Transcriptome sequencing reveals fibrotic associated-genes involved in bovine mammary fibroblasts with Staphylococcus aureus

Journal Pre-proof Transcriptome sequencing reveals fibrotic associated-genes involved in bovine mammary fibroblasts with Staphylococcus aureus Zengqiang Miao (Conceptualization) (Data curation) (Formal analysis) (Methodology) (Project administration) (Writing - original draft) (Writing - review and editing), Yulin Ding (Funding acquisition) (Investigation) (Methodology), Nan Zhao (Data curation) (Formal analysis) (Software), Xunan Chen (Methodology) (Resources), Huixin Cheng (Writing - original draft), Jinling Wang (Validation) (Visualization), Yonghong Liu (Writing - review and editing), Fenglong Wang (Funding acquisition) (Investigation) (Methodology) (Project administration)

PII:

S1357-2725(20)30013-3

DOI:

https://doi.org/10.1016/j.biocel.2020.105696

Reference:

BC 105696

To appear in:

International Journal of Biochemistry and Cell Biology

Received Date:

31 October 2019

Revised Date:

15 January 2020

Accepted Date:

18 January 2020

Please cite this article as: Miao Z, Ding Y, Zhao N, Chen X, Cheng H, Wang J, Liu Y, Wang F, Transcriptome sequencing reveals fibrotic associated-genes involved in bovine mammary fibroblasts with Staphylococcus aureus, International Journal of Biochemistry and Cell Biology (2020), doi: https://doi.org/10.1016/j.biocel.2020.105696

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

Transcriptome sequencing reveals fibrotic associated-genes involved in bovine mammary fibroblasts with Staphylococcus aureus

ro of

Zengqiang Miao a, Yulin Ding a, Nan Zhao a, Xunan Chen a, Huixin Cheng a, Jinling Wang a, Yonghong Liu a, Fenglong Wang a,* a Inner Mongolia Agricultural University, Key Laboratory of Clinical Diagnosis and Treatment Technology in Animal Disease, Hohhot, 010018, Inner Mongolia, China; Corresponding author. E-mail addresses: [email protected] (Z. Miao), [email protected] (Y. Ding), [email protected] (N. Zhao), [email protected] (X. Chen), [email protected] (H. Cheng), [email protected] (J. Wang), [email protected] (Y. Liu), [email protected] (F. Wang)

na

Abstract

lP

re

-p

Graphical abstract

Bovine mammary fibrosis represents a considerable health problem of cows, primarily

ur

indicated by lactation failure. Staphylococcus aureus (S. aureus) can cause mammary

Jo

damage, this multifactorial disease necessitates to identify how and to what extent molecular pathogen defense mechanisms prevent bacterial infections in bovine mammary gland. In this study, we have aimed to determine the transcriptional responses in bovine mammary fibroblasts (BMFBs) induced by S. aureus using bioinformatics analysis to determine whether mRNA expression profile changes between BMFBs activation and 1

quiescence. Established primary BMFBs obtained from healthy Holstein bovine were induced 106 CFU/mL heat-inactivated S. aureus and total RNA was isolated 6 h after treatment. When BMFBs were induced with S. aureus for 6 h, 7712 differentially expressed genes (DEGs) were identified; of which, 3635 were up- and 4077 down-regulated (DESeq2 padj<0.05). The 574 DEGs were involved in gene ontology (GO) that were

ro of

immune response, apoptotic process, extracellular region, receptor binding,

endopeptidase activity and protein kinase activity et al. The Kyoto Encyclopedia of

Genes and Genomes (KEGG) analyses, distinct pathway contained signaling molecules

-p

common to various inflammatory and fibrotic pathways were Pathways in cancer,

re

Cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, TNF signaling pathway, MAPK signaling pathway and Toll-like receptor signaling pathway. We

lP

further validated 11 genes using RT-qPCR, and found a strong correlation between the

na

RNA-Seq and qPCR results. The BMFBs was treated with heat-inactivated S. aureus (106 CFU/mL) and also with pharmacological inhibitors of ERK1/2, P38 MAPK and

ur

JNK. The MMP-2 activity were examined gelatin zymography, MMP-2, TIMP-1, -2 and PLAU/PAI-1 protein expression were examined in vitro by western blot. The

Jo

MMP-2 activity was significantly inhibited by simultaneous inhibition of ERK1/2, P38 MAPK and JNK, and MMP-2, TIMP-1,-2 and PLAU/PAI-1 protein expression were significantly decreased by inhibiting ERK1/2, P38 MAPK or JNK. This suggested a crosstalk between the ERK1/2, P38 MAPK or JNK signaling pathways in regulating extracellular matrix metabolism in the BMFBs with S. aureus. 2

Our study complement our initial study on S. aureus-induced responses by fibrosisassociated genes in BMFBs. This may lead to development of novel therapeutic targets to control bovine mammary fibrosis induced by S. aureus.

Keywords: BMFBs; S. aureus; RNA-Seq; fibrosis; genes.

ro of

1. Introduction Staphylococcus aureus (S. aureus) is the causative agent of mastitis in bovine, and

can cause huge economic losses in bovine production(Kosciuczuk et al., 2017).

-p

Therefore, as one of the most important bacterial pathogens in mastitis, controlling

infection caused by S. aureus is crucial. Under a persistent infection, bovine mammary

re

was damaged develop into mammary fibrosis characterized by fibroblast proliferation

lP

and extracellular matrix (ECM) deposition(Buckley, 2011). To date, although some profibrosis factors have been found and confirmed, the pathogenesis of S. aureus-induced

na

bovine mammary fibrosis has not been resolved in detail. In addition, continuous efforts have been made in pulmonary fibrosis using genomics

ur

and transcriptomics analysis. And studies indicated that the development of idiopathic

Jo

pulmonary fibrosis (IPF) was associated with abnormal cell interactions, perturbed cytokine signaling and dysregulated DNA repair(Kusko et al., 2012). Previous reports have shown that S. aureus can cause mammary damage and inflammation, related cell factors may play important roles in the infection process of S. aureus(Wu et al., 2016). During bacterial adhesion and invasion, pathogenesis infection is a complex process, no treatment has yet been shown to convincingly target and prevent S. aureus3

associated mammary fibrosis, so the mechanism of fibrosis needs to be studied further. Recent studies have revealed that several hundred differentially expressed genes (DEGs) in response to an infection by Streptococcus uberis (S. uberis), including a large number of immune-related genes. Challenging epithelial cells with S. aureus and Escherichia coli (E. coli) resulted in an increase in the majority of genes associated with the immune system measured(Swanson et al., 2009). Lutzow et al. found that two

ro of

main groups of DEGs were identified in the bovine mammary gland in response to

infection by S. aureus. The DEGs involved in intracellular signaling, primarily cytokines and chemokines, ECM proteins, apoptosis, cellular cytoskeleton proteins and

