The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection

G Model

ARTICLE IN PRESS

JVAC-17518; No. of Pages 8

Vaccine xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection Kelly A. Prendergast a,b , Claudio Counoupas a,b , Lisa Leotta a,b , Carolina Eto a , Wilbert Bitter c , Nathalie Winter d , James A. Triccas a,b,∗ a

Microbial Pathogenesis and Immunity Group, Discipline of Infectious Diseases and Immunology, University of Sydney, Sydney, NSW, Australia Mycobacterial Research Group, Centenary Institute of Cancer Medicine and Cell Biology, Sydney, NSW, Australia c Department of Medical Microbiology and Infection Control, VU University Medical Center, Amsterdam, The Netherlands d INRA, Université de Tours, UMR 1282, Infectiologie et Santé Publique, 37380 Nouzilly, France b

a r t i c l e

i n f o

Article history: Received 21 August 2015 Received in revised form 9 February 2016 Accepted 28 March 2016 Available online xxx Keywords: Tuberculosis Ag85B BCG Macrophages Vaccine

a b s t r a c t Defining the function and protective capacity of mycobacterial antigens is crucial for progression of tuberculosis (TB) vaccine candidates to clinical trials. The Ag85B protein is expressed by all pathogenic mycobacteria and is a component of multiple TB vaccines under evaluation in humans. In this report we examined the role of the BCG Ag85B protein in host cell interaction and vaccine-induced protection against virulent Mycobacterium tuberculosis infection. Ag85B was required for macrophage infection in vitro, as BCG deficient in Ag85B expression (BCG:85B ) was less able to infect RAW 264.7 macrophages compared to parental BCG, while an Ag85B-overexpressing BCG strain (BCG:oex85B ) demonstrated improved uptake. A similar pattern was observed in vivo after intradermal delivery to mice, with significantly less BCG:85B present in CD64hi CD11bhi macrophages compared to BCG or BCG:oex85B . After vaccination of mice with BCG:85B or parental BCG and subsequent aerosol M. tuberculosis challenge, similar numbers of activated CD4+ and CD8+ T cells were detected in the lungs of infected mice for both groups, suggesting the reduced macrophage uptake observed by BCG:85B did not alter host immunity. Further, vaccination with both BCG:85B and parental BCG resulted in a comparable reduction in pulmonary M. tuberculosis load. These data reveal an unappreciated role for Ag85B in the interaction of mycobacteria with host cells and indicates that single protective antigens are dispensable for protective immunity induced by BCG. © 2016 Elsevier Ltd. All rights reserved.

1. Introduction Tuberculosis (TB) was responsible for 1.5 million deaths in 2014, with 9.6 million new TB cases occurring globally [1]. One third of the world is infected with Mycobacterium tuberculosis, the causative agent of TB. The only licensed vaccine for TB, Mycobacterium bovis Bacille Calmette Guérin (BCG), is highly variable in its ability to prevent infection and limit disease progression [2]. A substantial effort to develop a more effective TB vaccine is underway, with a handful of candidates now in clinical trials [3]. These include recombinant strains of BCG [4], protein subunit

∗ Corresponding author at: Microbial Pathogenesis and Immunity Group, Department of Infectious Diseases and Immunology, University of Sydney, Sydney, NSW, Australia. Tel.: +61 2 9036 6582. E-mail address: [email protected] (J.A. Triccas).

vaccines [5–7], viral vector vaccines [8,9] and attenuated strains of M. tuberculosis [10]. Some of these vaccines are designed as booster vaccines to augment the BCG-induced protective immunity, while others are designed to replace BCG as a priming vaccine. A number of the vaccines that have entered clinical trials incorporate a major immuno-dominant protein, Ag85B, together with other important, secreted M. tuberculosis antigens such as ESAT-6, TB10.4 or Ag85A [3]. The Ag85 complex consists of three proteins, Ag85A, Ag85B and Ag85C [11]. During mycobacterial growth, proteins of the Ag85 complex are secreted and make up the largest fraction of proteins detected in the culture filtrate [11]. Ag85 proteins function as mycolyl transferases involved in cell wall assembly, participating in the conversion of the glycolipid ␣,␣ -trehalose monomycolate (TMM) to ␣,␣ -trehalose dimycolate (TDM), also known as cord factor [12]. Removal of TDM enhanced trafficking of M. tuberculosis to acidic compartments within macrophages [13], suggesting

http://dx.doi.org/10.1016/j.vaccine.2016.03.089 0264-410X/© 2016 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089

