Structure and expression of the genes encoding peroxisomal β-oxidation enzymes

Biochimie (1993) 75,243-250 © Soci6t6 franqaise de biochimie et biologie mol6culaire / Elsevier, Paris

243

Structure and expression of the genes encoding peroxisomal [3-oxidation enzymes T Osumi Department of Life Science, Himeji Institute of Technology, Kamigori, Hyogo 678-12, Japan (Received 18 November 1992; accepted 15 January ! 993)

Summary - - To investigate the mechanism of induction of the peroxisomai 13-oxidation enzymes by peroxisome proliferators, genes of these enzymes were cloned from rat liver and their structures analyzed. The acyl-CoA oxidase gene was found to produce two forms of the enzyme differing in their amino acid sequences in a limited region, through alternative splicing of the two copies of the third exon. The amino acid sequence of the bifunctional enzyme suggests, compared with those of its mitochondrial counterparts, that the enoyl-CoA hydratase and 3-hydroxyacyi-CoA dehydrogenase activities are located on the amino- and the carboxyl sides, respectively. Two copies of the 3-ketoacyl-CoA thiolase gene were identified per haploid genome. One gene named A is constitutive and encodes a thiolase precursor carrying 36 amino acid residues of amino-terminal presequence, whereas the other, termed B, is remarkably induced by peroxisome proliferators and specifies a precursor having a 26-residue presequence. Functional analysis of the upstream sequence of the acyl-CoA oxidase gene revealed three functionally different regions, one of which had the character of ciprofibrate-responsive enhancer. In this region, two sequences were identified as binding-sites of rat liver nuclear proteins. A gene transfection study indicated that these sequence elements (termed A and B) play important roles in the induction of the gene, the former acting positively whereas the latter probably is acting negatively.

peroxisomes / ~.oxidation system / peroxisome proliferator / gene structure / transcriptional induction Introduction Rat liver peroxisomes are markedly proliferated by the administration of various hypolipidemic compounds, collectively called peroxisome proliferators [ 1].The three [~-oxidation enzymes located in the peroxisomes are induced in parallel [2, 31. This phenomenon is of much biological interest in many aspects; eg coupled proliferation of organelles and induction of the matrix enzymes, and coordinate synthesis of the enzymes catalyzing consecutive metabolic reactions. Moreover, both the basal level expression and the induction of the 13-oxidation enzymes are highly tissue-specific [4], raising another interesting question about the underlying regulatory mechanism. To tackle this complex cellular event, we chose the induction nf the ~-oxidation enzymes as the initial target for study, because it seemed most feasible to be handled by available techniques. The induction occurs at the level of gene transcription [5]. Accordingly, we initiated our study by cloning and analyzing the genes coding for the 13-oxidation enzymes, and then tried to

identify the c/s-regulatory elements by transfection of manipulated genes to cultured hepatoma cells. Here I review experimental results and discuss some points for future investigations,

Structures of the [~.oxidation genes cDNAs encoding the peroxisomal 13-oxidation enzymes were cloned, starting from the liver poly(A+)RNA of di(2-ethyihexyl)phthalate-treated rats. Using the cDNAs obtained as probes, corresponding chromosomal genes were then isolated from rat genomic libraries.

AcyI-CoA oxidase This enzyme is the initial and rate-limiting enzyme of the peroxisomal ~-oxidation pathway. It contains FAD as the prosthetic group, and catalyzes a H202generating dehydrogenation of fatty acyl-CoA [6]. We obtained 3741 bases of cDNA sequence coding for

244 661 amino acid residues of the enzyme [71, by combining the sequences of several clones. This enzyme is originally composed of two identical subunits (component A), but, after translocation to peroxisomes [8], the polypeptide is cleaved proteolytically betv, een 46sVal and 469Ala, into two components (B and C) at a frequency of ca 80%. This 'processing' suggests that the full-length oxidase polypeptide folds into two structural domains (fig 1, bottom). The carboxyl terminus ends in -Ser-Lys-Leu-COOH, and was shown to form a peroxisomal targeting signal [9]. Acyl-CoA oxidases of Candida o'opicalis exhibit 25-30% identity to the rat enzyme [ 10]. A weak similarity was also noted between the rat oxidase and the mitochondrial acyl-CoA dehydrogenases [ 111. The acyl-CoA oxidase is a single copy gene. It spans about 25 kb, and consists of 14 exons and 13 introns 1121 (fig 1). Components B and C roughly derive from exons 1-9 and 10-14, respectively. For the third exon, two different sequences have been identified, and were shown to be alternatively utilized in the pre-mRNA splicing, thereby yielding two types of mRNA different in the nucleotide sequences only in a small part. These two alternative exons contain identical numbers of nucleotide, and have 55% identity in the nucleotide sequences. Thus, they were probably generated by exon duplication. This region corresponds to the amino acid residues 90 through 144,

