05, **P < 0.01, ***P < 0.001).

Effects of different concentrations of heatinactivated S.aureus treatment on Collagen type I (COL I) mRNA and protein expression in BMFBs COL I is the main component of the extracellular matrix, and it is an important indicator of tissue fibrosis. Treatments with heat-inactivated S. aureus significantly induced the expression of COL I mRNA and protein, compared with BMFBs controls. COL I mRNA expression peaked at 105 and 106 CFU/mL at 6 h and 108 CFU/mL at 6, 12 h (Fig. 3a). The expression of COL I protein was increased in a timedependent manner, in particular 106 CFU/mL heatinactivated S. aureus treatment (Fig. 3b).

Effects of different concentrations of heatinactivated S.aureus on constitutive expression of uPA system in BMFBs We examined the effect of different concentrations of heat-inactivated S. aureus on the constitutive expression of three uPA system components: uPA, uPAR, and PAI-1, in BMFBs. The data indicates that S. aureus released more uPA mRNA than the controls at 6 h and 12 h, with expression peaking at 12 h with 108 CFU/mL S. aureus. The expression of uPAR and PAI-1 mRNA increased with different concentrations of S. aureus (106, 108 CFU/mL) except 48 h, with expression peaking at 6 h with 108 CFU/ mL S. aureus. Nonsignificant effects were observed on uPAR, uPA, and PAI-1 expression after 105 CFU/mL S. aureus (Fig. 4a, c, e). Similarly, we measured the levels on uPA, uPAR, and PAI-1 protein present in BMFBs by Western blot analysis. The amount of uPA and uPAR protein increased significantly with different concentrations of S. aureus at each time point, with expression peaking at 24 h with 105 CFU/ mL or 106 CFU/mL S. aureus, respectively (Fig. 4b, d).

However, the amount of PAI-1 protein only increased after induction with 108 CFU/mL S. aureus, it decreased steadily or decreased significantly with 105 CFU/mL or 106 CFU/mL S. aureus (Fig. 4f).

Discussion The pathology of bovine mammary gland fibrosis is distinguished by excessive deposition of ECM and the accumulation of activated fibroblasts.2 In the development of fibrosis, researches on MMPs and uPA system have mainly focused on pulmonary fibrosis (PF),8 liver fibrosis,5 cardiac fibrosis16 etc, but the mechanism of S. aureus-induced bovine mammary fibrosis has been less assessed. The results of the present study revealed that different concentrations of heat-inactivated S. aureus can promote or suppress several MMPs and TIMPs in secretion and activity, and activate uPA system in BMFBs. It maybe implicate MMPs/TIMPs and uPA system participate in bovine mammary fibrosis, and could play a significant role in S. aureusinduced BMFBs with mechanism of ECM metabolism. It was commonly thought that MMPs have been considered to be anti-fibrotic factors due to degrading ECM to limit fibrosis. Inhibition MMPs proteolytic activity or upregulation of TIMPs was thought to account for ECM accumulation and fibrosis.27,28 In recent years, discovery of them have revealed diverse biological functions of MMPs in vivo and vitro. Against expectations, in IPF, MMP-1, -2, -9 and -13 were significantly upregulated, and showed an exaggerated early inflammatory response and an augmented lung fibrosis in bleomycin-challenged MMP-13/  mice, but it was decreased in radiation-treated MMP-13/  mice decreased pulmonary inflammation, whereas none of the TIMPs (1e4) were significantly altered.29 Yamashita CM et al. have demonstrated that transient adenoviral vector-mediated expression of recombinant MMP-3 in the

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

MMPs/TIMPs and uPA system in bovine mammary fibroblasts

7

Figure 3. BMFBs were cultured under unstimulated conditions and the heat-inactivated S. aureus at 105, 106, and 108 CFU/mL treated for 6, 12, 24, and 48 h, respectively. a. After treatments, the COL I mRNA level was determined by qPCR. b. COL I protein level was determined by Western blot. The mRNA were standardized to the value of b-actin according to 2DCT method. Data are expressed with two-way ANOVA as means  SD (*P < 0.05, **P < 0.01, ***P < 0.001).