-p

intracellular signaling proteins(Lutzow et al., 2008). Transcriptome profiling of

re

Staphylococci-infected cow mammary gland parenchyma results showed that 1700 and 2200 DEGs were identified in 1st or 2nd lactation and the 3rd or 4th lactations,

lP

respectively. Moreover, the following genes that belong to NOD-like receptor signaling

na

pathway, chemokine signaling pathway, antigen processing and presentation pathway, and cell adhesion molecules pathway(Kosciuczuk et al., 2017). The study of specific

ur

gene expression associated with Staphylococcus aureus mastitis of Canadian Holstein cows found that 22 genes were differentially displayed in blood mononuclear cells

Jo

(BMCs) and 16 genes in milk somatic cells (MSCs) of cows, and are known to reflect novel pathways or genes involved in progressive bovine mammary gland disease(Tao and Mallard, 2007). Moreover, Mitterhuemer S et al. found that mammary tissue inoculated with E. coli, 18 h post infection 2154 DEGs were found in infected animals, enhanced expression of antimicrobial genes, acute phase genes and indicators of 4

oxidative stress(Mitterhuemer et al., 2010). We previously discovered that the expression of fibrosis-associated genes were up-regulated in S. aureus-induced BMFBs, however, S. aureus infection induces transcriptome responses without theoretical basis in BMFBs. Although a great deal of information has shown that the use of the mammary epithelial cells (MECs) model to identify how and to what extent molecular pathogen

ro of

defense mechanisms(Gilbert et al., 2013; Pareek et al., 2005), however, BMFBs are the main stromal cells in mammary tissue, which play a role for the secretion of various

cytokines in particular. Based on S. aureus induces TGF-β1 and bFGF expression

-p

through the activation of AP-1 and NF-κB in BMFBs(Wu et al., 2016). Following these

re

initial studies, we pay close attention to MMPs/TIMPs and PLAU system, subsequently deemed it necessary to investigate the mechanisms of the specific function of the

lP

MMPs/TIMPs and PLAU system as well as S. aureus-induced BMFBs pathogenic

na

mechanisms. Thus, in the present study, we performed transcriptome profiling of 106 CFU/mL heat-inactivated S. aureus-induced BMFBs to determine possible pathogenic

ur

mechanisms and analyze the host cell responses. Our findings will help us to understand better the mechanism of bovine mammary damage induced by S. aureus, which could

Jo

provide new targets to prevent infection and provide a test basis for the research of mammary fibrosis. 2. Materials and methods 2.1. Cell Culture

5

BMFBs were isolated from the healthy Holstein bovine (Samples were obtained from a slaughterhouse in Hohhot and were ‘discard’ samples.) and cryopreserved in liquid nitrogen(Wu et al., 2016). The cells were cultured in DMEM/F12 (Gibco, NY, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (ExCell Biolog, Shanghai, China), 1% antibiotics/antimycotics and 1% glutamine. Cells were cultivated on 25 cm3 plastic culture flasks in a humidified atmosphere with 5% CO2 at 37°C. Cells

ro of

were used passages seven, grown to 80-100% confluency. Before stimulation, media

were changed to serum-free DMEM/F12 at least 24 hours. Then, the supernatant of the

cell solution was discarded, and the cells were washed twice with pre-cooled PBS, with

-p

or without 106 CFU/mL heat-inactivated S. aureus (Liu, 2005) induced cells 6 h for

re

RNA extraction.

lP

2.2. Sample Collection and total RNA extraction

After incubation for 6 h, cell culture supernatant was collected and 1ml Trizol

na

(InvitroGen, Carlsbad, CA, USA) was added into each 6-well cell culture plates, and was repeatedly blown and transferred to a 1.5 ml centrifuge tube for quick freezing.

ur

RNA was extracted from the S. aureus-induced and control quarters of the same 3 at 6

Jo

h. RNA quantification was checked using the NanoPhotometer® spectrophotometer (IMPLEN, CA, USA). RNA concentration was measured using Qubit® RNA Assay Kit in Qubit® 2.0 Flurometer (Life Technologies, CA, USA). RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA) with a RNA Integrity Number (RIN) value > 7.0.

6

2.3. Library preparation for Transcriptome sequencing In the present study, a total amount of 3µg RNA per sample was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample. In order to select cDNA fragments of preferentially 250~300 bp in length,

ro of

the library fragments were purified with AMPure XP system (Beckman Coulter,

Beverly, USA). Then 3µl USER Enzyme (NEB, USA) was used with size-selected,

-p

adaptor-ligated cDNA at 37°C for 15min followed by 5min at 95°C before PCR. Then

PCR was performed with Phusion High-Fidelity DNA polymerase. At last, PCR

lP

Agilent Bioanalyzer 2100 system.

re

products were purified (AMPure XP system) and library quality was assessed on the

2.4. Differential expression analysis

na

Differential expression analysis of two conditions/groups (three biological replicates per condition) was performed using the DESeq2 R package (1.16.1). The resulting P-

ur

values were adjusted using the Benjamini and Hochberg’s approach for controlling the

Jo

false discovery rate. Genes with an adjusted P-value < 0.05 found by DESeq2 were assigned as differentially expressed. 2.5. Gene Ontology and KEGG enrichment analysis To reveal novel genes and pathways involved in BMFBs with S. aureus between the regulated transcripts, a network and pathway analysis of the GO and KEGG 7

(http://www.genome.jp/kegg/) enrichment analysis. GO terms with adjusted P-value < 0.05 were considered significantly enriched by differential expressed genes. We used cluster Profiler R package to test the statistical enrichment of differential expression genes in KEGG pathways. 2.6. RT-PCR analysis

ro of

Total RNA (500 ng) was reverse transcribed with SuperScript® III Transcriptase (Life Technologies) according to the manufacturer’s instructions. The diluted sample cDNA in the real time reaction to determine quantities of RNA expression according to

-p

the standard protocol provided with the TB® Green protocol (TaKaRa BIO INC) in a 20 μl reaction. All primer sequences (Table 1) used in this study were designed and

re

synthesized by Sangon Biotech (Shanghai, China) using publicly available bovine

lP

sequences.

