Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes

Journal of Immunological Methods, 129 (1990) 175-185 Elsevier

175

JIM 05558

Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes Detection of single base mismatches L. Fugger

1,2, N.

Morling 1, L.P. Ryder

1, N.

Odum I and A. Svejgaard 1

I Tissue Typing Laboratory of the Department of Clinical Immunology, and 2 Research Center for Immunological Biotechnology, State University Hospital (Rigshospitalet), Copenhagen, Denmark

(Received 5 September 1989, revised received 10 January 1990, accepted 19 January 1990)

The polymerase chain reaction (PCR) is an effective method for in vitro D N A amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of H L A - D P typing with the technique. D N A from mononuclear nucleated cells was extracted with either a simple salting out method or phenol/chloroform. Both D N A s could be readily used for PCR. The MgC 2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgC12 concentration and the temperature must be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the D N A template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base mismatches may be detected in the PCR and typing for H L A - D P gene variants, which differ for only one base, may be performed. Key words: Polymerase chain reaction; Allele-specificamplification; HLA-DP typing

Introduction The class II loci of the human major histocompatibility complex (MHC), the HLA system, encode at least three polymorphic series of transmembranous glycoproteins which are constitu-

Correspondence to: Lars Fugger,Tissue Typing Laboratory, 7631, Rigshospitalet, 20 Tagensvej, DK-2200 Copenhagen N, Denmark. Abbreviations: PCR, polymerase chain reaction; MHC, major histocompatibility complex; PLT, primed lymphocyte typing; RFLP, restriction fragment length polymorphism; PP, primer pair.

tively expressed on the cell surfaces of B lymphocytes and macrophages and can be induced on many other cells by interferon-3,. The class II molecules of the DR, DQ, and DP series are each composed of two distinct subunits, a and t , which fold together to form a molecule that present intracellularily processed peptides (antigens) to T lymphocytes. The polymorphism in class II molecules is localized primarily to the N H 2 terminal outer domains, which are encoded by the second exons and are thought to interact with the T cell receptor (TcR) and antigen peptide fragments (Babbitt et al., 1985, Buus et al., 1986; Trowsdale 1987). Accordingly, it is important to study the

0022-1759/90/$03.50 © 1990 Elsevier Science Publishers B.V. (Biomedical Division)

176 polymorphism of these domains in order to explore the genetics of the immune response. A novel technique, the polymerase chain reaction (PCR) for in vitro amplification of specific D N A sequences (Saiki et al., 1988), has previously been introduced in the investigation of the genetic polymorphism of the H L A class II loci (Saiki et al., 1986; Todd et al., 1987; Bugawan et al., 1988; Gyllensteen et al., 1988; Horn et al., 1988). The PCR includes a three-step cycling process: (i) denaturation of double-stranded D N A into single stranded DNA; (ii) annealing (binding) of an oligonucleotide primer pair, one primer on each side of the D N A segment to be amplified; and (iii) primer extension, i.e., construction of a new D N A strand which is complementary to the original D N A strand between the primers. A typical cycle takes about 4 - 6 rain and is repeated about 30 times. The PCR reaction mixture contains buffers, nucleotides, primer pairs, D N A polymerase, and DNA. The denaturation step at about 9 5 ° C separates the complementary strands of DNA. To obtain annealing of primers to the dissociated D N A strands, the reaction is cooled to about 55 ° C. A primer is a single stranded oligonucleotide complementary to one of the original D N A strands. Each primer of a primer pair is complementary to opposite strands at either the 'left' (5' terminal) or the 'right' (3' terminal) side of the sequence of interest and are oriented so that the Taq DNA polymerase proceeds across the region between the primers. The primer pairs are present in vast molar excess in order to ensure that the primers anneal to the dissociated strands rather than the strands reanneal to each other when the reaction is cooled. Once annealing has occurred, the reaction is heated to about 70 o C, where the heat resistant D N A polymerase of Thermus aquaticus, the Taq polymerase, has optimum activity. During the transition from annealing to extension temperature, poorly matched primer-template hybrids dissociate and only highly complementary hybrids will remain. The Taq polymerase incorporates nucleotides complementary to those in the unpaired D N A onto the annealed primer, resulting in synthesis of a new copy of the targetted D N A segment. Repeated cycles result in an exponential accumulation of the specific target sequence. After about 30 cycles, the reaction is

terminated and, for many purposes, the amplified D N A segment is ready for use. The amplified segment can be e.g. analysed by DNA sequencing, used for hybridization techniques using labelled oligonuclotide probes, or analysed in simple agarose gels which permit determination of the size of the fragment. Typing for H L A - D R and H L A - D Q alleles has, in general, been performed with serological techniques, while H L A - D P typing has been based on a cellular technique known as primed lymhphocyte typing (PLT). However, because the PLT technique is time-consuming and typing reagents are difficult to generate, PLT typing is performed only in a few laboratories. The investigation of the polymorphism of the H L A - D P locus has thus received much less attention compared with the H L A - D R and H L A - D Q loci. Recent studies using primed T lymphocytes (Odum et al., 1986, 1987), restriction fragment length polymorphism (RFLP) (Bodmer et al., 1987; Hyldig-Nielsen et al., 1987; Mitsuishi et al., 1987, Maeda et al., 1988; Simons et al., 1989), and D N A sequencing (Lee et al., 1989) indicate, however, that the DP region is more polymorphic than the D P w l - w 6 alloantigens, currently defined by cellular techniques. In a previous study (Bugawan et al., 1988), the sequence variations of the polymorphic second exon of the H L A - D P A and DPB genes were analysed using in vitro enzymatic amplification of the DPA and DPB loci in combination with a D N A sequencing technique. The DP polymorphism was primarily localized to the DPB locus where 14 allelic variants were identified. Typing for individual alleles were based on dot blot and oligonucleotide probe hybridization techniques. The technique is, however, not optimal for HLADP gene typing (or typing for other allelic series with few D N A base substitutions in a number of different hypervariable regions), because a large number of different probes must be used. We have developed a system in which the PCR step includes specificity for the alleles to be amplified. In cases where probes cannot distinguish between two H L A - D P alleles, the oligonucleotide primers of the PCR step may be constructed in such a way that they will only amplify one of the alleles, i.e., allele-specific amplification of H L A - D P (Fugger et al., 1989).