G Model JVAC-17518; No. of Pages 8

ARTICLE IN PRESS K.A. Prendergast et al. / Vaccine xxx (2016) xxx–xxx

2

a role for TDM in the arrest of phagosomal maturation, an important survival mechanism for M. tuberculosis [14]. This implies that the function of Ag85 complex proteins as mycolyl transferases is important for M. tuberculosis survival. Ag85 proteins also bind to fibronectin [15–17], an extracellular matrix protein implicated in the binding of M. tuberculosis to alveolar macrophages [18]. The binding of Ag85B to fibronectin has also been shown to stimulate the production of TNF-␣ by human monocytes [19]. Ag85A and Ag85B exhibit close homology [11], and induce strong CD4+ T cell responses including T cell proliferation and IFN-␥ production [20–22]. As such, these highly immunogenic proteins are attractive targets for improved vaccine design against M. tuberculosis. Due to the strong recognition of Ag85B by the immune system, and its inclusion in a number of vaccine candidates against TB [3], we sought to determine the role of Ag85B in the protective effect of the BCG vaccine, by comparing host cell interaction and vaccine efficacy of Ag85B-expressing and Ag85B-deficient BCG (BCG:85B ). We found that infection of macrophages in vitro was inhibited by the loss of Ag85B, suggesting its importance in the initial interaction with host cells. This reduced capacity to infect host cells did not affect the ability of BCG:85B to protect mice against aerosol M. tuberculosis infection, indicating that multiple antigenic components contribute to the protective effect of BCG. 2. Materials and methods 2.1. Mice Female C57BL/6 mice, aged 6–8 weeks old, were purchased from the Animal Resources Centre (Perth, Australia). For adoptive transfer studies, P25 (CD45.1) TCR transgenic mice (specific for residues 240–254 of M. tuberculosis Ag85B) [23] were bred in house under specific pathogen free conditions. All experiments were approved by the Sydney Local Health District Animal Welfare Committee. 2.2. Bacteria 2.2.1. Culture conditions M. tuberculosis (H37Rv), M. bovis BCG Pasteur, BCG:85B , BCG:oex85B [24], and the equivalent mCherry expressing BCG reporter strains were grown at 37 ◦ C in 7H9 media (Difco Laboratories, BD Diagnostic Systems, Sparks, MD, USA) supplemented with 10% albumin-dextrose-catalase (ADC), 0.5% glycerol and 0.02% tyloxapol. Where required the antibiotics hygromycin (50 ␮g/mL) or kanamycin (25 ␮g/mL) were added to liquid or solid media. 2.2.2. Generation of Ag85B-deficient BCG and mCherry fluorescent strains Upstream and downstream regions flanking the Ag85Bencoding gene (fbpB) were amplified by PCR from BCG Pasteur genomic DNA and inserted into the StuI and XbaI (upstream fragment) or XhoI and BglII (downstream fragment) restriction sites of the pYUB854 vector [25] to place fragments either side of the hygromycin resistance gene (pYUB854-85KO). To facilitate deletion of fbpB, the pJV53 plasmid [26] was electroporated into BCG to generate BCG-pJV53. The pJV53 plasmid permits expression of an inducible phage recombinase that facilitates homologous recombination [27]. Electrocompetent cells of BCG-pJV53 were prepared as described previously [26] and these cells were transformed with 100 ng of pYUB854-85KO. Potential deletion clones were selected on 7H11 solid medium supplemented with 10% oleic acid-albumindextrose-catalase (OADC) and 0.5% glycerol (Difco Laboratories) containing hygromycin and kanamycin. Deletion of fbpB was confirmed by PCR using primers spanning chromosomal and plasmid borne Ag85B sequences.

Vector for mcherry expression into BCG was constructed by PCR amplification of the mCherry encoding gene from plasmid pFPV-mCherry/2 [28] with primers XbaI F (ATATCTAGAGAGGATATACATATGGTGAGC) and mCherry XbaI R (TATATCTAGATGCATGCTTACTTGTACAGC). After XbaI restriction, the gene was introduced into the integrative vector pNIP40b [29]. BCG strains expressing mCherry were constructed by electroporation of either the pNIP-40-mCherry or pSMT3-mCherry plasmid [30] into BCG strains. Hygromycin or kanamycin-resistant colonies were selected on supplemented 7H11 agar (Difco Laboratories) and fluorescent colonies confirmed by flow cytometry (see Section 2.7). BCG overexpressing the Ag85B protein (BCG:oex85B ) has been described previously [24]. 2.3. Western blot BCG cell lysates were prepared from exponential-phase cultures (OD600 = 1) by using a Mini BeadBeater (BioSpec Products, Bartlesville, USA). Lysate samples (20 ␮g), along with pre-stained molecular weight standards (BioRad, Hercules, CA, USA), were separated on a 2-phase 4%/12% SDS-polyacrylamide stacking/resolving gel and transferred to a PVDF membrane. Blots were probed with rabbit polyclonal anti-Ag85B serum followed by anti-rabbit HRPconjugated secondary antibody, and the membrane developed with SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL, USA) and visualized on a ChemiDoc MP Imaging System (BioRad). 2.4. IFN- ELISPOT Splenocytes were re-stimulated overnight at 37 ◦ C with 10 ␮g/mL of either the P25 peptide [21], TB10.43-11 peptide [31], Ag85B protein, BCG sonicate or ConA, in wells pre-coated with ␣IFN-␥ (AN18). After washing, ␣-IFN-␥ (XMG1.2-biotin) was added overnight at 4 ◦ C. After washing, avidin alkaline phosphatase was added for 45 min at room temperature, before washing, and alkaline phosphatase substrate solution was added. The reaction was allowed to develop for 10 min before washing with water. The plates were analyzed using an AID ELISPOT reader and V6.0 software (AID, Strassberg, Germany). 2.5. BCG infection of macrophages BCG, BCG:85B or BCG:oex85B were added to 2 × 105 RAW 264.7 cells (ATCC, TIB-71) in 96-well plates at a multiplicity of infection of 1:1 in DMEM supplemented with 10% fetal bovine serum (FBS). The plates were incubated at 37 ◦ C/5% CO2 for 4 h then washed three times with PBS to remove extracellular bacteria. Cells were incubated for a further 20 h after which they were lysed and colony forming units (CFU) determined by growth at 37 ◦ C on supplemented 7H11 medium. 2.6. Vaccination and aerosol infection of mice For vaccination with BCG strains, mice were injected subcutaneously (base of tail) with 5 × 105 colony forming units (CFU) of BCG or BCG:85B . For intradermal vaccination, mice were injected with 4 ␮l of PBS containing 5 × 105 CFU of mCherry BCG or BCG:85B into each ear under a surgical Leica M651 microscope (Leica, Wetzlar, Germany) using an ultrafine syringe (29 G, BD Biosciences), as previously described [32]. For aerosol infection with M. tuberculosis H37Rv, mice were infected using a Middlebrook airborne infection apparatus (Glas-Col, Terre Haute, IN, USA) to generate an initial infective dose of approximately 100 bacilli per lungs. Infected lungs and spleens were homogenized and bacterial numbers were determined by growth at 37 ◦ C on supplemented 7H11 agar.