na

2.7. Gelatin zymaography assays

Gelatin zymography of conditioned medium was used to observe the levels of MMP-

ur

2 produced by BMFBs treated with S. aureus and/or MAPK inhibitors (PD98059 50 µM, SB203580 20 µM, SP600125 20 µM). Gelatinolytic activity was determined using

Jo

the MMP Zymography Assay Kit (Xinfan Bio-Tech CO., Ltd) following the manufacturer’s instructions. Each independent experiment was performed in triplicate. 2.8. Western blotting Cells were lysed in a Triton lysis buffer (Sangon Biotech) for 15 minutes at 4°C. 20 µg of samples were fractionated by SDS-PAGE according to standard protocols 8

(Beijing Solarbio Science ＆ Technology Co., Ltd). The primary antibodies were used: MMP-2 (1:500), TIMP-1 (1:500), TIMP-2 (1:500), PLAU (1:500), PAI-1 (1:500) (ProteinTech Group), ERK1/2 (1: 1000), phospho-ERK1/2 (1: 1000), P38 MAPK (1:1000), phospho-P38 MAPK (1:1000), JNK (1: 1000), phospho-JNK (1:1000) (Affinity Biosciences), and β-actin (1:10000) (Abcam). Immunoreactive signals were detected with a secondary antibody (Beyotime Biotech) and reacted with ECL plus

ro of

reagent (Thermo Scientific). 2.9. Statistical analysis

-p

In this study, 3 commonly used reference genes (ACTB, GAPDH, UXT) were

analyzed by qPCR (Bougarn et al., 2011). Western blot band quantifications were

re

performed with Image J and GraphPad Prism 5. The statistical analysis was performed

lP

using the student’s t-test to calculate statistically significant differences which was used SPSS 22 and GraphPad Prism 5. Statistically significant differences were expressed as

ur

3. Results

na

*p < 0.05; **p< 0.01; ***p<0.001.

Jo

3.1. Quantification of gene expression levels According to the similar progress of the sample gene expression profile, cluster

analysis was carried out to show the expression of the genes in different treatment groups, and obtain the relevant biological information. Gene expression was shown in different groups (Fig. 1). The changes of expression levels between the treatment (T_STA) and control (C_STA) group were determined according to the color depth in 9

the figure. 3.2. Identification of DEGs To better investigate the regulatory mechanism of S. aureus-induced bovine mammary gland fibrosis, it is important to identify the differentially expressed genes of S. aureus-induced BMFBs. The reaction of BMFBs to S. aureus was investigated to

ro of

evaluate the differential expression patterns of genes associated with S. aureus-induced BMFBs at 6 h post-exposure. A significant change in expression between the T_STA and C_STA group was identified, the DESeq2 R package (1.16.1) was used to perform

-p

a differential gene expression analysis and the P values were adjusted by the Benjamini

and Hochberg’s approach. Under the restrictive threshold conditions of adjusted P <

re

0.05. The distribution of the DEGs is shown in a volcano plot (Fig 2). We observe up-

lP

regulation of MMP-2, MMP-11, MMP-14, MMP-19 and MMP-24. Conversely, thought MMP-16 and MMP-17 expressed in normal tissues and participate in tissue

na

homeostasis, were down-regulated in infected cells. In addition to, we find differential expression of fifteen members of the ADAM (A Disintegrin And Metalloproteinase)

ur

and ADAMTS (A Disintegrin And Metalloproteinase with ThromboSpondin motifs)

Jo

that are previously unreported in the context of S. aureus-induced BMFBs. ADAM12, ADAM19 and ADAMTS14 are down-regulated, whereas ADAM33, ADAMTS3, ADAMTS5, ADAMTS6, ADAMTS10 and ADAMTS20 are up-regulated. Remarkably, the collagen superfamily are differentially expressed in our data, indicating that collagen deposition processes are initiated very early in infection rather than as a late consequence of disease progression. COL1A1, COL3A1, COL4A5, 10

COL4A6, COL5A2, COL5A3, COL7A1 and COL17A1 are all up-regulated with 106 CFU/mL heat-inactivated S. aureus-induced BMFBs, while COL4A1, COL4A2, COL5A1, COL6A2, COL13A1, COL15A1, COL16A1, COL21A1 and COL25A1 are all down-regulated. These results demonstrated that different genes played a different biological role in the 106 CFU/mL heat-inactivated S. aureus-induced BMFBs.

ro of

3.3. GO enrichment analysis of DEGs GO enrichment analysis was implemented to assign DEGs to different functional

categories biological process (BP), molecular function (MF), and cellular component

-p

(CC). GO terms with adjusted P < 0.05 were considered significantly enriched, the most differentially expressed genes were distributed in categories related to different

re

biological processes (Fig 3). 574 DEGs significantly enriched GO categories mainly

lP

involved immune response, apoptotic process, extracellular region, receptor binding, endopeptidase activity and protein kinase activity. For the most highly up- and down

na

regulated genes at 6 h of incubation with S. aureus, a few indications can be drawn DEGs were categorized into 68 functional groups with GO classification (adjusted P

ur

<0.05) (Fig 3). As for fibrosis responses, DEGs were involved in “extracellular matrix

Jo

structural constituent” (GO: 0005201), “extracellular region part” (GO: 0044421), “extracellular matrix” (GO: 0031012), “peptidase activity” (GO: 0008233) and “metalloendopeptidase activity” (GO: 0004222), respectively (table 2). In addition, TIMP-1 and TIMP-2 were reported to be associated with the category of “enzyme inhibitor activity” (GO: 0004857). Moreover, PLAU and PLAUR were reported to be associated with the category of “endopeptidase activity” (GO: 0004175). Based on 11

these observations, in the bovine mammary fibrosis, the DEGs in different functional categories may provide valuable information for future evaluations of ECM degradation. 3.4. KEGG enrichment analysis of DEGs In addition, pathway‐based analysis was conducted using the KEGG orthology based annotation system to identify the statistical enrichments of DEGs. Among these

ro of

categories, the most significantly enriched pathway was “Pathways in cancer” (bta05200) encompassing 97 DEGs (adjusted P < 0.05). Other significantly enriched

pathways included “Cytokine-cytokine receptor interaction” (bta04060), “PI3K-Akt signaling pathway” (bta04151), “Toll-like receptor signaling pathway” (bta04620) and