177 During the development of the method, several technical problems were met, and here we report on some of the major methodological aspects of allele-specific amplification of H L A - D P alleles.

Materials and methods

DNA preparation Genomic D N A was extracted from peripheral white blood cells from healthy individuals either using the p h e n o l / c h l o r o f o r m / i s o a m y l alcohol approach as described by BiShme et al. (1983) or by salting out with a saturated (approximately 6 M) NaC1 solution (cf. below).

annealing) and, 2 min at 72 ° C (primer extension). After the last cycle, all samples were incubated for an additional 7 min at 7 2 ° C to ensure that the final extension step was complete. Samples were subsequently cooled to 4 ° C and stored at this temperature for subsequent manipulations (Saiki et al., 1988). From each PCR product 10 /~1 of amplified D N A was supplemented with 2 /~1 of 12.5% sucrose, 0.5% sodium dodecyl sulfate (SDS), and 0.1% bromphenolblue in 50 mM Tris-50 mM EDTA buffer, electrophoresed on a composite gel of 3% NuSieve (FMC BioProducts, Rockland, ME) and 1% SeaKem (FMC BioProducts, Rockland, ME) agarose and stained with ethidium bromide.

Spotting of DNA PCR The D N A was amplified by PCR with the following primer pairs (PP): PP1 (VYQL-2-EAV, PP2 (VYQL-1-EAV), PP3 (VYQL-3 and EAV), or PP4 ( L F Q G - G P M ) (Table I). Amplification took place in 100/tl reaction mixtures containing 1 #g of genomic D N A in 50 mM KC1, 10 mM Tris (pH = 8.4), 1.5, 3.0, 5.0, 7.0 or 10.0 mM MgC12, using each primer at 1 #M, each d N T P (dATP, dCTP, dTTP, dGTP) at 200 /~M, gelatin at 200 # g / m l , and 2.5 U of Taq D N A polymerase (Perkin-Elmer Cetus, Norwalk, CT). The samples were overlaid with 100 /~1 of mineral oil to prevent condensation. Samples were subjected to a total of 35 cycles of amplification in a programmable heat block (Perkin-Elmer Cetus, Norwalk, CT), with individual cycle consisting of 2 min at 94 o C (DNA denaturing), 2 rain at 55, 59, 63, or 71°C (primer TABLE I O L I G O N U C L E O T I D E P R I M E R S A N D PROBES

1 /~1 of the amplified D N A was suspended in 1 vol. of 0.4 M N a O H and spotted manually on Zeta-Probe nylon membrane (Bio-Rad Laboratories) prewetted in distilled water. The D N A was alkaline fixed to the membrane according to the manufacturer's instructions.

Hybridization Membranes were prehybrized for at least 2 h at 45 o C in 5 x sodium chloride/sodium citrate (SSC) (1 × SSC = 0.15 M NaC1/0.015 M Na2-citrate, p H = 7.0), 20 mM sodium phosphate (pH = 7.0), 10 × Denhardt's solution, 7% SDS, and 100/~g/ml heat-denatured salmon sperm DNA. Hybridization was performed overnight in the prehybridization solution supplemented with 50% dextran sulfate to a final concentration of 10% and approximately 10 n g / m l 3zp-labelled oligonucleotide probe. The membranes were washed for 1 h at 45 ° C in 3 × SSC, 10 mM sodium phosphate (pH = 7.0), 10 × Denhardt's solution, and 5% SDS, and for 1 h at 5 0 ° C 1 × SSC and 1% SDS.

For reactivity of probes, see Fig. 1. Primers: VYQL-I: VYQL-2: VYQL-3: EAV : LFQG : GPM :

A utoradiography 5' 5' 5' 5' 5" 5'

ATTACGTGTACCAGTTACG AGAATTACGTGTACCAGTT GAGAATTACGTGTACCAGT TGCAGGGTCACGGCCT ATTACCTTTTCCAGGGACG CCGGGTACTGGGACGT

Probes: K : 5' AGGAGAAGCGGGCAGT E : 5' AGGAGGAGCGGGCAGT

3' 3' 3' 3' 3' 3'

3" 3'

Autoradiography was performed on X-Omat A R film (Kodak) with intensifying screen for 2 - 2 4 h.