lungs of rats induces pulmonary myofibroblast accumulation and fibrosis, MMP-3 mRNA and protein levels were increased in whole lung, MMP-3/ mice are protected in the bleomycin-induced fibrosis models, and overexpression of MMP-3 promotes PF by activating TGF-b, but the

expression of MMP-9 level was no change.30 MMP-2, MMP-9 expression was decreased, while TIMP-1 expression was the opposite in the CCL4-or BDL-induced fiver fibrosis models groups.31 LPS challenge increased the protein levels of uPA, MMP-2 and MMP-9, and induced the activity of MMP-2 and

Figure 4. BMFBs were cultured under unstimulated conditions and the heat-inactivated S. aureus at 105, 106, and 108 CFU/mL treated for 6, 12, 24, and 48 h, respectively. a, c, e. After treatments, the uPA, uPAR, PAI-1 mRNA levels were determined by qPCR, respectively. b, d, f. uPA, uPAR, PAI-1 protein levels were determined by Western blot, respectively. The mRNA were standardized to the value of b-actin according to 2DCT method. Data are expressed with two-way ANOVA as means  SD (*P < 0.05, **P < 0.01, ***P < 0.001).

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

8 MMP-9 in H9c2 cardiomyoblasts, whereas none of the TIMP1, -2, -3, -4 were significantly altered.16,32 Kanangat S et al. reported that MMP-1, MMP-2, MMP-3 had significantly enhanced in human synovial fibroblasts with S. aureus culture supernatant.10 Peptidoglycan of S. aureus causes a rapid elevation of MMP-9 protein in the liver, lung, and blood of the rat.33 Zymography showed upregulation of MMP-2 and MMP-9 following infection of BMFBs with heatinactivated S. aureus, despite the lack of apparent activation of MMP-9 in BMFBs. Interestingly, comparable studies indicated that bovine mammary epithelial cells (BMECs) also secreted MMP-2 and MMP-9 in response to different concentrations of heat-inactivated S. aureus. And the change of MMP-9 was as same as MMP-2, following infection of BMECs with different concentrations of heat-inactivated S. aureus (data not shown). The difference may be due to the fact that zymography underestimated the relatively weak MMP-9 activation by S. aureus in BMFBs and MMP-2 and MMP-9 may play different biological roles in the BMFBs and BMECs. These findings suggest that heatinactivated S. aureus may cause bovine mammary damage and dysfunction through upregulating MMPs and TIMPs. In induced processing, the difference of expression may be due to the fact that MMPs and TIMPs in response to S. aureus is ECM dependent or is mutual inducement in cells, so should be examined further. Unexpectedly, different cell types express MMPs and mechanisms by which MMPs regulate have different roles in fibrosis, such that increased expression of an MMP (or MMPs) might be “pro-fibrotic” in one cell type, whereas increased expression in another cell type might serve an “antifibrotic” function. The study reported that MMP-1 has antifibrotic activities in the hepatic fibrosis reversed the fibrosis in vivo.34 The pro-fibrotic effects of MMP-2 and -9 have been implicated in pulmonary fibrosis.14 Murthy et al. reported that MMP-9 plays a pro-fibrotic role in pulmonary experimental fibrosis,35 also similar result in liver fibrosis model.36 COL I is the main component of the extracellular matrix, and it is an important indicator of tissue fibrosis. In this study, heat-inactivated S. aureus significantly induced the expression of COL I mRNA and protein, which is consistent with the expression of MMPs. It has not been proved whether COL I has some intervention effects on the metabolism of MMPs. Therefore, MMPs play an anti-fibrotic or pro-fibrotic effect was to be further study in bovine mammary fibrosis. It is worth noting that the expression of uPA system components (uPA, uPAR, PAI-1) is increased in inflammatory and cancer process, including some human diseases.24e26 In IPF patients, uPA elicits fibrogenic activity via binding uPAR, PAI-1 also contributes to pulmonary fibrosis. The uPA and uPAR are upregulated, PAI-1 mRNA expressed lower levels in fibrotic lung fibroblasts from the lungs of patients with IPF.37 It is reported that the expression of PAI-1 mRNA was continuously increased, while the expression of uPA mRNA was not increased in mercuric chloride-induced tubulointerstitial fibrosis in Brown Norway rats.38 Therefore, the expression of uPA system and mechanisms have different roles in fibrosis. The present study have shown that the uPA system was activated with different concentrations of heat-inactivated S. aureus in BMFBs. The dynamic change correlation of the MMPs and uPA system could