-p

“MAPK signaling pathway” (bta0401) (adjusted P < 0.05). While “TNF signaling

pathway” (bta04668) is tightly associated with cytokine–receptor interactions, this

re

pathway was also reported to be significantly enriched involving 54 DEGs (adjusted P < 0.05) (table 3). These annotations may enhance a broader understanding of gene

lP

transcriptions in bovine mammary fibrotic pathways. Based on the KEGG pathway analysis, we may be interested in the enriched “Toll-like receptor signaling pathway”

na

and downstream “MAPK signaling pathway” and “TNF signaling pathway” (Figure 4). In addition, BMFBs with heat-inactivated S. aureus genes involved in inflammatory

ur

response signaling pathways such as “IL-17 signaling pathway” (bta04657), “NOD-

Jo

like receptor signaling pathway” (bta04621) were also significantly up-regulated, and at 6 h with 106 CFU/mL heat-inactivated S. aureus genes regulating cell growth, autophagy, proliferation, apoptosis and cell death were significantly up-regulated. 3.5. Validation by RT-qPCR To validate RNA-Seq expression levels of fibrosis genes, we selected eleven DEGs

12

(MMP-2, TIMP-1, TIMP-2, PLAU, PLAUR, COL1A1, BMP2, TLR2, TLR5, NOD2, HGF) with adjusted P-value < 0.05. The results showed that, mRNAs expression levels were significant difference compared with the control group. A strong correlation was found between RNA-Seq and RT-qPCR at 6h (Fig 5). 3.6. S. aureus induces MAPKs phosphorylation in the BMFBs To explore the role of MAPK pathways in inducing MMPs/TIMPs and PLAU/PAI-

ro of

1 mechanism, we tested whether S. aureus is able to induce phosphorylation of ERK1/2, P38 MAPK and JNK. BMFBs treated with 106 CFU/mL heat-inactivated S. aureus for

24 h and the levels of ERK1/2/p-ERK1/2, P38 MAPK/p-P38 MAPK and JNK/p-JNK

-p

were analyzed by Western Blotting. As shown in Figure 6A, western blot analysis p-

re

ERK1, total ERK1/2, p-P38 MAPK, total P38 MAPK, p-JNK, and total JNK. The heatinactivated S. aureus induced a significant phosphorylation of ERK1/2 (p < 0.001),

lP

whereas JNK phosphorylation (p < 0.05) was downregulated at 24h, P38 MAPK

6B, 6C, 6D).

na

phosphorylation (p > 0.05)was slightly upregulated by heat-inactivated S. aureus (Fig

ur

2.7. Gelatin zymography analysis of metalloproteinase activity and effect of administration of MAPK inhibitors in the BMFBs model

Jo

Previously cells were pretreated with different concentrations PD98059, SB203680

or SP600125 (1 µM, 5 µM, 10 µM, 20 µM, 50 µM), we performed 106 CFU/mL heatinactivated S. aureus stimulation for periods of times corresponding to the activation of each MAPK (data not presented). After the BMFBs were pretreated with MAPK inhibitors (PD98059 50 µM, SB203580 20 µM, SP600125 20 µM) for 1 h and then 13

stimulated with 106 CFU/mL heat-inactivated S. aureus for 24 h, conditioned media were collected for determining the MMP-2 activity by using gelatin zymography and the results are shown in Figure 7. The results indicated that the 106 CFU/mL S. aureus treatment for 24 h slightly increased the MMP-2 activity rather than MMP-9. There was a significant decline in the activity of MMP-2 in MAPK inhibitors (e.g. S. aureus +

and these effects are also manifested in its crosstalk.

ro of

PD98059, p < 0.01; S. aureus + SB203580, p < 0.001; S. aureus + SP600125, p < 0.001)

2.8. MAPK inhibition blocked MMP-2, TIMP-1/-2 and PLAU/PAI-1 protein levels

The above results indicated that MAPK pathways were involved in the heat-

-p

inactivated S. aureus-mediated regulation of MMP-2 activity. Therefore, we

re

investigated whether these MAPKs could crosstalk in BMFBs upon activation by S. aureus. To this end, BMFBs were pretreated with MAPK inhibitors for 1 h and then

lP

stimulated with 106 CFU/mL heat-inactivated S. aureus. By Western blotting, we found

na

that the MAPK inhibitors not only blocked the S. aureus-mediated induction of MMP2 protein level, but also significantly decreased TIMP-1 and TIMP-2 protein levels.

ur

ERK1/2 inhibition (p < 0.05) not only blocked the S. aureus-mediated upregulation of MMP-2 protein production, but also ERK1/2/P38 MAPK (p < 0.01) and P38

Jo

MAPK/JNK (p < 0.01) inhibition significantly decreased MMP-2 protein expression (Fig 8A). As shown in Figure 8B, 8C, there was a significant decline TIMP-1,-2 protein levels in MAPK inhibitors and these effects are also manifested in its crosstalk. In addition, the MAPK inhibitors significantly decreased the amount of PLAU protein levels following heat-inactivated S. aureus treatment, all of these inhibitors were able 14

to significantly block (p < 0.001) the S. aureus-induced PLAU protein level (Fig 8D). Interestingly, we found that the MAPK inhibitors (PD98059, SB203580 and SP600125 respectively) did not affect the S. aureus-mediated induction of PAI-1 protein level (Fig 8E), inhibiting more than one signal transduction molecule significantly reduced PAI1 expression (e.g. ERK1/2 + JNK, p < 0.05; P38 + JNK, p < 0.001; ERK1/2 + P38 + JNK, p < 0.001). These results suggest that MAPK signal transduction molecules

ro of

activity is essential for the modulation of MMP-2, TIMP-1/-2 and PLAU/PAI-1 expression by S. aureus.