( lqllt' IP i

3+1 0

3-:~4661

tJ0

10 lll~"~hl ld I

nd+NA

Protein

I)ontilJn MfUcluI'P

II:N

Fig 1. Structure of the acyI-CoA oxidase gene and scheme of alternative splicing yielding two forms of the enzyme. At the bottom, the putative domain structure of the enzyme is shown. Thick downward arrow indicates the site of proteolytic attack cleaving the A component into B and C components from the amino- and carboxyl-terminal portions of the polypeptide, respectively. The point corresponding to the 'processing" site is also shown by arrowheads on the figures of gene structure and protein sequences.

and hence, two types of the oxidase enzyme are expected to occur. The amino acid sequences of the region are 50% identical between the two. The difference in the functions of the two predicted forms of the enzyme is not clear, but an attractive possibility is that they have different selectivity against different chain-lengths of fatty acyl-CoA substrates. Recently, three types of acyl-CoA oxidase were identified in rat liver [ 13], but it is not known how they are related to the two predicted polypeptide sequences. The bifunctional enzyme Enoyl-CoA hydratase and 3-hydroxyacyl-CoA dehydrogenase activities, corresponding to the second and third reactions of the peroxisomal [I-oxidation pathway, are catalyzed by a monomeric bifunctional enzyme [14]. This enzyme is in fact 'trifunctional', because enoyl-CoA isomerase activity has recently been identified in this enzyme as the third function [15]. From the eDNA sequence [16], 721 residues of the amino acid sequence were predicted, excluding the initiator methionine. The carboxyl-terminal sequence is -Ser-Lys-Leu-COOH, again conforming to the SKL-motif, the peroxisomal targeting consensus sequence [ 17, 18]. Significant similarities in the amino acid sequences were found between the amino-terminal ca 190 residues of the enzyme and mitochondrial enoyl-CoA hydratase, and between ca 230 residues in the middle portion of the bifunctional enzyme and mitochondrial 3-hydroxyacyI-CoA dehydrogenase [ 19]. These sequence comparison data support the view that the two enzyme activities are attributed to the respective regions, probably forming distinct functional domains (fig 2). Comparison with the E coli fadB gene that encodes the 13subunit of the multifunctional ~-oxidation enzyme was even more informative [20]. In addition to the hydratase and dehydrogenase regions, another sequence resemblance was found in the extreme carboxyl-terminal regions between the enzymes from rat and E coli. The E coli enzyme carries four activities; the same three activities as those of the rat enzyme and 3-hydroxyacyl-CoA epimerase. It was proposed that the third common function, enoyl-CoA momerase activity, is carried by the extreme carboxylterminal regions, though no further evidence was presented. The fungi, Saccharomyces cerevisiae [21 ] and Candida tropicalis [22], also have similar multifunctional enzymes of [3-oxidation, and the enzymes are closely related to each other. However, there is no detectable homology between them and the enzymes of rat and E coli. It was shown that the enzymes of rat and E coli utilize L-3-hydroxyacyl-CoA as the substrate, as in the case of the mitochonddal [3-oxidation system, whereas those of the fungi use the o-isomer

245 [21]. Thus, the multifunctional enzymes of the two groups must be evolutionarily independent in spite of the overall functional identity. The chromosomal gene of the bifunctional enzyme is 31 kb long, containing seven exons [23] (fig 2). The first five exons code for the amino-terminal hydratase domain, whereas exon VI corresponds to the linker region between the two domains. The remaining carboxyl-terminal region including the dehydrogenase domain is specified solely by exon VII. This exon consists of 1259 nucleotides, encoding as much as 58% of the total length of the polypeptide sequence. The intronless structure of this region might reflect the gene fusion process in the evolution yielding the multifunctional enzyme. 3-Ketoacyi-CoA thiolase

Two closely related genes (termed genes A and B) for the thiolase were found per haploid genome of rat [24]. Both have 12 exons, separated by 11 introns inserted at exactly the same positions of the coding sequences (fig 3). Their nucleotide sequences are almost identical in the translated regions, and very similar even in some intron regions. Hence, they probably originated by gene duplication, and have conserved their sequences through partial gene conversion. We showed by the primer extension method that the A gene is weakly expressed in a constitutive manner, whereas the B gene is remarkably induced by a peroxisome proliferator, di(2ethylhexyl)phthalate.