Z. Miao et al. contribute to ECM metabolism. In responses to S. aureusinduced bovine mammary fibrosis, we speculate that degradation of ECM by MMPs/TIMPs and uPA system may contribute to the development of bovine mammary damage, which thus subsequently leads to bovine mammary fibrosis. More interestingly, we identify that different concentrations of heat-inactivated S. aureus triggers cellular response and in the upregulation of uPA and MMPs in BMFBs. These findings may explain how S. aureus can induce bovine mammary fibrosis. Diverse studies have shown MMPs/TIMPs and uPA system as a potent target for the treatment of different diseases. Results from our recent study demonstrated the expression of MMPs/TIMPs were upregulated and uPA system was activated with different concentrations heat-inactivated S. aureus, which could contribute to ECM metabolism. That might be a potential mechanism underlying the contribution of MMPs/TIMPs and uPA system to bovine mammary gland fibrosis. Furthermore, subsequent studies will corroborates the modulation of MMPs/TIMPs and the uPA system, supporting the development of new bovine mammary gland fibrosis therapies based in MMPs/TIMPs and the uPA system treatment.

Declaration of Competing Interest The authors declared that they have no competing interests.

Acknowledgments This work was supported by the National Natural Science Foundation of China (31460642).

References 1. Turner NA. Inflammatory and fibrotic responses of cardiac fibroblasts to myocardial damage associated molecular patterns (DAMPs). J Mol Cell Cardiol 2016;94:189e200. 2. Andreotti CS, Pereyra EA, Baravalle C, Renna MS, Ortega HH, Calvinho LF, et al. Staphylococcus aureus chronic intramammary infection modifies protein expression of transforming growth factor beta (TGF-b) subfamily components during active involution. Res Vet Sci 2014;96(1):5e14. 3. Knittel T, Mehde M, Kobold D, Saile B, Dinter C, Ramadori G. Expression patterns of matrix metalloproteinases and their inhibitors in parenchymal and non-parenchymal cells of rat liver: regulation by TNF-a and TGF-b1. J Hepatol 1999;30(1): 48e60. 4. Wu J, Ding Y, Bi Y, Wang Y, Zhi Y, Wang J, et al. Staphylococcus aureus induces TGF-b1 and bFGF expression through the activation of AP-1 and NF-kB transcription factors in bovine mammary gland fibroblasts. Microb Pathog 2016;95:7. 5. Giannandrea M, Parks WC. Diverse functions of matrix metalloproteinases during fibrosis. Dis Model Mech 2014;7(2): 193e203. 6. Schilling O, Franzke C. Biological role of matrix metalloproteinases: a critical balance. Eur Respir J 2011;38(1): 191e208. 7. Gu J, Han CH, Hu FF, Wang YB, Cao YJ. The correlation analysis of human embryonic MMP-9 secretion and embryo quality. Eur Rev Med Pharmacol Sci 2015;19(13):2354e8.