-p

4. Discussion

Although a great deal of information has shown that common features of fibrosis

re

across different tissues. For example, fibroblasts not only display heterogeneous

lP

phenotypes within single organs (kidney), they also differ among organs (heart, intestine, liver, lung, and skin)(Berg et al., 2019; Grupp et al., 1997). Fibroblasts may

na

be exhibited similar molecular characteristics in liver, lung, or kidney fibrosis, which suggested that organ-specific mechanisms associated with tissue fibrosis may be

ur

fundamental and conserved pathogenic pathways may be common(Zeisberg and Kalluri,

Jo

2013). Despite multiple efforts to assess the fibrosis-associated gene expression in several distinct organs, no approved anti-fibrotic therapies have been discovered and no reliable markers of clinical utility have been identified and to date. In this study, 106 CFU/mL heat-inactivated S. aureus-induced BMFBs was investigated through RNASeq at 6 h post-exposure in order to gain insight into novel genes and pathways, likely to contribute to the development of new therapeutic approaches. 15

It is known that gram-positive bacteria (S. aureus) express secreted proteins (protein A and α-hemolysins) and cell wall components (peptidoglycan and lipoteichoic acid (LTA)), which have been shown to be inflammatory(Fournier and Philpott, 2005). The intramammary infection by S. aureus is often less severe but results in a chronic infection for an animal(Gunther et al., 2011). Several studies have showed that bovine mammary epithelial cells (bMEC) are poised to respond quickly to bacterial intrusion

ro of

through the activation of several evolutionary conserved pattern recognition receptors

(PRR) by recognition of pathogen-associated molecular patterns (PAMPs)(Aderem and Ulevitch, 2000; Goldammer et al., 2004; Porcherie et al., 2012; Yang et al., 2008). For

-p

example, TLR4 recognizes LPS from gram-negative bacteria (e.g. E. coli), whereas

re

TLR2 recognizes cell wall components of gram-positive bacteria (e.g. S. aureus)(Hirschfeld et al., 2000). TLR2 and TLR4 gene most significantly expressed by

lP

bMEC stimulated by S. aureus and E. coli for 3 and 6 h compared to unstimulated cells,

na

which represented immune defense response(Gilbert et al., 2013). In our study, TLR2, TLR4 and TLR5 mRNA expression was shown to be higher in BMFBs after inoculation

ur

with 106 CFU/mL heat-inactivated S. aureus than in the non-inoculated BMFBs. In our RNA-Seq data, many ECM moieties are differentially expressed, including

Jo

MMPs, TIMPs, numerous collagens and several fibrosis-associated molecules. Except for epithelial cells and immune cells, fibroblasts also produce molecules that remodel the ECM, notably the zinc-dependent MMPs(Berg et al., 2019; Craig et al., 2015; Krenkel et al., 2019; Murphy and Nagase, 2008; Visse and Nagase, 2003; Wen and Cai, 2014). TLR2/TLR4 are expressed in Human umbilical vein endothelial cells (HUVEC) 16

infected with viable microorganisms and heat-killed bacteria. In addition, the cells preincubated with TLR2/TLR4 neutralizing antibodies showed a decrease in C. pneumoniae-induced MMP-9 production, which suggesting that the dependency of MMPs regulation on the stimulation of TLRs(Paolillo et al., 2012). In our study, numerous MMPs and TLR2/TLR4 were identified in heat-inactivated S. aureus infected BMFBs. Furthermore, Merkle M et al. found that a selectively TLR3 mediated,

ro of

MMP-9 and TIMP-1 represented time- and dose-dependent upregulation(Merkle et al.,

2010). Similarly, upregulation of MMP-2 and TIMP-1 and -2 is found in heatinactivated S. aureus infected BMFBs. It remains to be elucidated whether the

-p

dependency of MMPs/TIMPs regulation on the stimulation of an integral component

re

of the innate immune system (TLRs).

Remarkably, transcription of numerous collagens are evident as early as 6 h with

lP

heat-inactivated S. aureus infected BMFBs. COL1A1, COL3A1 and COL5A3 (fibril-

na

forming collagens) are all up-regulated, while The type IV collagens COL4A1 and COL4A2 (network-forming collagens), COL15A1 (multiplexin collagens), containing

ur

multiple collagenous domains interrupted by non-collagenous domains, COL16A1 (fibril-associated collagens), and COL25A1 (membrane-associated collagens) are all

Jo

down-regulated(Ricard-Blum, 2011). Fibril-forming collagens I, II, and III are cleaved by MMP-1 and MMP-14, collagen II is a preferential substrate of MMP-13. MMP-2 is also able to cleave collagen I and collagen IV(Klein and Bischoff, 2011; Zheng and Chen, 2017). Several other ECM components are differentially regulated at 6 h, these dramatic early expression changes of numerous ECM moieties may underlie bovine 17

mammary fibrosis. Furthermore, according to KEGG pathway enrichment analysis, we found that the DEGs were mainly enriched in several related pathways including MAPKs signaling pathway. In our previous study the expression of MMPs/TIMPs were upregulated and uPA system was activated with different concentrations heat-inactivated S. aureus (Miao et al., 2019), the present study showed that heat-inactivated S. aureus induced a

ro of

significant phosphorylation of ERK1/2, whereas JNK phosphorylation was downregulated at 24h. P38 MAPK phosphorylation was slightly upregulated by heatinactivated S. aureus, it may be due to the incubation time is not sufficient to induce the

-p

phosphorylation of P38. Gomes LR et al. have reported that TGF-β1 could be a

re

common regulator for MMPs and TIMPs through p38 MAPK and ERK1/2 in human breast cancer cell models(Gomes et al., 2012). MMP activation correlated with

lP

increased degradation of elastin, laminin and type IV collagen and is mediated by p38

na

MAPK in part(Dodd et al., 2011). Another study demonstrated that collagen degradation and MMP activation via activation of MAPK/AP-1 signaling pathway in

ur

ultraviolet B-induced skin fibroblasts(Han et al., 2019). Interestingly, the p38 MAPK signaling pathway was activated after NODs activation(Wang et al., 2015). Several

Jo

studies have indicated that collagens, MMPs, TIMPs, NODs and MAPKs were mutually promotion and activation. Similarly, our results demonstrated that a significant decline in the activity of MMP-2 in MAPK inhibitors, and inhibition of ERK, P38 and JNK by specific inhibitor markedly blocked the S. aureus-mediated induction of MMP-2, TIMP-1 and TIMP-2 expression, and these effects are also manifested in its 18

crosstalk. More interestingly, we identify that different concentrations of heat-inactivated S. aureus triggers cellular response and in the activation of PLAU/PAI-1 in BMFBs. The inhibition of PLAU-mediated conversion of plasminogen to plasmin attenuates fibrinolysis, but also diminishes MMP activation. PLAU/PAI-1/plasmin/MMP system in collagen metabolism may play a principal role(Visse and Nagase, 2003). In IPF

ro of

patients, PLAU elicits fibrogenic activity via binding PAI-1 also contributes to

pulmonary fibrosis (Marudamuthu et al., 2015). In the study of myocardial fibrosis, LPS induced upregulation of fibrosis-related factors PLAU and MMP-2 through