Southern blot Southern blots were performed as recently described (Fugger et al., 1989). Briefly, after gel electrophoresis the amplified D N A was transferred onto H y b o n d - N nitrocellulose filters

178 i0

20

I

30

I

40

I

50

I

60

I

70

I

80

I

90

I

I

ENYvYQLRQECYAFNG~QRFLERYIYNREEF~RFDSDVGEFRAVTELGRPDED-~WNSQKDLLEEKRAVPDR~CRHNYELDEAVTLQRR

DPB3: DPB6: DPBII: DPBI:

...............................................................

E......

M. . . . . . . . . . . . . .

...........................

R. . . . . .

M. . . . . . . . . . . . . .

.....

DPBI0: DPBg: DPBI2: DPB8: DPB5: DPB7:

Q-YA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

G .......................

YA

..................

---H

...............................................

---H ---H

AAE

.......

I ......................... I---E

.....................

.......................................................

I---E

.....................

.......

I---E

.........

I---E

.......................

G .........

S .....................................

LF-G

.............................................

LF-G

.......................

--LF-G

E .......

D .......

L ...................

R .............

EAE

.......

I ..........

........................

A ..................

AAE

.......

I ...........................

M ................

A ..................

AAE

DPB4.1:

LF-G

........................

.......

I ..........

M .......

GGPM---

DPB4.2:

LF-G

.............................................

E .......

I ..........

M .......

GGPM---

.............................................

E .......

I---E

......

M .......

GGPM

.....

.......

I---E

......

M .......

GGPM

.....

DPB2.1:

--LF-G

DPB2.2:

LF-G

VYQL-I:

.......................

...... ......

>

VYQL-3:

......

>

:

......

EAE

>

VYQL-2:

LFQG

L ...................

K/E

>

EAV:

< .....

GPM:

< .....

:

Fig. 1. A l i g n m e n t of the p r o t e i n sequences of the s e c o n d exon of d i f f e r e n t H L A - D P B genes. T h e s e q u e n c e s are expressed in the s t a n d a r d one-letter a m i n o acid code a n d aligned to the D P B 3 allele. A dash i n d i c a t e s i d e n t i t y w i t h the p r o t o t y p e D P B 3 allele a n d a space i n d i c a t e s t h a t the sequence was n o t d e t e r m i n e d . T h e p o s i t i o n s are for the m a t u r e p e p t i d e subunits. T h e p o s i t i o n s of P C R a m p l i f i c a t i o n primers, VYQL-1, VYQL-2, VYQL-3, L F Q G , EAV, a n d G P M are i n d i c a t e d w i t h arrows, a n d the p o s i t i o n s of the

oligonucleotideprobes E and K are indicated with horizontal bars. The designations of the alleles are shown at the left (modified from Bugawan et al., 1988).

(Amersham). Hybridization of the filters was for 48 h at 4 2 ° C in plastic bags with a total volume of 20 ml of 50% ( v / v ) formamide, 5 x sodium chloride/sodium p h o s p h a t e / E D T A (SSPE) (1 x S S P E = 1 8 0 mM N a C I + 1 0 mM N a H 2 P O 4 + 1 m M EDTA), 0.2% Ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, 5% ( w / v ) dextran sulfate, and the radiolabelled probe (10 ng/ml). After hybridization, the filters were washed twice for 5 rain each in 2 × SSPE 0.5% SDS at room temperature and twice for 30 rain each, in 0.2 × SSPE + 0.5% SDS at 65 o C.

DPw4 (PP4) alleles (Fugger et al., unpublished observations) on the one hand or DPw3 and DPw6 (PP1-3) alleles on the other hand (Fugger et al., 1989). The same published sequences were used to design probes specific to two different sequences in the amplified DPB gene segments. These sequence-specific oligonucleotides (Table I) were, when possible, chosen to have destabilizing mismatches (i.e., mismatches between probe and genomic D N A which destabilize the hybrid) with closely related sequences (Fig. 1).

Primers Oligonucleotide primers and probes Oligonucleotides were synthesized in a Biosearch model 8600 D N A synthesizer in the laboratory of Otto Dahl, Department of Organic and General Chemistry, the H.C. I21rsteds Institute, University of Copenhagen. Recently published D N A sequences (Bugawan et al., 1988) were used to design primers either specific for DPw2 and

All PPs consisted of primers complementary to sequences at the 5' end and Y end, respectively, of the second exon of the DPB gene (Figs. 1 and 2). VYQL (VYQL-3) and EAV primers amplify D N A segments of about 255 basepairs (bp) (including primers). Figs. 1 and 2 show that the VYQL primers were placed where the common sequence of DPw3 and w6 alleles differs from the other

179

i0

15

I AS

I

nTyrValTyrGlnLeuArgG

GAGAATTACGTGTAC

DPB3: DPB6: DPBII: DPBI:

80

inGluCys

CAGTTACGGCAGGAATGC

85

[

90

I

.....

AsnTyrG

I

luLeuAspGluAlaVa

iThrLeuGlnArgArg

.....

AACTACGAGC

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

. . . .

-- .

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

. . . .

-- .

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

- - - - - - C

.

.

.

.

.

.

DPB9:

-

.

.

.

.

.

.

DPB8:

C-T-T

....

GG

.............

. ....

- ................................

C-T-T

....

GG

.............

. ....

- ................................

C-T-T

....

GG

.............

. ....

- ......................................

DPB4.1:

C-T-T

....

GG

.............

. ....

- ............