I

Gone

2

4

~il II 2

Nllz

5

6

7

I i~l

Protein

Domains

3

I

189 803

I 722

CO o ,

Fig 2. Gene and domain structures of the bifunctional enzyme. In exon 7, the 3' untranslated region is stippled. The amino terminus of the mature bifunctionai enzyme starts at the second amino acid residue of the initial polypeptide. Relationship between the three domains and the polypeptide sequence is roughly shown by thin lines. The carboxyl-terminal domain marked '?' was presumed to carry the isomerase domain based on the sequence conservation between the rat and E coli enzymes [20].

The thiolase is unusual among peroxisomal proteins, in that it is synthesized as a larger precursor carrying an amino-terminal peptide extension [81. The thiolase eDNA was first cloned from the mRNA of induced rats by a differential hybridiza6on iechnique, and thus corresponded to the 13 gene [25]. It encoded a thiolase precursor having 26 residues of presequence (fig 3). On the other hand, the A gene is expected to code for a precursor with 36 residues of presequence, due to the difference in the nucleotide sequences in the early portion of exon I of the two genes. The eDNA corresponding to the A gene was cloo,,d recently [261. The presequence of the A form contains 10 extra amino acid residues attached to the amino terminus of the B presequence, and the common portion is identical except for one residue (fig 3). These presequences have net positive charges, and lack a long hydrophobic stretch, hereby resembling the mitochondrial signal peptides. Swinkels et al [27] and Osumi et al [28] showed that these presequences have a function of cleavable signal peptide for peroxisomal targeting. Moreover, we found by site-directed mutagenesis of -17His that the sequence requirement of the presequence for the targeting function is totally different from that of the SKL-signal [29]. Surprisingly, replacement of this residue by certain amino acids converted the presequence to a mitochondrial signal peptide. The mature portions of both thiolases A and B consist ot' 398 residues of amino acid, being different at only seven positions 1241. The amino acid sequence is highly conserved between rat and human peroxisomai thiolases. The human gene (only one gene corresponding to the B gene was identilied 130, 31 I) was mapped at human chromosome 3p22--->p23 region [321, whereas the rat A gene was tentatively located on rat chromosome 8 [331. There are various types o1" thiolases having different substrate speciticities and subcellular distributions from prokaryotes to higher eukaryotes, forming a large family. Throughout them, 30-50% similarity is found at the amino acid level. Among them, the peroxisomal thiolase is most closely related to E coli 3-ketoacyl-CoA thiolase [341. Phylogenetic comparison analysis of a growing number of known thiolase sequences is giving insights into the evolution of peroxisomes 1351.

Expression of the peroxisomal [3-oxidation genes The coordinate induction of mRNAs of the ~-oxidation enzymes strongly suggests that a common regulatory mechanism is functioning at the level of gene transcription. Result of a nuclear run-on study supported this idea 151.

246 iil

[11

IV v

~,1

~11

Vlll IX X )tl

, I

Gene A

Gene B

"

•:'

iw

n

_ um

w,

_1 1

,

I

•ram••

l

o

I~ m i

.:'

l

/X// / ] ![II!

Ill

I

II

.,

,Ikb

-36

sequences, one of which we were particularly interested in (see below).

XII

,:,

-9-6

-16

MSESVGRTSAMHRLQVVLGHLAGRPESSSALQAAPC

-6

I

1 S-

Fig 3. The 3-ketoacyl-CoA thiolase genes, a. Structures of the two thiolase genes. Underlinings indicate the regions particularly well conserved between the two genes. b. Amino-terminal presequences of the two tbrms of thiolase precursors, including the first residue of the mature portions (numbered I). Amino acid residues of the presequences are indicated by negative numbers. In the common portion, the sequences are identical (shown with asterisk) except for the residue at -12.

Functional analysis of the acyl-CoA oxidase gene upstream sequence To determine the nucleotide sequence required for the induction, we analyzed the regulatory functions of the oxidase gene upstream region by CAT assay. For this purpose, we first established the conditions for the induction, using a rat hepatoma line, H4IIEC3 [37]. Although the hepatoma cells were extremely poor in the transfection efficiency, we could perform the experiments by an improved calcium phosphate precipitation method, employing both transient and permanent assays [38 ]. We investigated the regulatory functions of the sequence up to 4.3 kb upstream of the major cap site, by constructing deletion mutants for various portions. We could discriminate three regions having different regulatory functions (fig 4). Region I has an activity

-639

-472

-128

-2.5k

Characteristics of the 5'upstream sequences ~" the ~oxidation genes To obtain a hint on the mechanism of the coordinated regulation, we compared the upstream sequences of these genes 112, 23, 241. The genes of oxidase, bifunctional enzyme and thiolase A lack a TATA-like sequence in the promoter regions, but instead contain a GC-box and related sequences, thereby suggesting the involvement of a Spl-like transcription factor [361. These characteristics are often found in the promoters of 'housekeeping' genes. The three genes are indeed expressed at low levels in many tissues [4]. Interestingly, the thiolase B gene, which is strictly inducible, lacks a GC-box and has a TATA-Iike sequence. Thus, the oxidase and bifunctional enzyme genes have both constitutive and inducible characters, whereas the thiolase A and B genes separately carry these two functions. We next searched for common sequence motifs in the upstream regions in the three inducible genes, those for the oxidase, bifunctional enzyme and thiolase B [22]. We noted several

[

-2,5kA.472/°129 ~ "2.5k~.128/.20

~

n [ l

[ •.