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089

G Model JVAC-17518; No. of Pages 8

ARTICLE IN PRESS K.A. Prendergast et al. / Vaccine xxx (2016) xxx–xxx

2.7. Immunogenicity studies For experiments examining priming of T cells, lymph node and spleen cells from P25 mice were labeled with CFSE (Molecular Probes, Invitrogen, USA), as previously described [33] and 5 × 105 CFSE-labeled P25 cells (CD45.1) were transferred intravenously into C57BL/6 mice (CD45.2). The next day mice were vaccinated with 5 × 105 CFU of BCG strains and cells harvested as described below. Lungs of mice were dissociated with collagenase I/DNAse I in RPMI using a gentleMACS dissociator (Miltenyi Biotec) and incubated for 30 min at 37 ◦ C. For intradermal studies, both ears were removed and immediately split into dorsal and ventral halves, diced and incubated with collagenase I/DNAse I in RPMI for 30 min at 37 ◦ C. Ears, lungs, spleens or draining lymph node (DLN) cells were passed through 70 ␮m strainers and red blood cells were lysed with ACK (ammonium-chloride-potassium) lysis buffer for 1 min, before washing with RPMI. Fc␥R receptors were blocked using anti-CD32/16 (clone 2.4G2) and cells labeled with combinations of CD4-PerCP or CD4-AlexaFluor 700, CD8-Pacific Blue, CD11b-APC Cy7, CD11c-PE Cy7, CD64a&b-PE (all BD Pharmingen), CD45.1-PerCP, CD45.2-Pacific Blue, CD44-APC, CD62L-APC Cy7 (all BioLegend), Ly6G-PerCP Cy5.5, MHC class II-AlexaFluor 700 (all eBioscience) surface antibodies. A viability dye, live/dead UV blue (Life Technologies), was included in the antibody mix. For intracellular cytokine staining, cells were prepared as above and stimulated overnight in the presence of the P25 peptide (10 ␮g/mL) and Brefeldin A (10 ␮g/mL), then permeabilized using

3

Cytofix/CytopermTM (BD Biosciences), and stained for intracellular IFN-␥-PE Cy7 (eBioscience), TNF-APC and IL-2-PE (both BD Pharmingen). 2.8. Flow cytometry acquisition and analysis Samples were acquired on an LSR-Fortessa (Becton Dickinson, USA) and analyzed using FlowJoTM analysis software (Tree Star, Version 9.7.6). The gating strategy involved single cell selection using Forward Scatter-Height versus Forward Scatter-Area and Side Scatter-Height versus Side Scatter-Area exclusion of doublets, then selection of relevant populations. The absolute number of cell subsets within an organ was calculated as previously described [34]. 2.9. Statistics The significance of difference between groups was determined by one-way ANOVA with the Tukey post-test. Graphpad Prism 6 software (Graphpad Software Inc., San Diego, CA, USA) was used for all analyses. 3. Results 3.1. BCG deficient in Ag85B expression displays reduced in vitro uptake by macrophages Mycobacterial Ag85B is a highly immunodominant, secreted antigen that exhibits mycolyl transferase [12] and fibronectin

Fig. 1. Deletion of the Ag85B-encoding gene from the BCG vaccine. (A) Detection of the Ag85B protein in lysates of BCG:oex85B , BCG or BCG:85B by Western blot using polyclonal anti-Ag85B sera. (B–E) C57B/6 mice (n = 3) received CFSE-labeled P25 CD4+ T cells i.v. and 1 day later were vaccinated s.c. with 5 × 105 CFU BCG or BCG:85B , or left unvaccinated. Six days later the DLNs were harvested and P25 proliferation was assessed by flow cytometry. Representative plots of CFSE-labeled P25 CD4+ T cell proliferation are shown (B–D) as well as the number of P25 cells (CD4+ CD45.2− CD45.1+ ) in the DLNs (E). (F) IFN-␥ ELISPOT of splenocytes from mice (n = 4) vaccinated s.c. for 8 weeks with BCG or BCG:85B , after restimulation with P25 peptide, Ag85B protein, TB10.43-11 peptide or BCG sonicate. The significances of differences between groups were determined by ANOVA (* p < 0.05; ** p < 0.01). Results are representative of two independent experiments.