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008

+

MODEL

MMPs/TIMPs and uPA system in bovine mammary fibroblasts 8. Pardo A, Selman M. Matrix metalloproteases in aberrant fibrotic tissue remodeling. Proc Am Thorac Soc 2006;3(4): 383e8. 9. Mira E. Secreted MMP9 promotes angiogenesis more efficiently than constitutive active MMP9 bound to the tumor cell surface. J Cell Sci 2004;117(9):1847e57. 10. Kanangat S, Postlethwaite A, Hasty K, Kang A, Smeltzer M, Appling W, et al. Induction of multiple matrix metalloproteinases in human dermal and synovial fibroblasts by Staphylococcus aureus: implications in the pathogenesis of septic arthritis and other soft tissue infections. Arthritis Res Ther 2006;8(6). R176-R176. 11. Pardo A, Cabrera S, Maldonado M, Selman M. Role of matrix metalloproteinases in the pathogenesis of idiopathic pulmonary fibrosis. Respir Res 2016;17(1):1e10. 12. Gondi CS, Lakka SS, Dinh DH, Olivero WC, Gujrati M, Rao JS. Downregulation of uPA, uPAR and MMP-9 using small, interfering, hairpin RNA (siRNA) inhibits glioma cell invasion, angiogenesis and tumor growth. Neuron Glia Biol 2004;1(2): 165. 13. Agata, Matejczyk M, Rosochacki S. Matrix metalloproteinases (MMPs), the main extracellular matrix (ECM) enzymes in collagen degradation, as a target for anticancer drugs. J Enzym Inhib Med Chem 2016:1e7. 14. Selman M, Ruiz V, Cabrera S, Segura L, Ramirez R, Barrios R, et al. TIMP-1, -2, -3, and -4 in idiopathic pulmonary fibrosis. A prevailing nondegradative lung microenvironment. Am J Physiol Lung Cell Mol Physiol 2000;279(3):L562. 15. Feng D, Gao B, Wang H, Lafdil F, Wang L, Yin S. Tissue inhibitor of metalloproteinase 1 (TIMP-1) deficiency exacerbates carbon tetrachloride-induced liver injury and fibrosis in mice: involvement of hepatocyte STAT3 in TIMP-1 production. Cell Biosci 2011;1(1). 14e14. 16. Han CK, Tien YC, Jine-Yuan Hsieh D, Ho TJ, Lai CH, Yeh YL, et al. Attenuation of the LPS-induced, ERK-mediated upregulation of fibrosis-related factors FGF-2, uPA, MMP-2, and MMP-9 by Carthamus tinctorius L in cardiomyoblasts. Environ Toxicol 2016;32(3):754e63. 17. Sela-Passwell N, Kikkeri R, Dym O, Rozenberg H, Sagi I. Antibodies targeting the catalytic zinc complex of activated matrix metalloproteinases show therapeutic potential. Nat Med 2011; 18(1):143e7. 18. Rengel Y, Ospelt C, Gay S. Proteinases in the joint: clinical relevance of proteinases in joint destruction. Arthritis Res Ther 2007;9(5):221. 19. Smith HW, Marshall CJ. Regulation of cell signaling by uPAR. Nat Rev Mol Cell Biol 2010;11(1):23e36. 20. Blasi F, Sidenius N. The urokinase receptor: focused cell surface proteolysis, cell adhesion and signaling. FEBS Lett 2010; 584(9):1923e30. 21. Flevaris P, Vaughan D. The role of plasminogen activator inhibitor type-1 in fibrosis. Semin Thromb Hemost 2016;43(02): 169e77. 22. Gunther A, Lubke N, Ermert M, Schermuly RT, Weissmann N, Breithecker A, et al. Prevention of bleomycin-induced lung fibrosis by aerosolization of heparin or urokinase in rabbits. Am J Respir Crit Care Med 2004;168(11):1358e65. 23. Sisson TH, Mendez M, Choi K, Subbotina N, Courey A, Cunningham A, et al. Targeted injury of type II alveolar