-19

$ I O

I 0

1.0 2.7 0.2 2.1 O.I 0.2

Uninduced [ Induced

Fig 4. Three functionally different regions found upstream of the oxidase gene. a. The major cap site is numbered 1, and the upstream residues are indicated by negative numbers. b, Results of cat assays revealing the functions of regions I and If. Thick bar indicates region attached to cat structural gene for testing the promoter function. In -2.5k construct, it corresponds to the sequence from position 2.5 kb upstream of the major start site to position 34, the latter being located between the transcription start site and translation inflation codon. Deleted sequences are shown by Am/.. DNA transfection was carried out as described [38], and one of the two cultures for each construct was induced for 3 days with 0.5 mM ciprofibrate, whereas the other was uninduced. Numerals on the right indicate relative cat activities taking the uninduced activity of-2.5k construct as 1.0. These are averages of the results of several independent experiments.

247 of basal promoter, and contains a direct repeat of an l l-bp GC-rich unit [12], containing a Spl-binding site. Region II is essential for a basal level expression, but a significant activity was observed in the presence of an inducer (ciprofibrate, in this experiment), without this region. Hence, the apparent induction is remarkably strengthened in the mutants deleted for this region. This effect of deletion does not seem merely due to the decrease in the distance between the enhancer element of region III (see below) and the basal promoter; fine deletion analysis of region II revealed a complex mode of effects, suggesting the occurrence of several cis-acting sequence elements in the region (Osumi T, unpublished). Region HI has an indispensable role in the induction (fig 5). This region activated the transcription in response to ciprofibrate, independent of the orientation and position of insertion, and also cooperated with a heterologous promoter. Weak activation of transcription by this sequence was also observed in several other cell lines, but response to ciprofibrate was only seen in H4IIEC3. Thus, region III acts as a ciprofibrate (and probably general peroxisome proliferators)responsive, tissue-specific enhancer.

positively acting sequence A and negatively acting sequence B. In sequence A, one of the sequence motifs conserved in the 5' upstream regions of the three inducible 13-oxidation genes was found (double underlined in fig 6). Mutations in two different sites of this sequence both caused severe decreases in the transcription (fig 8). Thus, this sequence seems to play an important role in the regulation of the oxidase gene,

Relative cat activity Uninduced Induced

a

-639

-473 vb._

cat

- 128

1

[

I!!!!!!!!!!!!!!!!~!:!!!!!!!!!!!!!~!!!1

2.5

26.8

i ~ , ~

2.3

29.0

1.0

2.0

2.0

8.9

4.4

20.3

30,3

29.8

1.0

1.7

0,7

0,6

I

I

,iiiiii~!!!~!!ii!~ii,!i~ili~t

I'

t~t,~,~*~'~,,,~.,~

I

l~,~,~i~,~.-

•

IF"

Sequence elements responsible for the induction By more elaborate deletion analyses from both 5' and 3' sides, we could delimit the minimal enhancer seauence between positions -578 and -517 (fig 6). Experiments using rat liver nuclear extracts by footprinting and gel-retardation assay revealed two protein-binding sites (marked A and B) in this region ([5]; Osumi I', unpublished). The binding to site B was very strong, whereas that to site A was weak, being just over the limit of detection, by these techniques. To examine the functions of these sequence elements in the induction, we constructed plasmids where synthetic oligonucleotides corresponding to the sequences of sites A and B were placed just upstream of the basal promoter. When these plasmids were transfected into H4IIEC3 cells, sequence A alone exhibited a marked transcriptional activation (fig. 7). For this construct, however, the inducible effect of ciprofibrate was relatively small. On the other hand, sequence B by itself did not have an apparent effect on transcription, and even inhibited the basal level expression in some experiments (data not shown). When linked to sequence A, sequence B showed an inhibitory effect, which was more significant in the absence of the inducer. Hence, the apparent induction ratio was expanded by a coexistence of both the sequences. These results raise a possibility that the induction is achieved by a cooperative interaction of

72

72

21

&T~.T/.T,r.T~,T~T~T,r.~T~TC.T,~T,ITt.T,I T ~ C . T ~

-.¢"