G--G-C--A

...........

DPB4.2:

C-T-T

....

GG

.............

. ....

- ............

G--G-C--A

...........

C-T-T

....

GG

.............

. ....

- ............

G--G-C--A

...........

C-T-T

....

GG

.............

. ....

- ............

G--G-C--A

...........

DPBI0:

DPB5: ........

DPB7:

........

DPB2.1: DPB2.2:

-

C

.

.

.

.

.

.

.

.

. . . .

-

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

•

. . . .

-

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

•

. . . .

-

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

AATTACGTGTACCAGTTACG

VYQL-I:

AGAATTACGTGTACCAGTT

VYQL-2: VYQL-3:

LFQG

-

G G

TGGACGAGGCCGTGACCCTGCAGCGCCGA

EAV:

TCCGGCACTGGGACGT

GPM:

CCGGGTACTGGGACGT

GAGAATTACGTGTACCAGT

:

ATTACCTTTTCCAGGGACG

Fig. 2. Alignment of the nucleotide sequences from the 5' and 3' end of the second exon of the the H L A - D P B genes. Positions for the DPB3 allele are shown relative to the start of the mature peptide. A dash indicates identity with the prototype DPB3 allele and a space indicates that the sequence was not determined. The positions and the nucleotide sequences of the primers used to ampfify segments of genomic D N A are shown at the b o t t o m (modified from Bugawan et al., 1988).

known DP alleles. Because of close sequence homology between the different DPB alleles in the 3' end of the second exon, the EAV primer could not be designed to be specific for DPw3 and w6 alleles, and it binds to all other known DP alleles except DPw2.1, 2.2, 4.1 and 4.2. L F Q G and G P M primers amplify a 256 bp DNA segment (including primers). Figs. 1 and 2 show that the GPM primer was placed where the common sequence of DPw2 and w4 alleles differs from the other known DP alleles. Because of close sequence homology between the different DPB alleles in the 5' end of the second exon, the L F Q G primer could not be designed to be specific for DPw2 and w4 alleles, and is common with DPB5, 7, and 8. Probes The sequences of the probes are shown in Table I and Fig. 1. The K probe is complementary to a

sequence common to DPB3, 1, 4.1, 4.2, 5, and 7, and the E probe to DPB6, 2.1, 2.2, 8, 9, 10, and 12 (Bugawan et al., 1988).

Results

DNA preparation methods In order to study the influence of the procedure for DNA preparation from peripheral blood cells on the PCR product, D N A was, in separate sets of experiments, prepared in two different ways. The procedures used before and after DNA preparation were common to both approaches. Briefly, the initial lysing of cells, isolation of nuclei, lysis of nuclear membranes and protein digestion were performed using Triton X-100, SDS and proteinase-K (B~Shme et al., 1983). In the one preparation procedure, D N A was extracted using the phenol/chloroform/isoamyl alcohol approach as

180 described by B~Shme et al. (1983). In the other procedure, the p h e n o l / c h l o r o f o r m / i s o a m y l alcohol steps were totally omitted and substituted with saturated NaC1 (about 6 M) (Miller et al., 1988). The solubilized nuclei from 20 ml of blood were shaken vigorously with 3.5 ml saturated NaC1 for 15 s and centrifuged for 15 rain at 1500 × g. The supernatant was carefully transferred to new tubes in which D N A was precipitated with one volume of isopropanol. We found no detectable difference in yield or quality of extracted D N A between these two methods in more than 100 preparations. Both D N A s could readily be used for Southern blot and R F L P studies. Furthermore, the PCR product was not influenced by the preparation method as judged from electrophoretic examination of ethidium bromide stained gels, Southern blot, and dot blot analysis. In the following studies, however, we used D N A which previously had been prepared by the phenol/chloroform/isoamyl alcohol method and stored at 4 o C. Concentration of MgCI 2 in PCR reaction mixture We studied the influence of the concentration of MgC12 in the PCR reaction mixture when using the two different primer pairs PP1 and PP4. The concentration of MgCI 2 was varied (1.5, 3, 5, 7, and 10 mM) for both primer pairs. The profile of the PCR thermal cycle was held constant for both primer pairs with individual cycles consisting of 2 min at 9 4 ° C ( D N A denaturing), 2 min at 5 5 ° C (primer annealing), and 2 min at 7 2 ° C (primer extension). A total of 35 cycles of amplification were performed. Two parameters were employed to evaluate the influence of MgC12 concentration on the specificity and yield of the in vitro amplification. First, the PCR product was electrophoresed in ethidium bromide stained agarose gels in order to see whether or not the size of the amplified product was homogeneous. Secondly, dot blot analysis of the amplified products with radioactive labelled oligonucleotideprobes was performed in order to determine (i) whether or not the product contained the expected sequence, and (ii) yield of the amplification (i.e., size and density of dots on autoradiograms). In all cases, gel inspection revealed more than one single band of the expected size. The additional bands were of both higher and lower

267 234

i

t

Fig. 3. Electrophoretic examination of ethidium bromide stained PCR amplification product. DNA from one person was amplified with the primer pair PP1 using five different MgC12 concentrations: 1.5 mM, 3 raM, 5 mM, 7 raM, and 10 mM (lanes 1-5) in the PCR buffer. The 'correct' band is 255 bp long. Southern blot analysis with the K oligonucleotide probe resulted in hybridization to only the fragment of 255 bp.