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089

G Model JVAC-17518; No. of Pages 8 4

ARTICLE IN PRESS K.A. Prendergast et al. / Vaccine xxx (2016) xxx–xxx

binding [16] activity. To define the role of the Ag85B protein in BCG-induced protection against M. tuberculosis, the gene encoding Ag85B, fbpB, was deleted from BCG by recombination-facilitated allelic exchange [26]. Ag85B was absent from BCG deleted of Ag85B (BCG:85B ) as assessed by Western blotting with anti-Ag85B polyclonal sera (Fig. 1A). By contrast, a band corresponding to Ag85B was detected in wild-type BCG, and was present at higher levels in BCG overexpressing the protein (BCG:oex85B ) (Fig. 1A). To immunologically confirm the loss of Ag85B expression, CFSElabeled Ag85B-reactive CD4+ T cells (P25 T cells [23]) were transferred into C57BL/6 mice and 1 day later mice were vaccinated with BCG or BCG:85B . P25 T cells proliferated extensively 7

days after BCG delivery (Fig. 1C) and appreciable numbers of P25 CD4+ T cells were detected in the draining lymph nodes (DLNs; Fig. 1E). However, negligible P25 CD4+ T cell proliferation was observed in non-vaccinated and BCG:85B vaccinated mice, confirming deletion of the Ag85B protein (Fig. 1B and D). Eight weeks after BCG or BCG:85B vaccination, comparable IFN-␥ release was observed from cells restimulated with BCG sonicate, irrespective of the vaccine strain examined, whereas stimulation with P25 peptide induced IFN-␥ production only in the wild-type BCG strain (Fig. 1F). Stimulation with the Ag85B protein gave a similar IFN␥ response to P25 peptide-stimulated cells, demonstrating that the response to whole protein aligns closely with the P25 peptide

Fig. 2. Ag85B deficiency reduced the capacity of BCG to infect host cells in vitro and in vivo. RAW 264.7 cells were infected with BCG, BCG:85B or BCG:oex85 (MOI 1:1) for (A) 4 h or (B) 24 h at 37 ◦ C and intracellular bacterial load determined. (C–E) C57BL/6 mice (n = 4) were vaccinated i.d. with 5 × 105 CFU of mCherry-expressing strains of BCG, BCG:85B and BCG:oex85 . Ears were harvested 6 and 24 h post vaccination and mCherry fluorescence detected by flow cytometry. (C) Representative plots showing the proportion of CD64+ macrophages and Ly6G+ neutrophils within the mCherry+ cell population at 6 h post infection. The number of mCherry+ macrophages and neutrophils in the ear at 6 h (D) and 24 h (E) post infection is also shown. The significances of differences between groups were determined by ANOVA (* p < 0.05; ** p < 0.01). Results are representative of two independent experiments.

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089

G Model JVAC-17518; No. of Pages 8

ARTICLE IN PRESS K.A. Prendergast et al. / Vaccine xxx (2016) xxx–xxx

response. Interestingly, stimulation with the CD8+ T cell specific TB10.43-11 peptide showed an increased response in the BCG:85B group compared to BCG, which may reflect increased responses to other immunogenic proteins in the absence of Ag85B (Fig. 1F). To examine the role of Ag85B in host cell infection, the uptake of BCG, BCG:85B or BCG:oex85B by the mouse macrophage cell line, RAW 264.7 cells, was compared. Significantly less BCG:85B was present within RAW 264.7 cells at 4 h post-infection compared to wild-type BCG, while BCG:oex85B were more abundant within RAW 264.7 cells at this early time-point (Fig. 2A). This reduced infection capacity of BCG:85B was more evident at 24 h post-infection, with an approximate 8-fold decrease in recovered BCG:85B compared to wild-type BCG (Fig. 2B). Therefore Ag85B is responsible in part for the ability of BCG to infect host cells. 3.2. Ag85B is required for macrophage uptake of BCG in vivo To determine if the role of Ag85B in early macrophage interactions is also observed in vivo, mCherry-expressing BCG, BCG:85B and BCG:oex85B were constructed and used to intradermally infect mice. The uptake of mCherry-expressing bacteria by CD64+ CD11b+ macrophages and Ly6G+ neutrophils was assessed at 6 and 24 h post infection at the site of vaccination by flow cytometry (Fig. 2C). At 6 h post infection, there were significantly less mCherrypositive macrophages in the BCG:85B group (Fig. 2C and D). The same pattern was observed at 24 h however this effect did not reach significance (Fig. 2E). There was an increased frequency of mCherry-positive neutrophils in the BCG:85B group (Fig. 2C), however, this did not translate to a significant increase in cell number