-p

ERK1/2 signaling pathway in cardiomyoblasts (Han et al., 2017). Vayalil P K et al

re

(Vayalil et al., 2007) reported that TGF-beta induced PAI-1 expression by P38 and JNK MAPK in murine embryonic fibroblasts. We found that the MAPK inhibitors

lP

significantly decreased the amount of PLAU protein following heat-inactivated S.

na

aureus treatment, and inhibiting more than one signal transduction molecule significantly reduced PAI-1 expression in BMFBs. Transcription profiling illustrated

ur

that MAPKs signaling pathway was one of the most enriched pathways in that most of the DEGs (MMP-2, TIMP-1, TIMP-2, PLAU, PAI-1, COL1A1, TLR2 and NOD2)

Jo

related to the fibrosis participated in this pathway. Thus, we speculate that activation of MAPKs signaling pathway might be one of major factors causing MMPs activation and ECM proteins secretion in the heat-inactivated S. aureus-induced BMFBs. 5. Conclusion In summary, we have identified a fibrosis gene in the heat-inactivated S. aureus19

induced BMFBs. We have further mapped the DEGs to distinct processes linked to extracellular matrix proteins, oncogene expression, inflammatory cytokines, and immune mediators. Our RNA-Seq study emphasize the importance of the candidate pathway involving MAPKs, provide new insights into the host cell responses driving the fibrotic process. It contributes valuable information for potential novel therapeutic targets that could be used to develop new anti-fibrotic treatments as well as biomarkers

ro of

of disease severity in bovine mammary fibrosis and other tissues.

Credit author statement

Zengqiang Miao: Conceptualization, Data curation, Formal analysis, Methodology,

-p

Project administration, Roles/Writing-original draft, Writing-review & editing. Yulin Ding: Funding acquisition, Investigation, Methodology. Nan Zhao: Data curation,

re

Formal analysis, Software. Xunan Chen: Methodology, Resources. Huixin Cheng: Roles/Writing-original draft. Jinling Wang: Validation, Visualization.

Yonghong

lP

Liu: Writing-review & editing. Fenglong Wang: Funding acquisition, Investigation,

na

Methodology, Project administration.

Declaration of Competing Interest

ur

The authors declare no conflict of interest.

Jo

Acknowledgments

We are deeply grateful to our team for participating in this study. This study was

supported by the National Natural Science Foundation of China (31460642). The authors thank facilities at the Laboratory of Clinical Diagnosis and Treatment Technology in Animal Disease, especially acknowledges Novogene (China) for

20

bioinformatics advice.

References

Jo

ur

na

lP

re

-p

ro of

Aderem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of the innate immune response. Nature 406(6797), 782-787. Berg, G., Barchuk, M., Miksztowicz, V., 2019. Behavior of Metalloproteinases in Adipose Tissue, Liver and Arterial Wall: An Update of Extracellular Matrix Remodeling. Cells 8(2). Bougarn, S., Cunha, P., Gilbert, F.B., Meurens, F., Rainard, P., 2011. Technical note: Validation of candidate reference genes for normalization of quantitative PCR in bovine mammary epithelial cells responding to inflammatory stimuli. Journal of dairy science 94(5), 2425-2430. Buckley, C.D., 2011. Why does chronic inflammation persist: An unexpected role for fibroblasts. Immunology letters 138(1), 12-14. Craig, V.J., Zhang, L., Hagood, J.S., Owen, C.A., 2015. Matrix metalloproteinases as therapeutic targets for idiopathic pulmonary fibrosis. Am J Respir Cell Mol Biol 53(5), 585-600. Dodd, T., Jadhav, R., Wiggins, L., Stewart, J., Smith, E., Russell, J.C., Rocic, P., 2011. MMPs 2 and 9 are essential for coronary collateral growth and are prominently regulated by p38 MAPK. J Mol Cell Cardiol 51(6), 1015-1025. Fournier, B., Philpott, D.J., 2005. Recognition of Staphylococcus aureus by the innate immune system. Clinical microbiology reviews 18(3), 521-540. Gilbert, F.B., Cunha, P., Jensen, K., Glass, E.J., Foucras, G., Robert-Granie, C., Rupp, R., Rainard, P., 2013. Differential response of bovine mammary epithelial cells to Staphylococcus aureus or Escherichia coli agonists of the innate immune system. Veterinary research 44, 40. Goldammer, T., Zerbe, H., Molenaar, A., Schuberth, H.J., Brunner, R.M., Kata, S.R., Seyfert, H.M., 2004. Mastitis increases mammary mRNA abundance of beta-defensin 5, toll-like-receptor 2 (TLR2), and TLR4 but not TLR9 in cattle. Clinical and diagnostic laboratory immunology 11(1), 174-185. Gomes, L.R., Terra, L.F., Wailemann, R.A., Labriola, L., Sogayar, M.C., 2012. TGFbeta1 modulates the homeostasis between MMPs and MMP inhibitors through p38 MAPK and ERK1/2 in highly invasive breast cancer cells. BMC Cancer 12, 26. Grupp, C., Lottermoser, J., Cohen, D.I., Begher, M., Franz, H.E., Muller, G.A., 1997. Transformation of rat inner medullary fibroblasts to myofibroblasts in vitro. Kidney Int 52(5), 1279-1290. Gunther, J., Esch, K., Poschadel, N., Petzl, W., Zerbe, H., Mitterhuemer, S., Blum, H., Seyfert, H.M., 2011. Comparative kinetics of Escherichia coli- and Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits a delayed response dominated by interleukin-6 (IL6) but not by IL-1A or tumor necrosis factor alpha. Infect Immun 79(2), 695-707. 21