molecular weights than the expected segment. We observed increasing numbers of extra bands in the gels as the MgC12 concentration was increased. Southern blot analysis with the K oligonucleotide probe resulted, however, in hybridization to only the fragment of expected size. With PP1 (Fig. 3), we observed no bands in the gel at 1.5 mM MgC12, several bands at 3 m M and 5 mM including the 'correct' band, the 3 mM bands being faintest, and multiple bands at 7 mM and 10 mM MgC12. With PP4, several bands, including one of the expected size, appeared at a low MgC12 concentration (1.5 mM). At higher MgC12 concentrations, an increasing number of bands were observed. In order to estimate the yield of the PCR, we performed dot blot analyses. The yields of the in vitro amplifications were evaluated by the size and intensity of the dots on autoradiograms. The MgCI 2 concentration which, judged from the dot TABLE II PCR YIELD WITH DIFFERENT MgCI2 CONCENTRATIONS Yield of PCR reaction estimated from the size and density of the dots on autoradiogram. + + + : high yield; - : no yield. VYQL * is VYQL1-3. Primerpair

MgC12concentration (mM)

1.5 VYQL*-EAV(PP1-3) LFQG-GPM (PP4) +++

3.0 5.0 7.0 10.0 ++ +++ + . . . .

181

blots, appeared to be optimal was the same as the one which gave fewest bands in the ethidium bromide stained gel. An optimal MgC12 concentration existed for both PPs, and changing these conditions caused reduction or even disappearance of the signals (Table II). Thus, the optimal MgC12 concentration was about 1.5 m M for PP4 while it was about 5 mM for PP1. For PP1, weaker signals were obtained with two of the other MgC12 concentrations employed, while PP4 only gave a signal at 1.5 mM. None of the PPs used in this study gave dot blot signals at 10 m M MgC12-

Influence of primer anneafing temperature Saiki et al. (Saiki et al., 1988) have reported that the primer annealing temperature is an important parameter in the specificity of the PCR. On the basis of this and our own studies showing that MgC12 is also an important parameter, but obviously not the only one influencing the specificity of the PCR, the effect of the primer annealing temperature on specificity and yield was studied in separate sets of experiments. The MgC12 concentration in the PCR reaction mixture was 1.5 m M for PP4 and 5 mM for PP1. Two approaches were taken: first, for both primer pairs the annealing temperature in the thermal cycle was increased from 5 5 ° C to 71°C with intervals of 4 ° C in four separate experiments. The samples were heated from the respective annealing temperature to 7 2 ° C as fast as possible and incubated at that temperature for 2 rain, heated over a 1 min period to 9 4 ° C and incubated for 2 rain, cooled as fast as possible (about 30 s) to the respective annealing temperature and incubated for 2 min. The second approach employed four different annealing temperatures as well, but differed from the first approach in that the cooling time from 94 ° C to the respective annealing temperature was extended to two minutes and the incubation at the annealing temperature was omitted. From the number and the brightness of the bands in the ethidium bromide stained gels and from the size and density of dots, different optimal annealing temperatures for PP4 (59 ° C) and PP1 (63°C) were estimated. The fewest and brightest bands, including the amplified segment,

~iiitrl ~ ¸~ li ~I~¸¸ ~i/!,l~i~

'

~ ~ ii~ ~iiiiiiiii!J!! !¸ il ii ! .... l~i!i ¸ ~!li!iiiii~i~!ii i ~il ~ii~triii~¸ : ilil¸~!iilil

i~ii

..........

1

2

3

4

I

I l ,

...........

5

I

Fig. 4. D o t blot analyses of the influence of P C R a n n e a l i n g t e m p e r a t u r e o n the a m p l i f i c a t i o n product. D N A from one p e r s o n was a m p l i f i e d w i t h the p r i m e r p a i r PP1 u s i n g five different a n n e a l i n g t e m p e r a t u r e s : 5 5 ° C , 5 9 ° C , 6 3 ° C , 6 7 ° C a n d 7 1 ° C (dots 1-5). 1 #1 of the a m p l i f i e d D N A was s p o t t e d on a n y l o n m e m b r a n e a n d h y b r i d i z e d to a r a d i o a c t i v e l a b e l l e d specific o l i g o n u e l e o t i d e p r o b e a n d a u t o r a d i o g r a p h e d .

appeared at 5 9 ° C and 6 3 ° C for PP4 and PP1, respectively. At the higher annealing temperatures, bands appeared with decreasing brightness and disappeared at 6 7 ° C and 71 ° C, respectively (Fig. 4). At lower annealing temperatures, the number of bands increased. At the above Optimal annealing temperatures, dot signals could be obtained after 2 h of exposure, whereas annealing at the nearest alternative temperatures required at least 24 h of exposure in order to obtain sufficient dot intensity. Extension of the interval between the D N A denaturing temperature (94 o C) in the PCR and the relevant annealing temperature to 2 min only marginally increased the specificity and yield of the PCR.