5

(Fig. 2D and E). At both time-points, a greater number of mCherrypositive macrophages were detected in BCG:oex85B -vaccinated mice compared to mice vaccinated with BCG:85B , however there was no difference compared to the BCG-vaccinated group (Fig. 2D and E). There were no CD11c+ dendritic cells associated with BCG at the time points assessed (data not shown). These results reveal that the Ag85B protein plays a transient role in the interaction of BCG with macrophages during vaccination. 3.3. BCG and BCG:85B vaccination invokes comparable immunity after aerosol M. tuberculosis challenge The reduced interaction of BCG:85B with host cells, coupled with the loss of an immunodominant protective antigen within the strain, suggested that Ag85B may be required for the generation of protective immunity against M. tuberculosis challenge afforded by BCG vaccination. To examine this, mice were vaccinated subcutaneously with BCG or BCG:85B , aerosol infected with M. tuberculosis and the pattern of T cell activation examined. The proportion of activated CD4+ and CD8+ T cells (CD44high CD62Llow ) observed after vaccination with either strain was greater than that seen in naïve mice, but reduced compared to unvaccinated mice challenged with M. tuberculosis (Fig. 3A and B). There was no difference however between the proportion of either activated CD4+ or CD8+ T cells between BCG or BCG:85B vaccinated mice (Fig. 3B). When lung cells were re-stimulated with the CD4+ T cell specific Ag85B peptide P25 [23] and the release of cytokines examined (Fig. 4A), low proportions of multi-cytokine expressing CD4+ T cells (IFN-␥+ TNF+ IL-2+ and IFN-␥+ TNF+ ) were detected in the

Fig. 3. Activation of T cell subsets after vaccination with BCG lacking Ag85B. C57BL/6 mice (n = 5) were vaccinated s.c. with 5 × 105 CFU BCG or BCG:85B , or left unvaccinated. Ten weeks after vaccination the mice were aerosol infected with M. tuberculosis H37Rv and 4 weeks after infection the lungs were harvested and T cell frequency determined by flow cytometry. Representative plots of lung CD4+ CD44high CD62Llow T cells are shown (A), together with the percentage of CD44high CD62Llow cells within the CD4+ or CD8+ T cell populations in the lungs (B). The significances of differences between groups were determined by ANOVA (* p < 0.05; ** p < 0.01). Results are representative of two independent experiments.

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089

G Model JVAC-17518; No. of Pages 8 6

ARTICLE IN PRESS K.A. Prendergast et al. / Vaccine xxx (2016) xxx–xxx

Fig. 4. Cytokine production in the lungs of BCG:85B vaccinated mice after M. tuberculosis infection. C57BL/6 mice (n = 5) were vaccinated s.c. with 5 × 105 CFU BCG or BCG:85B , or left unvaccinated. Ten weeks after vaccination the mice were aerosol infected with M. tuberculosis H37Rv and 4 weeks after infection the lungs were harvested, cells re-stimulated over night with P25 peptide and cytokine production assessed by flow cytometry. (A) Representative plots showing IFN-␥ versus TNF-␣ and IFN-␥ versus IL-2 expression by CD4+ T cells. (B) The percentage of cytokine producing cells within the CD4+ T cell population in the lungs. The significances of differences between groups were determined by ANOVA (** p < 0.01; **** p < 0.0001). Results are representative of two independent experiments.

BCG:85B -vaccinated group, while these subsets were detected at heightened levels in the lungs of mice vaccinated with BCG (Fig. 4B). Together, these results indicate that the deletion of Ag85B from BCG does not alter the activation profile of CD4+ T cells after BCG vaccination and subsequent M. tuberculosis infection, but does impact on the Ag85B-induced release of cytokines by CD4+ T cells in BCG vaccinated and M. tuberculosis-challenged animals. 3.4. Ag85B deficiency does not impair the ability of BCG to protect against M. tuberculosis infection Due to the reduced generation of multi-cytokine-secreting Ag85B-reactive CD4+ T cells in BCG:85B -vaccinated mice, coupled with the previously observed protection imparted by Ag85B in animal models of TB [35–37], we next examined the ability of BCG:85B to protect mice against aerosol M. tuberculosis infection. Mice vaccinated with wild-type BCG exhibited a significantly reduced M. tuberculosis bacterial load after challenge in both the lungs (Fig. 5A) and spleen (Fig. 5B) compared with unvaccinated mice. BCG:85B vaccinated mice were also significantly protected compared to unvaccinated mice, however this protection did not differ

compared to wild-type BCG vaccination (Fig. 5A and B). Therefore, the deletion of Ag85B alone does not alter the protective capacity of BCG against M. tuberculosis infection.