Jo

ur

na

lP

re

-p

ro of

Han, C.K., Tien, Y.C., Jine-Yuan Hsieh, D., Ho, T.J., Lai, C.H., Yeh, Y.L., Hsuan Day, C., Shen, C.Y., Hsu, H.H., Lin, J.Y., Huang, C.Y., 2017. Attenuation of the LPS-induced, ERK-mediated upregulation of fibrosis-related factors FGF-2, uPA, MMP-2, and MMP-9 by Carthamus tinctorius L in cardiomyoblasts. Environ Toxicol 32(3), 754-763. Han, H.S., Shin, J.S., Myung, D.B., Ahn, H.S., Lee, S.H., Kim, H.J., Lee, K.T., 2019. Hydrangea serrata (Thunb.) Ser. Extract Attenuate UVB-Induced Photoaging through MAPK/AP-1 Inactivation in Human Skin Fibroblasts and Hairless Mice. Nutrients 11(3). Hirschfeld, M., Ma, Y., Weis, J.H., Vogel, S.N., Weis, J.J., 2000. Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine toll-like receptor 2. Journal of immunology 165(2), 618-622. Klein, T., Bischoff, R., 2011. Physiology and pathophysiology of matrix metalloproteases. Amino acids 41(2), 271-290. Kosciuczuk, E.M., Lisowski, P., Jarczak, J., Majewska, A., Rzewuska, M., Zwierzchowski, L., Bagnicka, E., 2017. Transcriptome profiling of Staphylococciinfected cow mammary gland parenchyma. BMC veterinary research 13(1), 161. Krenkel, O., Hundertmark, J., Ritz, T.P., Weiskirchen, R., Tacke, F., 2019. Single Cell RNA Sequencing Identifies Subsets of Hepatic Stellate Cells and Myofibroblasts in Liver Fibrosis. Cells 8(5). Kusko, R.L., John Brothers, I.I., Liu, G., 2012. Comprehensive genomic profiling of the lung transcriptome in emphysema and idiopathic pulmonary fibrosis using RNASeq. BMC proceedings 6(6), 21. Liu, Z., 2005. Slection of Clinical Bovine Mastitis Pathobacteria and Study on Pathogenicity to Mice. Inner Mogolia Agricultral University. Lutzow, Y.C., Donaldson, L., Gray, C.P., Vuocolo, T., Pearson, R.D., Reverter, A., Byrne, K.A., Sheehy, P.A., Windon, R., Tellam, R.L., 2008. Identification of immune genes and proteins involved in the response of bovine mammary tissue to Staphylococcus aureus infection. BMC veterinary research 4, 18. Marudamuthu, A.S., Shetty, S.K., Bhandary, Y.P., Karandashova, S., Thompson, M., Sathish, V., Florova, G., Hogan, T.B., Pabelick, C.M., Prakash, Y.S., Tsukasaki, Y., Fu, J., Ikebe, M., Idell, S., Shetty, S., 2015. Plasminogen activator inhibitor-1 suppresses profibrotic responses in fibroblasts from fibrotic lungs. J Biol Chem 290(15), 94289441. Merkle, M., Ribeiro, A., Sauter, M., Ladurner, R., Mussack, T., Sitter, T., Wornle, M., 2010. Effect of activation of viral receptors on the gelatinases MMP-2 and MMP-9 in human mesothelial cells. Matrix Biol 29(3), 202-208. Miao, Z., Ding, Y., Bi, Y., Chen, M., Cao, X., Wang, F., 2019. Staphylococcus aureus on the effect of expression of MMPs/TIMPs and uPA system in bovine mammary fibroblasts. Journal of microbiology, immunology, and infection. Mitterhuemer, S., Petzl, W., Krebs, S., Mehne, D., Klanner, A., Wolf, E., Zerbe, H., Blum, H., 2010. Escherichia coli infection induces distinct local and systemic transcriptome responses in the mammary gland. BMC Genomics 11, 138. Murphy, G., Nagase, H., 2008. Progress in matrix metalloproteinase research. Molecular aspects of medicine 29(5), 290-308. 22

Jo

ur

na

lP

re

-p

ro of

Paolillo, R., Iovene, M.R., Romano Carratelli, C., Rizzo, A., 2012. Induction of VEGF and MMP-9 expression by toll-like receptor 2/4 in human endothelial cells infected with Chlamydia pneumoniae. International journal of immunopathology and pharmacology 25(2), 377-386. Pareek, R., Wellnitz, O., Van Dorp, R., Burton, J., Kerr, D., 2005. Immunorelevant gene expression in LPS-challenged bovine mammary epithelial cells. Journal of applied genetics 46(2), 171-177. Porcherie, A., Cunha, P., Trotereau, A., Roussel, P., Gilbert, F.B., Rainard, P., Germon, P., 2012. Repertoire of Escherichia coli agonists sensed by innate immunity receptors of the bovine udder and mammary epithelial cells. Veterinary research 43, 14. Ricard-Blum, S., 2011. The collagen family. Cold Spring Harbor perspectives in biology 3(1), a004978. Swanson, K.M., Stelwagen, K., Dobson, J., Henderson, H.V., Davis, S.R., Farr, V.C., Singh, K., 2009. Transcriptome profiling of Streptococcus uberis-induced mastitis reveals fundamental differences between immune gene expression in the mammary gland and in a primary cell culture model. Journal of dairy science 92(1), 117-129. Tao, W., Mallard, B., 2007. Differentially expressed genes associated with Staphylococcus aureus mastitis of Canadian Holstein cows. Veterinary immunology and immunopathology 120(3-4), 201-211. Vayalil, P.K., Iles, K.E., Choi, J., Yi, A.K., Postlethwait, E.M., Liu, R.M., 2007. Glutathione suppresses TGF-beta-induced PAI-1 expression by inhibiting p38 and JNK MAPK and the binding of AP-1, SP-1, and Smad to the PAI-1 promoter. Am J Physiol Lung Cell Mol Physiol 293(5), L1281-1292. Visse, R., Nagase, H., 2003. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res 92(8), 827-839. Wang, Z., Liu, M., Nie, X., Zhang, Y., Chen, Y., Zhu, L., Chen, X., Chen, L., Chen, H., Zhang, J., 2015. NOD1 and NOD2 control the invasiveness of trophoblast cells via the MAPK/p38 signaling pathway in human first-trimester pregnancy. Placenta 36(6), 652660. Wen, Y., Cai, L., 2014. [Research progress of matrix metalloproteinase 12 in non-small cell lung cancer]. Zhongguo fei ai za zhi = Chinese journal of lung cancer 17(1), 30-33. Wu, J., Ding, Y., Bi, Y., Wang, Y., Zhi, Y., Wang, J., Wang, F., 2016. Staphylococcus aureus induces TGF-beta1 and bFGF expression through the activation of AP-1 and NF-kappaB transcription factors in bovine mammary gland fibroblasts. Microb Pathog 95, 7-14. Yang, W., Zerbe, H., Petzl, W., Brunner, R.M., Gunther, J., Draing, C., von Aulock, S., Schuberth, H.J., Seyfert, H.M., 2008. Bovine TLR2 and TLR4 properly transduce signals from Staphylococcus aureus and E. coli, but S. aureus fails to both activate NFkappaB in mammary epithelial cells and to quickly induce TNFalpha and interleukin-8 (CXCL8) expression in the udder. Molecular immunology 45(5), 1385-1397. Zeisberg, M., Kalluri, R., 2013. Cellular mechanisms of tissue fibrosis. 1. Common and organ-specific mechanisms associated with tissue fibrosis. Am J Physiol Cell Physiol 304(3), C216-225. Zheng, P., Chen, H., 2017. Evaluate the effect of different mmps inhibitors on adhesive

23

Jo

ur

na

lP

re

-p

ro of

physical properties of dental adhesives, bond strength and mmp substarte activity. Sci Rep 7(1), 4975.