21

21

I

I

I~

t

I

~-

SV0

L IF"

t

t

t

t-

i,5

12,9

i

t

t

~

1.4

13.8

A

Fig 5. Demonstration of the ciprofibrate-dependent enhancer activity of region III in H41IEC3 hepatoma cells. a. Orientation- and position-independent effect of region III. Filled arrow indicates region III sequence together with the direction of insertion. Open box indicates the oxidase basal promoter, and the stippled box, cat structural gene. b. Cooperation of region III with SV40 basal promoter. Dotted and open boxes indicate the 72-bp repeat enhancer and the 21-bp repeat basal promoter of SV40, respectively. The sequences shown were linked to cat structural gene. SV0 is a promoterless construct. In both a and b, cat activities are shown as relative values, taking as 1.0 the uninduced activities of the constructs having only the basal promoters.

248 and hopefully also of other inducible peroxisomal [3oxidation genes. Sequence A contains a direct repeat TGACCTtTGTCCT, which conforms to the binding motif of o-arts-acting protein factors of the steroid/thyroid receptor family. Recently, cDNA of a member of this family that is activated in the presence of peroxisome proliferators, called peroxisome proliferator-activated receptor (PPAR), was cloned [39--411. It was shown that PPAR bound to the direct repeat in sequence A of the oxidase gene, and this sequence conferred an inducible expression in conjunction with forcedly expressed PPAR in non-hepatic cells [40, 42]. Moreover, the potential of PPAR for both binding and transcriptional activation was found to be strengthened by the coordination with the retinoid X receptor tx (RXRo0 [431. These results suggest that the oxidase gene is a target of PPAR, and its regulatory function is modulated by heterodimer formation with RXRct.

Concluding remarks Gene analysis studies of the peroxisomal [3-oxidation enzymes revealed many unexpected results. The oxidase gene produces two different types of enzyme in the amino acid sequences in a limited region, possibly having different substr,'tte specificities. The gene of the bifunctional (trifunctional, in fact) enzyme retains a structure apparently reflecting the continuing gene fusion process, and the comparison of the gene structure with those of E coil and yeasts is giving new insights into the evolution of the [3-oxidation enzymes. Two closely related genes are present for the thiolase, one of which is constitutive and the other inducible. Phyiogenetic analysis of the thiolase gene family is also expected to shed light on the evolution

Relative cat activity Uninduced Induced -639 A-472/-129

-639 l

-473 - 128 .[--

[

AB/-128

B/-128

~ A ~

B

~

- 128

I

-548

I

TTGCTCCTATTTGGTTAGGTTCCAGTAAAATCA

5.6

12.8

I

0.8

3.4

i

0.4

0.4

|

0.4

0.3

of the [3-oxidation system and peroxisomes [35]. Recently, Hashimoto and coworkers [44, 45] isolated a novel, tightly membrane-bound mitochondrial 13oxidation enzyme system, which again contained a multifunctional enzyme. Thus, despite its history of nearly one hundred year of investigation, the fatty acid 13-oxidation system is still continuing to be a source of many exciting novel observations. Gene transfection analysis revealed a cis-acting positive element (sequence A) which probably plays a central role in the induction of the oxidase gene by peroxisome proliferators. This element contains a recognition sequence of recently identified nuclear receptors PPAR, and RXRot which is activated by 9cis-retinoic acid [461. It is highly probable that these

E

"

I

-639 A.472/.129 -mutant A4 [

0

-639 A -472/-129 -mutant A6

I

l l l . - -

I

|

Fig 7. Effects of sequences A and B on the transcription. Oligonucleotides A, B or both were linked to the basal promoter of the oxidase gene, instead of region III. Cat activities are represented by relative values taking the uninduced activity of the construct carrying region III as 1.0.

A

B

12.0

B

A

CCCGACGTGACCTTTGTCCTG_GTCCCCTT A4(CAG) A6(ATG)

1.0

A A/-128

-639 A_472/.129 -578

I I

E

1.0 6.7 0.5 2.4 0.9 0.9

-516

Fig 6. Nucleotide sequence of the region essential for the inducible expression. Sequence elements A and B are protein-binding sites identified by tbotprint analysis. Arrows indicate the direct repeat motif that is presumed to be the binding site of PPAR. Double underlining shows a sequence conserved in the regulatory regions of the inducible peroxisomal l~-oxidation genes. In mutants A4 and A6 of figure 8, the three nucleotides marked by thick underlinings were changed into sequences indicated in parentheses.