4. Discussion Many of the TB vaccines in clinical trials aim to improve the immune response to specific antigens that are known to be highly immunogenic. Fusion proteins typically incorporate 2–3 proteins, and in a number of cases the immunodominant Ag85B is one of these included components [3,5–8]. For this reason we sought to determine the role played by Ag85B in the interaction with the host immune system, as well as the generation of protective immunity after BCG vaccination. Ag85B displayed a clear role in the initial uptake of BCG by macrophages both in vitro and in vivo (Fig. 2). The reduced uptake of BCG:85B by macrophages may be due to the proposed ability of Ag85B to bind to fibronectin on the surface of macrophages [15–17]. While some bacteria can directly engage with integrin receptors to achieve invasion of host cells, other bacteria indirectly engage these receptors via fibronectin binding proteins [38]. Inhibiting the interaction between fibronectin

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089

G Model

ARTICLE IN PRESS

JVAC-17518; No. of Pages 8

K.A. Prendergast et al. / Vaccine xxx (2016) xxx–xxx

B

6.0

****

****

M. tuberculosis CFU in spleen (log10)

5.5 NS

5.0 4.5 4.0

*

**

5

NS

4 3 2

B 85

G

: G C

ac nv

B

B

na ci

: G C B

C

te

B 85

G C B

d te na ci U

nv

ac

d

1

3.5

U

M. tuberculosis CFU in lungs (log10)

A

7

Fig. 5. Vaccination of mice with BCG:85B or BCG affords similar protective efficacy against aerosol M. tuberculosis infection. (A and B) C57BL/6 mice (n = 5) were vaccinated s.c. with 5 × 105 CFU BCG or BCG:85B , or left unvaccinated. Ten weeks after vaccination the mice were aerosol infected with M. tuberculosis H37Rv and 4 weeks after infection the M. tuberculosis CFU in the lung (A) or spleen (B) was determined. The significances of differences between groups were determined by ANOVA (* p < 0.05, ** p < 0.01, **** p < 0.0001). Results are representative of two independent experiments.

and integrin receptors during in vitro mycobacterial infection was found to inhibit phagocytosis by human blood leukocytes [39], suggesting a role for both fibronectin and integrin receptors during mycobacterial infection of host cells. The reduced in vivo interaction of BCG:85B with macrophages was not observed at extended time-points, which may in part be due to the presence of other fibronectin-binding proteins in BCG such as Ag85A and Ag85C [15,17], which could compensate for the loss of Ag85B in vivo (Fig. 2). The discrepancy between in vivo and in vitro findings may also be due to the contribution of cells other than macrophages to the initial uptake of BCG during vaccination, such as dendritic cells and particularly neutrophils, which have been shown to phagocytose mycobacteria early after infection (Fig. 2 and [40,41]). No difference was observed in T cell activation in the lungs of BCG or BCG:85B -vaccinated mice, indicating loss of the antigen does not impact on the generalized T cell response imparted by BCG (Fig. 3). However, there was a lower proportion of antigen-specific cytokine producing cells from the lungs of BCG:85B -vaccinated mice after re-stimulation with the Ag85B-specific P25 peptide (Fig. 4). This is likely due to memory cells specific for Ag85B existing within the BCG vaccinated mice which are absent from BCG:85B vaccinated animals. Further, this reduced generation of Ag85Breactive multifunctional CD4+ T cells in BCG:85B -vaccinated mice was apparent even though all groups had been infected with M. tuberculosis, suggesting that there may be qualitative differences in the T cell response between BCG vaccination and M. tuberculosis infection. The greater response in unvaccinated, M. tuberculosis infected mice may also reflect the increased bacterial load present in the lungs (Fig. 5), resulting in a higher level of primary antigen stimulation. This was also seen in the higher activation profile of the unvaccinated and M. tuberculosis infected mice compared with vaccinated animals (Fig. 3). Deletion of Ag85B had no impact on the protective effect of BCG (Fig. 5). This was despite the fact that multi-cytokine producing Ag85B-specific CD4+ T cells were reduced in BCG:85B , a phenotype that is associated with control of bacterial infection [42,43]. This suggests that the multitude of additional antigens expressed by BCG [44] can compensate for the lack of Ag85B. Deletion of Ag85A from virulent M. tuberculosis resulted in a growth defect both in culture and in vivo. In contrast, deletion of Ag85B from M. tuberculosis demonstrated an in vivo growth profile similar to wild type M. tuberculosis [45,46], and we similarly observed no difference in the in vitro and in vivo growth profiles of BCG and BCG:85B (data not shown). Interestingly, mice vaccinated subcutaneously with M. tuberculosis lacking Ag85A were better protected after aerosol M. tuberculosis infection compared to vaccination with BCG, further

demonstrating that the Ag85 complex is not essential for protection in the mouse [47]. It is of interest to note that overexpression of Ag85B has been shown to either improve the protective effect of BCG [35–37] or have no improved effect compared to conventional BCG [24,48]. These differences may be due to variations in expression levels by the rBCG strains developed or differences in the animal models employed. A number of BCG ‘booster’ vaccines in clinical trials contain Ag85B [3], and our data does question the contribution of Ag85B to TB vaccine-induced efficacy. However, Ag85B-containing protein vaccines delivered in adjuvant are highly effective in animal models, suggesting that the mode of antigen delivery is critical for the resultant protective effect [5–7]. In addition, Ag85B is expressed early during mycobacterial growth [49] and for this reason we examined protection at a relatively early time-point post-challenge (4 weeks). However we cannot exclude the possibility that differences may be observed at extended timepoints post challenge, where the protective effect of BCG wanes [50–52]. 5. Conclusions The Ag85B protein of BCG is required for the early interaction of the vaccine with host cells, but deletion of the antigen does not affect BCG-induced protective immunity against M. tuberculosis aerosol challenge. Therefore BCG contains other antigens other than Ag85B that are sufficient for protection against M. tuberculosis infection in the murine model. Acknowledgements We would like to thank Dr Gayathri Nagalingam and Dr Rachel Pinto for technical assistance and helpful discussion. We also thank Thierry Cochard and Franck Biet for the mCherry expression vectors for BCG. This work was supported by a Project Grant from the National Health and Medical Research Council (APP1043519). Conflict of interest: The authors declare no commercial or financial conflicts of interest. References [1] Global tuberculosis report 2015. Geneva: World Health Organisation; 2015. [2] Colditz GA, Brewer TF, Berkey CS, Wilson ME, Burdick E, Fineberg HV, et al. Efficacy of BCG vaccine in the prevention of tuberculosis: meta-analysis of the published literature. JAMA 1994;271:698–702. [3] Andersen P, Kaufmann SH. Novel vaccination strategies against tuberculosis. Cold Spring Harb Perspect Med 2014;4.