Influence of mismatches The sequenced D P w 3 / D P w 6 and D P w l alleles differ only at APt position 11 in the N H 2 terminal end of the second exon of the DPB gene (Fig. 1). Initially, the primer pair PP2 (VYQL-1 and EAV) were designed in order to obtain allele-specific amplification on only DPw3 and DPw6 alleles. The EAV primer is common to both D P w 3 / w 6 and D P w l alleles. In the VYQL-1 primer the last three bases (ACG) at the 3' end are complementary to both DPw3, w6, and wl alleles, while the base differences between D P w 3 / D P w 6 and D P w l are at positions 4 and 5 counted from the 3' end. When hybridizing the E probe to the amplified products, we observed positive signals from alleles carrying not only the DPw3 but also the D P w l specificity. Thus, cross-amplification of the DPwl allele had occurred although the complementarity between the DPwl allele and the primer was incomplete. We attempted to avoid cross-amplifica-

182

tion by increasing the stringency of the hybridization conditions between primer and template. First, we increased the annealing temperature in the heating cycle from 5 5 ° C to 71°C with intervals of 4 ° C in four separate experiments, and secondly, we combined the increase of the annealing temperature with extension of the interval between the D N A denaturing temperature (94 o C) step in the PCR and the relevant annealing temperature from 30 s to 2 min. Neither of these two approaches was sufficient to avoid cross-amplification of DPwl alleles as judged by hybridization signals from the E probe. At an annealing temperature of 71 ° C, no amplification occurred of DPw3 or DPwl alleles indicating that the conditions for primer annealing were too stringent. In another attempt to avoid cross-amplification of the DPwl allele, we substituted the 'left hand' primer, VYQL-1, with VYQL-2, or VYQL-3 and kept the EAV primer as the 'right hand' primer (Table I, Figs. 1 and 2). These two modified VYQL primers differed only slightly at the 3' and 5' terminal ends compared to the VYQL-1 primer. VYQL-2 differed from VYQL-1 only in that VYQL-2 is three nucleotides shortened at the 3' end and three nucleotides extended at the 5' end. VYQL-3 differ from VYQL-2 only in that VYQL-3 is one nucleotide shortened at the 3" end and one nucleotide extended at the 5' end. The essential difference (Fig. 5) between VYQL-1 on the one hand and VYQL-2 and VYQL-3 on the other is that the last two, nucleotide(s) at the 3' end of the VYQL-2 and VYQL-3 primer are complementary only to the DPw3 and w6 alleles but not to the DPwl allel (which carries the base pair G G in this position). This means that the 3 ' - O H terminal of VYQL-1 and VYQL-2 primers are complementary to the DPw3 and DPw6 alleles but not to the DPwl alleles. As judged from hybridization signals with the K probe, cross-amplification of DPwl alleles were avoided using the VYQL-2 and the VYQL-3 primers. However, while crossamplification was avoided with the VYQL-2 primer at an annealing temperature of 55 o C, the annealing temperature had to be increased to 63 o C for the VYQL-3 primer in order to obtain the same primer specificity. Thus, single C-T mismatch stringency conditions have to be titrated more carefully than two C-T mismatches. Amplifi-

VYQL-1 + + + AMPLIF, DPw3

EAV

+ + AMPLIF. DPw I

EAV

VYQL-2 C

+ + + AMPLIF. DPw3

EAV

DPwl

EAV

VYQL-2~ D

+

AMPLIF.

--

AMPLIF.

VYQL-> ~k E DPwl

EAV

Fig. 5. Schematic representation of the allele-specific amplification approach detecting single base mismatches. *, indicates one base mismatch between primer and chromosomal DNA. For details, see text.

cations of the DPw6 alleles were not influenced by the three different designs of the VYQL primer as judged by dot blot hybridization with the E probe. No cross-amplification was observed using the primerpair specific for DPw2 and DPw4 alleles and eight different oligonucleotide probes each complementary to different allelic sequences of the second exon of the DPB gene (data not shown).

Discussion

We have studied some of the technical aspects of allele-specific amplification (PCR) of human genomic D N A in order to develop a highly discriminatory dot blot system which can identify variants of H L A - D P (Fugger et al., 1989). The variability of H L A - D P is caused by a small num-

183

ber of D N A base substitutions in a few variable regions (Bugawan et al., 1989). When such small differences are to be detected with hybridization techniques it is necessary to use a combination of oligonucleotide probes and PCR amplified DNA. Whilst establishing the H L A - D P typing system, we observed that the PCR step could discriminate between single base substitutions. It is, however, necessary to optimize the reactions for each amplification system, as discussed below. A practical problem is the extraction of D N A from blood samples. Currently used standard D N A preparation methods employ phenol and chloroform to deproteinize the aqueous solution containing the desired DNA. In an attempt to minimize the use of organic solvents, we have compared this method with a more convenient method, in which a saturated NaC1 solution substitutes phenol and chloroform for the separation of proteins from DNA. We found no detectable difference in the yield or quality of the extracted D N A obtained by two methods. D N A prepared by both methods could readily be used for Southern blot ( R F L P studies) and in vitro D N A amplification. However, several advantages are associated with the use of the NaC1 approach. First, the toxicity of organic solvents is avoided and secondly, the method is much cheaper, less time consuming and easier to handle than the phenol/chloroform method. The steps in the PCR are influenced by a number of factors of which the MgC12 concentration and the primer annealing temperature are of major importance and easy to control. In order to study the influence of MgCI 2 concentration on PCR specificity and yield, this parameter was varied between 1.5 and 10 m M in the reaction mixture for both PPs. The electrophoretic examination of the PCR products showed generally increasing numbers of bands as the MgC12 concentration was increased, indicating an increased non-specific binding of the primers to irrelevant parts of the D N A with increasing concentrations of MgC12. Although the number of these bands could be reduced by lowering the MgC12 concentration, they could not, with the heating cycle profile used, be converted to just one single band representing the target D N A segment. Southern blotting and hybridization with the K probe re-