E Uninduced Induced Fig 8. Effects of mutations in the conserved sequence motif. In mutants A4 and A6, base changes as shown in figure 6 were introduced into the --639A_472/_u29construct. Numerals on the right indicate the relative cat activities divided by the value of the wild type construct under uninduced conditions,

249 nuclear receptors confer the inducibility by heterodimer formation [43]. One question to be answered is how the target gene specificity of the nuclear receptors is determined, because the same sequence element is also recognized by other nuclear receptor-like proteins such as C O U P - T F [47] and H N F 4 [48]. Our results of deletion and site-directed mutagenesis studies suggest that other sequence elements are also important for the induction of the natural oxidase gene. Protein-protein interactions responsible for the complex mode of regulation should be investigated, under conditions as close as possible to the physiological cellular environment. How are the peroxisomal 13-oxidation genes coregulated? In the 5' upstream region of the thiolase gene, a motif of RXRtx (and probably also PPAR)binding site is found [47]. Moreover, a region conferring the induction by ciprofibrate was identified in the upstream region of the gene of bifunctional enzyme [49]. This region also contains the possible binding motif of PPAR, though the nucleotide spacing between the unit binding elements is different from those of the oxidase and thiolase genes (two in the former, whereas one in the latter two). Further characterization of the regulatory sequences and t r a n s - a c t i n g factors recognizing them will present an unified picture of the induction m e c h a n i s m of the peroxisomal 13oxidation enzymes and peroxisomes,

Acknowledgments The author expresses sincere gratitude to Prof T Hashimoto, Shinshu University School of Medicine, and his laboratory members, Ibr collaboration and encouragement.

6 7

8

9

10

ll

12 13

14

15

References I

Reddy JK, Warren JR, Reddy MK, Lalwani ND (1982) Hepatic and renal effects of peroxisome proliferators: biological implications. Ann NY Acad Sci 386, 81-110 2 Lazarow PB, de Duve C (1976) A fatty acyl-CoA oxidizing system in rat liver peroxisomes; enhancement by clofibrate, a hypolipidemic drug. Proc Natl Acad Sci USA 73, 2043-2046 3 Hashimoto T (1982) Individual peroxisomal ~-oxidation enzymes. Ann NY Acad Sci 386, 5-12 4 Nemali MR, Usuda N, Reddy MK, Oyasu K, Hashimoto T, Osumi T, Rao MS, Reddy JK (1988) Comparison of constitutive and inducible levels of expression of peroxisomal ~-oxidation and catalase genes in liver and extrahepatic tissues of rat. Cancer Res 48, 5316-5324 5 Reddy JK, Goel SK, Nemali MR, Carrino J J, Laffler TG, Reddy MK, Sperbeck SJ, Osumi T, Hashimoto T, Lalwani ND, Rao MS (1986) Transcriptional regulation of peroxisomal fatty acyl-CoA oxidase and enoyI-CoA hydratase/3hydroxyacyl-CoA dehydrogenase in rat liver by peroxisome proliferators. Proc Natl Acad Sci USA 83, 1747-1751