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089

G Model JVAC-17518; No. of Pages 8 8

ARTICLE IN PRESS K.A. Prendergast et al. / Vaccine xxx (2016) xxx–xxx

[4] Grode L, Ganoza CA, Brohm C, Weiner 3rd J, Eisele B, Kaufmann SH. Safety and immunogenicity of the recombinant BCG vaccine VPM1002 in a phase 1 open-label randomized clinical trial. Vaccine 2013;31:1340–8. [5] van Dissel JT, Soonawala D, Joosten SA, Prins C, Arend SM, Bang P, et al. Ag85B-ESAT-6 adjuvanted with IC31(R) promotes strong and long-lived Mycobacterium tuberculosis specific T cell responses in volunteers with previous BCG vaccination or tuberculosis infection. Vaccine 2011;29:2100–9. [6] Skeiky YA, Dietrich J, Lasco TM, Stagliano K, Dheenadhayalan V, Goetz MA, et al. Non-clinical efficacy and safety of HyVac4:IC31 vaccine administered in a BCG prime-boost regimen. Vaccine 2010;28:1084–93. [7] Lin PL, Dietrich J, Tan E, Abalos RM, Burgos J, Bigbee C, et al. The multistage vaccine H56 boosts the effects of BCG to protect cynomolgus macaques against active tuberculosis and reactivation of latent Mycobacterium tuberculosis infection. J Clin Invest 2012;122:303–14. [8] Abel B, Tameris M, Mansoor N, Gelderbloem S, Hughes J, Abrahams D, et al. The novel tuberculosis vaccine, AERAS-402, induces robust and polyfunctional CD4+ and CD8+ T cells in adults. Am J Respir Crit Care Med 2010;181: 1407–17. [9] Tameris MD, Hatherill M, Landry BS, Scriba TJ, Snowden MA, Lockhart S, et al. Safety and efficacy of MVA85A, a new tuberculosis vaccine, in infants previously vaccinated with BCG: a randomised, placebo-controlled phase 2b trial. Lancet 2013;381:1021–8. [10] Arbues A, Aguilo JI, Gonzalo-Asensio J, Marinova D, Uranga S, Puentes E, et al. Construction, characterization and preclinical evaluation of MTBVAC, the first live-attenuated M. tuberculosis-based vaccine to enter clinical trials. Vaccine 2013;31:4867–73. [11] Wiker HG, Harboe M. The antigen 85 complex: a major secretion product of Mycobacterium tuberculosis. Microbiol Rev 1992;56:648–61. [12] Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan PJ, Besra GS. Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis. Science 1997;276:1420–2. [13] Indrigo J, Hunter RL, Actor JK. Cord factor trehalose 6,6 -dimycolate (TDM) mediates trafficking events during mycobacterial infection of murine macrophages. Microbiology 2003;149:2049–59. [14] Gomes MS, Paul S, Moreira AL, Appelberg R, Rabinovitch M, Kaplan G. Survival of Mycobacterium avium and Mycobacterium tuberculosis in acidified vacuoles of murine macrophages. Infect Immun 1999;67:3199–206. [15] Abou-Zeid C, Ratliff TL, Wiker HG, Harboe M, Bennedsen J, Rook GAW. Characterization of fibronectin-binding antigens released by Mycobacterium tuberculosis and Mycobacterium bovis BCG. Infect Immun 1988;56:3046–51. [16] Peake P, Gooley A, Britton WJ. Mechanism of interaction of the 85B secreted protein of Mycobacterium bovis with fibronectin. Infect Immun 1993;61: 4828–34. [17] Kuo CJ, Bell H, Hsieh CL, Ptak CP, Chang YF. Novel mycobacteria antigen 85 complex binding motif on fibronectin. J Biol Chem 2012;287:1892–902. [18] Pasula R, Wisniowski P, Martin 2nd WJ. Fibronectin facilitates Mycobacterium tuberculosis attachment to murine alveolar macrophages. Infect Immun 2002;70:1287–92. [19] Aung H, Toossi Z, Wisnieski JJ, Wallis RS, Culp LA, Phillips NB, et al. Induction of monocyte expression of tumor necrosis factor alpha by the 30-kD alpha antigen of Mycobacterium tuberculosis and synergism with fibronectin. J Clin Invest 1996;98:1261–8. [20] Palma C, Iona E, Giannoni F, Pardini M, Brunori L, Orefici G, et al. The Ag85B protein of Mycobacterium tuberculosis may turn a protective immune response induced by Ag85B-DNA vaccine into a potent but non-protective Th1 immune response in mice. Cell Microbiol 2007;9:1455–65. [21] Kariyone A, Tamura T, Kano H, Iwakura Y, Takeda K, Akira S, et al. Immunogenicity of peptide-25 of Ag85B in Th1 development: role of IFN-g. Int Immunol 2003;15:1183–94. [22] Fan X, Gao Q, Fu R. Differential immunogenicity and protective efficacy of DNA vaccines expressing proteins of Mycobacterium tuberculosis in a mouse model. Microbiol Res 2009;164:374–82. [23] Tamura T, Ariga H, Kinashi T, Uehara S, Kikuchi T, Nakada M, et al. The role of antigenic peptide in CD4+ T helper phenotype development in a T cell receptor transgenic model. Int Immunol 2004;16:1691–9. [24] Kong CU, Ng LG, Nambiar JK, Spratt JM, Weninger W, Triccas JA. Targeted induction of antigen expression within dendritic cells modulates antigen-specific immunity afforded by recombinant BCG. Vaccine 2011;29:1374–81. [25] Bardarov S, Bardarov Jr S, Pavelka MS, Sambandamurthy V, Larsen M, Tufariello J, et al. Specialized transduction: an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology 2002;148:3007–71. [26] van Kessel JC, Hatfull GF. Mycobacterial recombineering. Methods Mol Biol 2008;435:203–15. [27] van Kessel JC, Hatfull GF. Recombineering in Mycobacterium tuberculosis. Nat Methods 2007;4:147–52. [28] Drecktrah D, Levine-Wilkinson S, Dam T, Winfree S, Knodler LA, Schroer TA, et al. Dynamic behaviour of Salmonella-induced membrane tubules in epithelial cells. Traffic 2008;9:2117–29.