9

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

epithelial cells induces pulmonary fibrosis. Am J Respir Crit Care Med 2010;181(3):254e63. Botkjaer KA, Fogh S, Bekes EC, Chen Z, Andreasen PA. Targeting the autolysis loop of urokinase-type plasminogen activator with conformation-specific monoclonal antibodies. Biochem J 2011;438(1):39. Lund IK, Rasch MG, Signe I, Jesper P, Madsen DH, Engelholm LH, et al. Inhibitory monoclonal antibodies against mouse proteases raised in gene-deficient mice block proteolytic functions in vivo. Front Pharmacol 2012;3. Wang XQ, Bdeir K, Yarovoi S, Cines DB, Fang W, Abraham E. Involvement of the urokinase kringle domain in lipopolysaccharide induced acute lung injury. J Immunol 2006;177(8): 5550e7. Zhao H, Dong Y, Tian X, Tan TK, Liu Z, Zhao Y, et al. Matrix metalloproteinases contribute to kidney fibrosis in chronic kidney diseases. World J Nephrol 2013;2(3):84. Catania JM, Chen G, Parrish AR. Role of matrix metalloproteinases in renal pathophysiologies. Am J Physiol Renal Physiol 2007;292(3):F905. Nkyimbeng T, Ruppert C, Shiomi T, Dahal B, Lang G, Seeger W, et al. Pivotal role of matrix metalloproteinase 13 in extracellular matrix turnover in idiopathic pulmonary fibrosis. PLoS One 2013;8. Yamashita CM, Dolgonos L, Zemans RL, Young SK, Robertson J, Briones N, et al. Matrix Metalloproteinase 3 is a mediator of pulmonary fibrosis. Am J Pathol 2011;179(4):1733e45. Zhang M, Hu X, Li S, Lu C, Li J, Zong Y, et al. Hepatoprotective effects of ethyl pyruvate against CCl4-induced hepatic fibrosis via inhibition of TLR4/NF-kB signaling and up-regulation of MMPs/TIMPs ratio. Clin Res Hepatol Gastroenterol 2017;42(1): 72e81. Cheng YC, Chen LM, Chang MH, Chen WK, Tsai FJ, Tsai CH, et al. Lipopolysaccharide upregulates uPA, MMP-2 and MMP-9 via ERK1/2 signaling in H9c2 cardiomyoblast cells. Mol Cell Biochem 2009;325(1e2):15e23. Wang JE, Pettersen S, Stuestol JF, Wang YY, Foster SJ, Thiemermann C, et al. Peptidoglycan of S.aureus causes increased levers of matrix metalloproteinases in rat. Shock 2004;22(4):376e9. Suga M, Iyonaga K, Okamoto T, Gushima Y, Miyakawa H, Akaike T, et al. Characteristic elevation of matrix metalloproteinase activity in idiopathic interstitial pneumonias. Am J Respir Crit Care Med 2000;162(5):1949e56. Murthy S, Ryan A, He C, Mallampalli RK, Carter AB. Rac1mediated mitochondrial H2O2 generation regulates MMP-9 gene expression in macrophages via inhibition of SP-1 and AP-1. J Biol Chem 2010;285(32):25062e73. Kaviratne M, Hesse M, Leusink M, Cheever AW, Wynn TA. IL-13 activates a mechanism of tissue fibrosis that is completely TGF-b independent. J Immunol 2004;173(6):4020e9. Marudamuthu AS, Shetty SK, Bhandary YP, Karandashova S, Thompson M, Sathish V, et al. Plasminogen Activator Inhibitor1 suppresses profibrotic responses in fibroblasts from fibrotic lungs. J Biol Chem 2015;290(15):9428e41. Suzuki K, Nakayama H, Doi K. Kinetics of matrix metalloproteinases and their regulatory factors in mercuric chlorideinduced tubulointerstitial fibrosisin Brown Norway rats. Exp Toxicol Pathol 2001;53(5):337e44.

Please cite this article as: Miao Z et al., Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts, Journal of Microbiology, Immunology and Infection, https://doi.org/10.1016/j.jmii.2019.09.008