16

17 18

19

20

:.')sumiT, Hashimoto T, Ui N (1980) Purification and properties of acyl-CoA oxidase from rat liver. J Biochem (Tokyo) 87, 1735-1746 Miyazawa S, Hayashi H, Hijikata M, Ishii N, Furuta S, Kagamiyama H, Osumi T, Hashimoto T (1987) Complete nucleotide sequence and predicted amino acid sequence of rat acyl-CoA oxidase. J Biol Chem 262, 8131-8137 Miura S, Mori M, Takiguchi M, Tatibana M, Furuta S, Miyazawa S, Hashimoto T (1984) Biosynthesis and intracellular transport of enzymes of peroxisomal [3-oxidation. J Biol Chem 259, 6397-6402 Miyazawa S, Osumi T, Hashimoto T, Ohno K, Miura S, Fujiki Y (1989) Peroxisome targeting signal of rat liver acyl-coenzyme A oxidase resides at the carboxy terminus. Mol Cell Biol 9, 83-91 Okazaki K, Tan H, Fukui S, Kubota I, Kamiryo T (1987) Peroxisomal acyl-coenzyme A oxidase multigene family of the yeast Candida tropicalis; nucleotide sequence cf a third gene and its protein product. Gene 58, 37-44 Matsubara Y, Indo Y, Naito E, Ozasa H, Glassberg R, Vockley J, ~keda Y, Kraus J, Tanaka K (1989) Molecular cloning and nucleotide sequence of cDNAs encoding th:' precursors of rat long chain acyl-coenzyme A, short chain acyl-coenzyn.~e A, and isovaleryl-coenzyme A dehydrogenases. Sequence homology of four enzymes of the acylCoA dehydrogenase family. J Biol Chem 264, ! 632 l-1633 l Osumi T, Ishii N, Miyazawa S. Hashimoto T (1987) Isolation and structural characterization of the rat acyl-CoA oxidase gene. J Biol Chem 262, 8138.-8143 Schepcrs L, Van Veldhoven PE Casteels M, Eyssen HJ, Mann~.erts GP (1990) Presence of three acyI-CoA oxidases in rat liver peroxisomes. An inducible fatty acyiCoA oxidase, a noninducible fatty acyI-CoA oxidase, and a noninducible trihydroxycoprostanoyI-CoA oxidase. J Biol Chem 265, 5242-5246 Osumi T, Hashirnoto T (1979) Peroxisomal [3-oxidation system ot' rat liver. Copurilication of enoyI-CoA hydratase and 3.hydroxyacyI-CoA dehydrogenase. Biochem Biophys Res ('ommun 89, 580-584 Palosaari PM, Hiltunen JK (1990) Peroxisomal bifunctional protein from rat liver is a trifu,lctional enzyme possessiag 2-eno~l-CoA hydratase, 3-hydroxyacyI-CoA dehydrogenase, and .^,3 ,~,2-enoyI-CoA isomerase activities. J Biol Chem 265, 2446-2449 Osumi T, lshii N, Hijikata M, Kamijo K, Ozasa H, Furuta S, Miyazawa S, Kondo K, Inoue K, Kagamiyama H, Hashimoto T (1985) Molecular cloning and nucleotide sequence of the cDNA for rat peroxisom.'d enoylCoA:hydratase-3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme. ,I Biol Chem 260, 8905-89 ! 0 Gould SJ, Keller GA, Hosken N, Wilkinson J, Subramani S (1989) A conserved tripeptide sorts proteins to peroxisomes..I Cell Biol 108, 1657-1664 Miura S. Kasuya-Arai 1, Mori H, Miyazawa S, Osumi T, Hashimoto T. Fujiki Y (1992) Carboxyl-terminal consensus Ser-Lys-Leu-related tripeptide of peroxisomal proteins functions in vitro as a minimal peroxisome-targeting signal. ,I B/ol Chem 267, 14405-14411 Minami-lshii N, Taketani S, Osumi T, Hashimoto T (1989) Molecular cloning and sequence analysis of the cDNA for rat mitochondrial enoyl-CoA hydratase. Structural and evolutionary relationships linked to the bifunctionai enzyme of the peroxisoma113-oxidation system. Eur J Biochem 185, 73-78 Yang XYH, Schulz H, Eizinga M, Yang SY (1991)

250

21

22

23

24

25 26

27

28

29

30 31 32

33

34

Nucleotide sequence of the promoter and fadB gene of the fadBA operon and primary structure of the multifunctional fauy acid oxidation protein from Escherichia coli. Biochemisnw 30, 6788-6795 Hiltunen JK, Wenzel B, Beyer A, Erdmann R, Fossa A, Kunau WH (1992) Peroxisomal multifunctional [3-oxidation protein of Saccharomyces cerevisiae. Molecular analysis of the fox2 gene and gene product. J Bioi Chem 267, 6646-6653 Nuttley WM, Aitchison JD, Rachubinski RA (1988) cDNA cloning and primary structure determination of the peroxisomal trifunctional enzyme hydratase-dehydrogenase-epimerase from yeast Candida tropicalis pK233. Gene 69, 17 I- 180 lshii N, Hijikata M, Osumi T, Hashimoto T (198"7) Structural organization of the gene for rat enoyl-CoA hydratase'3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme. J Biol Chem 262, 8144-8150 Hijikata M, Wen JK, Osumi T, Hashimoto T (1990) Rat peroxisomal 3-ketoacyl-CoA thiolase gene. Occurrence of two closely related but differentially regulated genes. J Biol Chem 265, 4600--4606 Hijikata M, Ishii N, Kagamiyama H, Osumi T, Hashimoto T (1987) Structural analysis of cDNA for rat peroxisomal 3- ketoacyi-CoA thiolase. J Biol Chem 262, 8151-8158 Bodnar AG, Rachubinski RA (1990) Cloning and sequence determination of cDNA encoding a second rat liver peroxisomal 3-ketoacyl-CoA thiolase. Gene 91, 193199 Swinkels BW, Gould SJ, Bodnar AG, Rachubinski RA, Subramani S (1991) A novel, cleavable peroxisomal targeting signal at the amino-terminus of the rat 3-ketoacylCoA thiolase. EMBO J 10, 3255-3262 Osumi T, Tsukamoto T, Hata S, Yokota S, Miura S, Fujiki Y. Hijikata M, Miyazawa S, Hashimoto T (1991) Aminoterminal presequence of the precursor of peroxisomal 3ketoacyI-CoA thiolase is a cleavable signal peptide tbr peroxisomal targeting. Biochem Biophys Res Commun 18 !, 947-954 Osumi 1", "Esukamoto 1', Hata S (1992) Signal peptide tbr peroxisomal targeting: replacement of an essential histidine residue by certain amino acids converts the aminoterminal presequence of peroxisomal 3-ketoacyI-CoA thiolase to a mitochondrial signal peptide. Biochem BioPhys Res Commun 186, 81 !-818 Bout A, Teunissen Y, Hashimoto I', Benne R, Tager JM (1988) Nucleotide sequence of human peroxisomal 3oxoacyI-CoA thiolase. Nucleic Acids Res 16, 10369 Fairbairn LJ, Tanner MJA (1989) Complete cDNA sequence of human foetal liver peroxisomal 3-oxoacylCoA thiolase. Nucleic Acids Res 17, 3588 Bout A, Hoovers JMN, Bakker E, Mannens MMAM, van Kessel AG, Westerveld A, Tager JM, Benne R (1989) Assignment of the gene coding for human peroxisomal 3oxoacyI-CoA thiolase (ACAA) to chromosome region 3p22-p23. Cytogenet Cell Genet 52, 147-150 Serikawa I', Kuramoto T, Hilbert P, Mori M, Yamada J, Dubay CJ, Lindpainter K, Ganten D, Guenet JL, Lathrop GM, Beckmann JS (1992) Rat gene mapping using PCRanalyzed microsatellites. Genetics ! 3 I, 701-72 I Yang SY, Yang XYH, Healy-Louie G, Schulz H, Elzinga M (1990) Nucleotide sequence of the fadA gene. Primary structure of 3-ketoacyl-coenzyme A thiolase from Escherichia coli and the structural organization of the fadAB operon. J Biol Chem 265, 10424- i 0429