vealed only the fragment of expected size, confirming that the extra bands represent non-specific amplification. On the basis of PCR specificity and yield, the optimal MgC12 concentrations for the primers used in this study were about 1.5 and 5 mM, respectively. We have found for other PPs amplifying segments of the DPB gene, DQB gene, and HIV-1 genome that the optimal MgC12 concentration is also between 1.5 and 5 mM. We suggest that the MgC12 concentration is titrated between 1.5 and 5 mM for 16-20 mer primer pairs. Saiki et al. (1989) have reported that the primer annealing temperature is an important parameter in the specificity of the PCR. In amplification of the fl-globin gene it was demonstrated that raising the primer annealing temperature from 4 0 ° C to 5 5 ° C resulted in a significant improvement in specificity. We studied the effect of the primer annealing temperature on specificity and yield in separate sets of experiments. Two approaches were taken, both based on the rationale that by increasing the stringency of hybridization conditions between primer and template, perfect matches between primer and template would preferentially occur. This should reduce the number of non-target priming events, partly because primers would be used preferentially for 'correct' priming events and partly because these events would be templates for exponential amplification. Estimated from the number of bands in ethidium bromide stained gels (i.e., specificity) and the size and density of the dot signals (i.e., yield), we found that the optimal primer annealing temperatures were 5 5 ° C and 63°C, respectively, for the PPs used in this study. Furthermore, we found that the specificity could be increased by extension of the cooling time between denaturation and primer annealing temperature. Thus, the primer annealing temperature should be 'titrated' for the individual primer pairs, for example between 5 5 ° C and 6 7 ° C with intervals of 4 ° C . If annealing under these condition does not occur, we recommend that primer annealing is lowered to 50 °C, 45 °C, or 40 °C. The use of a too low annealing temperature results in non-specific priming which leads to a reduced number of primers left for correct priming thus affecting both the specificity and the yield of the PCR. Too

184 high an annealing temperature results in too stringent conditions for the binding of the primer to the template which results in a reduced yield (but not necessarily in specificity). In all cases of detectable amplification, we observed more than one single band of relevant size in the ethidium bromide stained gel indicating that parameters other than the concentration of MgC12 and primer annealing temperature should be adjusted for individual primer pairs. In order to improve the specificity of the PCR, we are currently studying the influence of the concentrations of dNTP, primers and KC1 in the reaction mixture, and reduced incubation times (i.e., < 2 min for segments about 250-300 bp long) at the annealing and extension temperatures. In an attempt to obtain allele-specific amplification of D P w 3 / D P w 6 alleles and avoid crossamplification of D P w l alleles, we used P C R primers that formed mismatches with the D P w l allele but perfect matches with the DPw3 and DPw6 alleles (Fugger et al., 1989). These primers had either two C-T mismatches near the 3' end on the one hand or, on the other hand, one or two C-T mismatches at the very 3' end. We observed that the primers with one or two mismatched 3' end residues did not function as primers for the Taq polymerase under appropriate annealing conditions, whereas the primer with two mismatches of three nucleotides from the 3' end only affected the reaction to a much lesser extent and for allele-specific amplifications which were not useful. The Taq polymerase is well suited for the discrimination of alleles that differ by one or two nucleotides because this polymerase has no 3' ~ 5' exonuclease activity. Such an activity would digest the mismatched primer-template region and then permit efficient priming with the shortened primer. Wu et al. (1989) previously reported that one A-A or T - T mismatch permits effective discrimination in allele-specific amplification of fl-globin genomic D N A for the diagnosis of sickel cell anemia. Our data provide evidence that single C-T mismatches are also effective in obtaining allelespecific amplification. This is in accordance with the observations of Newton et al. (1989), who were able to demonstrate the volume of allelespecific amplification in the diagnosis of aa-anti-

trypsin deficiency. Newton et al. (1989) also reported that G-T, T-G, A-C and C-A mismatches (all purine-pyrimidine mismatches) at the 3' end of primers are much less refractory to extension by the Taq polymerase. In those instances where a single 3' end mismatch does allow amplification, the introduction of additional deliberate mismatches near the 3' end of appropriate primers ameliorates this problem. This approach might also prove to be most useful in H L A typing by PCR.

Acknowledgements We thank Ms. Ewa Szojmer, Ms. Ingrid Alsing, and Ms. Pia Jensen for skillful technical assistance. Ms. Britta Dahl and Dr. Otto Dahl, Department of Organic and General Chemistry, the H.C. IDrsteds Institute, University of Copenhagen, are acknowledged for synthesizing the oligonucleotides. Lars Fugger is the recipient of a fellowship from the Research Center For Immunological B i o t e c h n o l o g y , State U n i v e r s i t y H o s p i t a l (Rigshospitalet), Copenhagen, Denmark. The work was partly supported by the Danish Biotechnology Programme, the Danish Medical research Council, the Danish Multiple Sclerosis Society, and the Danish Rheumatism Association.