24

Fig. 2

ro of

-p

re

lP

na

ur

Jo Fig. 1

25

Fig. 4

ro of

-p

re

lP

na

ur

Jo Fig. 3

26

ro of

-p

Fig. 6

re

lP

na

ur

Jo Fig. 5

27

Fig. 8

ro of

-p

re

lP

na

ur

Jo Fig. 7

28

Table 1 Primer sequences for qPCR

Gene

TIMP-1 TIMP-2 COL ⅠA1 PLAU PLAUR BMP2 HGF UXT

82 bp

R: CAGCCACGCCCACATCATCTTC F: CAGGACAGTCACAACCGCATCC

111 bp

R: GGCAGGTTTCGGAAGGCTTCTC F: ACCTTCGCAGCAGAGCCCTAC

99 bp

R: TCGCCCACCACCAGCACAG F: CCTGTTGCTGCTGTGGCTCAC R: GACGACATCGGAGTTGCAGAAGG F: ACGAGTGCCTCTGGATGGACTG R: GAGCCGTCGCTTCTCTTGATGC F: AGGAATGCCTGGTGAACGA R: CACCTTTGGGACCAGCATC F: CAGGTCACCAACGCCGAGAAC R: CTGATGAGGCTGCCACCACAC F: GCCAACCGCTGCTGCTACTG

R: ACGTTCATCTCATTGCCACCTTCC F: CGTCCTGAGCGAGTTCGAGTTG R: CGAGTGCTGGCGGTACAAGTC

F: CGCTGGGATCATCAGACACCAC R: CCTCGGCTTGCCATCAGGATTG F: CGTTGACACAGTGGTCCCAGAC R: CTTGGTGAGGTTGTCGCTGAGC F: TCTGGCACCACACCTTCTACAAC R: GGACAGCACAGCCTGGAT

91 bp 91 bp 77 bp

98 bp 175 bp 118 bp 105 bp 145 bp 170 bp

Jo

ur

ACTB

F: CTTCCTGTTGCTCCTGCTCACG

ro of

NOD2

169 bp

R: GAGCGAAGGCATCATCCACTGTC

-p

TLR5

F: GACCAGAGCACCATTGAGACCATG

re

TLR2

105 bp

R: GCACCAGCATCACCCCACTTG

lP

MMP-2

Product length

F: CGGCACAGTCAAGGCAGAGAAC

na

GAPDH

Primer sequence(5' to 3')

29

Table 2 Genes most significantly expression by BMFBs induced by heat-inactivated S. aureus for 6 h.

gene symbol

Gene description

Fold change

extracellular region CXCL12

C-X-C motif chemokine ligand 12%2C transcript variant X2

-2.5806

ESM1

endothelial cell specific molecule 1

-1.9982

CX3CL1

C-X3-C motif chemokine ligand 1%2C transcript variant X1

3.9779

ECM1

extracellular matrix protein 1%2C transcript variant X1

0.8907

IL36A

interleukin 36%2C alpha%2C transcript variant X3

-2.6998

CCL20

C-C motif chemokine ligand 20%2C transcript variant X1

7.1983

WNT4

Wnt family member 4%2C transcript variant X3

1.5896

IL17B

interleukin 17B%2C transcript variant X7

0.8552

immune response C-X-C motif chemokine ligand 8

IL18

interleukin 18%2C transcript variant X1

CXCL2

chemokine (C-X-C motif) ligand 2

TNFSF10

TNF superfamily member 10%2C transcript variant X1

2.7050

CCL5

C-C motif chemokine ligand 5

3.8900

TNFSF15

TNF superfamily member 15

CCL2

chemokine (C-C motif) ligand 2

IL7

interleukin 7%2C transcript variant X1

IL6

interleukin 6

CXCL3

chemokine (C-X-C motif) ligand 3

IL1A

interleukin 1 alpha

NOD2

-1.0748 3.3264

re

-p

3.3324

lP

apoptotic process

4.6164

ro of

CXCL8

nucleotide binding oligomerization domain containing 2%2C

3.3723 1.6069 3.6074 1.4741 3.2401 3.0489

transcript variant X3

Bcl2 modifying factor%2C transcript variant X1

1.4119

BBC3

BCL2 binding component 3%2C transcript variant X1

1.4626

BIK

BCL2-interacting killer (apoptosis-inducing)

BCL2A1

BCL2 related protein A1

4.8563

BCL2L11

BCL2 like 11%2C transcript variant X5

1.0613

na

BMF

3.6847

LAMA3

laminin subunit alpha 3%2C transcript variant X1

1.1695

IRS2

insulin receptor substrate 2

1.5178

BMP2

bone morphogenetic protein 2

1.6041

FGF9

fibroblast growth factor 9

1.0375

Jo

ur

receptor binding

endopeptidase activity MMP17

matrix metallopeptidase 17%2C transcript variant X2

-1.0220

ADAMTS14

ADAM metallopeptidase with thrombospondin type 1 motif

-2.0527

14%2C transcript variant X1 ADAM33

ADAM metallopeptidase domain 33

1.1101

ADAMTS6

ADAM metallopeptidase with thrombospondin type 1 motif 6%2C

0.9993

transcript variant X7 30

Table 3 Functional pathways of genes most affected by heat-inactivated S. aureus

Signal transduction pathways

Adjusted p-value

Nb of genes*

Pathways in cancer

1.19E-27

97/350

Cytokine-cytokine receptor interaction

7.31E-25

54/350

PI3K-Akt signaling pathway

9.85E-24

71/350

TNF signaling pathway

1.95E-21

41/350

MAPK signaling pathway

1.82E-20

64/350

AGE-RAGE signaling pathway in diabetic complications

1.03E-19

37/350

Toll-like receptor signaling pathway

1.39E-19

35/350

IL-17 signaling pathway

3.11E-19

31/350

Hepatitis B

3.83E-17

41/350

Jo

ur

na

lP

re

-p

ro of

* Nb of genes: number of genes in the list in the pathway.

31