35

36 37

38

39 40

41

42

43

44

45

46

47

48

49

Igual JC, Gonzalez-Bosch C, Dopazo J, Perez-Ortin JE (1992) Phylogenetic analysis of the thiolase family. Implications for the evolutionary origin of peroxisomes. J Mol Evo135, 147-155 Kadonaga JT, Jones KA, Tjian R (1986) Activation of RNA polymerase II transcription by Sp 1. Trends Biochem Sci 11, 20-23 Osumi T, Yokota S, Hashimoto T (1990) Proliferation of peroxisomes and induction of peroxisomal [3-oxidation enzymes in rat hepatoma H41IEC3 by ciprofibrate. J Biochem (Tokyo) 108,614-621 Osumi T, Wen JK, Hashimoto T (1991) Two cis-acting regulatory sequences in the peroxisome proliferator-respensive enhancer region of rat acyl-CoA oxidase gene. Biochem Biophys Res Commun 175, 866-871 Issemann I, Green S (1990) Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347, 645-650 Dreyer C, Krey G, Keller H, Glvel F, Helftenbein G, Wahli W (1992) Control of the peroxisomal [3-oxidation pathway by a novel family of nuclear hormone receptors. Cell 68, 879-887 Gottlicher M, Widmark E, Li Q, Gustafsson JA (1992) Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor. Proc Natl Acad Sci USA 89, 4653-4657 Tugwood J, lssemann I, Anderson RG, Bundell KR, McPheat WL, Green S (1992) The mouse peroxisome proliferator activated receptor recognizes a response element in the 5' flanking sequence of the rat acyl CoA oxidase gene. EMBO J 11,433-439 Kliewer SA, Umesono K, Noonan DJ, Heyman RA, Evans RM (1992) Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 358, 77 !-774 lzai K, Uchida Y, Orii T, Yamamoto S, Hashimoto T (1992) Novel fatty acid J3-oxidation enzymes in rat liver mitochondria. I. Purification and properties of very-longchain acyl-coenzyme A dehydrogenase. J Biol Chem 267, 1027-1033 Uchida Y, Izai K, Orii T, Hashimoto T (1992) Novel fatty acid J3-oxidation enzymes in rat liver mitochondria. II. Purification and properties of enoyl-coenzyme A (CoA) hydratase/3-hydroxyacyl-CoA dehydrogenase/3-ketoacylCoA thiolase trifunctional protein. J Biol Chem 267, 1034-1041 Heyman RA, Mangelsdoff D J, Dyck JA, Stein RB, Eichele G, Evans RM, Thaller C (1992) 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 68, 397-406 Kliewer SA, Umesono K, Heyman RA, Mangelsdorf DJ, Dyck JA, Evans RM (1992) Retinoid X receptor-COUPTF interactions modulate retinoic acid signaling. Proc Natl Acad Sci USA 89, 1448-1452 Sladek FM, Zhong W, Damell Jr JE (1990) Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev 4, 2353-2365 Zhang B, Marcus SL, Sajjadi FG, Alvares K, Reddy JK, Subramani S, Rachubinski RA, Capone JP (1992) Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase. Proc Natl Acad Sci USA 89, 7541-7545