References Babbitt, B.P., Allen, P.M., Matsueda, G., Haber, E. and Unanue, E.R. (1985) Binding of immunogenic peptides to la histocompatibility molecules. Nature 317, 359-361. Bodmer, J., Bodmer, W., Heyes, J., So, A., Tonks, S., Trowsdale, J. and Young, J. (1987) Identification of HLA-DP polymorphism with DPa and DPfl probes and monoclonal antibodies: Correlation with primed lymphocyte typing. Proc. Natl. Acad. Sci. U.S.A. 84, 4596-4600. B~hme, J., Owerbach, D., Denaro, M., Lernmark, ,~., Peterson, P.A. and Rask, L. (1983) Human class II major histocompatibility antigen a-chains are derived from at least three loci. Nature 301, 82-84. Bugawan, T.L., Horn, G.T., Long, C.M., Mickelson, E., Hansen, J.A., Ferrara, G.B., Angelini, G. and Erlich, H.A. (1988) Analysis of HLA-DP allelic sequences polymorphism using the in vitro enzymatic DNA amplification of DP-a and DP-fl loci. J. Immunol. 141, 4020-4030. Buus, S., Colon, S., Smith, C., Freed, J.H., Miles, C. and Grey H.M. (1986) Interaction between "processed" ovalbumin

185 peptide and Ia molecules. Proc. Natl. Acad. Sci. U.S.A. 83, 3968-3971. Fugger, L., Morling, N., Ryder, L.P., Platz, P., Georgsen, J., Jakobsen, B.K. and Svejgaard, A. (1989) NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNFa) region in primary biliary cirrhosis and in healthy danes. Scand. J. Immunol. 30, 185-190. Fugger, L., Morling, N., Ryder, L.P., Odum, N., Georgsen, J. and Svejgaard, A. (1989) Typing for HLA-DPw3 and w6 using allele-specific DNA in vitro amplification and allelespecific oligonucleotide probes, Detection of 'new' DPw6 variants. Immunogenetics, in press. Gyllensteen U.B. and Erlich, H.A. (1988) Generation of single-stranded DNA by by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc. Natl. Acad. Sci. U.S.A. 85, 7652-7656. Horn, G.T., Bugawan, T.L., Long, C.M. and Erlich, H.A. (1988) Ailelic sequence variation of the HLA-DQ loci: Relationship to serology and to insulin-dependent diabetes susceptibility. Proc. Natl. Acad. Sci. U.S.A. 85, 6012-6016. Hyldig-Nielsen, J.J., Morling, N., Odum, N., Ryder, L.P., Platz, P., Jakobsen, B.K. and Svejgaard, A. (1987) Restriction fragment length polymorphism of the HLA-DP subregion and correlates to HLA-DP phenotype. Proc. Natl. Acad. Sci. U.S.A. 84, 1644-1648. Lee, J.S., Sartoris, S., Briata, P., Choi, E., Cullen, C., Lespalier D. and Yunis, I. (1989) Sequence polymorphism of HLADP beta chains. Immunogenetics 29, 346-349. Maeda, M., Inoko, H., Ando, A., Uryu, N., Nagata, Y. and Tsuji, K. (1988) HLA-DP typing by analysis of DNA restriction fragment length polymorphisms in the HLA-DPfl subregion. Hum. Immunol. 21,239-248. Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 15, 859. Mitsuishi, Y., Urlacher, A., Tongio, M.-M. and Mayer, M. (1987) Restriction fragment length polymorphism of DP genes defines three new DP alleles. Immunogenetics 26, 383-388.

Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C. and Markham, A.F. (1989) Analysis of any point mutation in DNA. The amplification refractory system (ARMS). Nucleic Acids Res. 17, 2503-2516. Odum, N., Hartzman, R., Jakobsen, B.K., Morling, N., Platz, P., Robbins, F.-M., Ryder, L.P. and Svejgaard, A. (1986) The HLA-DP polymorphism in Denmark investigated by local and international PLT reagents. Definition of two 'new' DP antigens. Tissue Antigens 28, 105-118. gldum, N., Hofmann, B., Hyldig-Nielsen, J.J., Jakobsen, B.K., Morling, N., Platz, P., Ryder, L.P. and Svejgaard, A. (1987) A 'new' supertypic HLA-DP related determinant detected by primed lymphocyte typing. Tissue Antigens 29, 101-109. Saiki, R.K., Bugawan, T.L., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1986) Analysis of enzymatic amplified flglobin and HLA-DQa DNA with a allele-specific oligonucleotide probes. Nature 324, 163-166. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. Simons, M.J., Wheeler, R., Lalouel, J.-M. and Dupont, B. (1989) Restriction fragment length polymophisms of HLA genes. Summary of the Tenth International Workshop Southern Blot Analysis. In: B. Dupont (Ed.), Immunobiology of HLA. Springer Verlag, New York. Todd, J.A., Bell, J.I. and McDevitt, H.O. (1987) HLA-DQp gene contributes to susceptibility and resistance to insulindependent diabetes mellitus. Nature 329, 599-604. Trowsdale, J. (1987) Genetics and polymorphism: Class II antigens. Br. Med. Bull. 43, 15-36. Wu, D.Y., Ugozzoli, L., Pal, B.K. and Wallace, B.R. (1989) Allele-specific enzymatic amplification of fl-globin genomic DNA for diagnosis of sickle cell anemia. Proc. Natl. Acad. Sci. U.S.A. 86, 2757-2760.