[29] Kocincova D, Winter N, Euphrasie D, Daffe M, Reyrat JM, Etienne G. The cell surface-exposed glycopeptidolipids confer a selective advantage to the smooth variants of Mycobacterium smegmatis in vitro. FEMS Microbiol Lett 2009;290:39–44. [30] Meijer AH, van der Sar AM, Cunha C, Lamers GE, Laplante MA, Kikuta H, et al. Identification and real-time imaging of a myc-expressing neutrophil population involved in inflammation and mycobacterial granuloma formation in zebrafish. Dev Comp Immunol 2008;32:36–49. [31] Billeskov R, Vingsbo-Lundberg C, Andersen P, Dietrich J. Induction of CD8 T cells against a novel epitope in TB10.4: correlation with mycobacterial virulence and the presence of a functional region of difference-1. J Immunol 2007;179:3973–81. [32] Li JL, Goh CC, Keeble JL, Qin JS, Roediger B, Jain R, et al. Intravital multiphoton imaging of immune responses in the mouse ear skin. Nat Protoc 2012;7:221–34. [33] Nambiar JK, Ryan AA, Kong CU, Britton WJ, Triccas JA. Modulation of pulmonary DC function by vaccine-encoded GM-CSF enhances protective immunity against Mycobacterium tuberculosis infection. Eur J Immunol 2010;40:153–61. [34] Nambiar JK, Pinto R, Aguilo JI, Takatsu K, Martin C, Britton WJ, et al. Protective immunity afforded by attenuated, PhoP-deficient Mycobacterium tuberculosis is associated with sustained generation of CD4+ T-cell memory. Eur J Immunol 2012;42:385–92. [35] Wang C, Fu R, Chen Z, Tan K, Chen L, Teng X, et al. Immunogenicity and protective efficacy of a novel recombinant BCG strain overexpressing antigens Ag85A and Ag85B. Clin Dev Immunol 2012;2012:563838. [36] Shi C, Chen L, Chen Z, Zhang Y, Zhou Z, Lu J, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing HspX protein. Vaccine 2010;28:5237–44. [37] Horwitz MA, Harth G, Dillon BJ, Maslesa-Galic S. Recombinant bacillus Calmette-Guerin (BCG) vaccines expressing the Mycobacterium tuberculosis 30-kDa major secretory protein induce greater protective immunity against tuberculosis than conventional BCG vaccines in a highly susceptible animal model. Proc Natl Acad Sci 2000;97:13853–8. [38] Hoffmann C, Ohlsen K, Hauck CR. Integrin-mediated uptake of fibronectinbinding bacteria. Eur J Cell Biol 2011;90:891–6. [39] Siemion IZ, Wieczorek Z. Antiadhesive peptides as the inhibitors of Mycobacterium kansasii phagocytosis. Peptides 2003;24:623–8. [40] Wolf AJ, Linas B, Trevejo-Nunez GJ, Kincaid E, Tamura T, Takatsu K, et al. Mycobacterium tuberculosis infects dendritic cells with high frequency and impairs their function in vivo. J Immunol 2007;179:2509–19. [41] Abadie V, Badell E, Douillard P, Ensergueix D, Leenen PJ, Tanguy M, et al. Neutrophils rapidly migrate via lymphatics after Mycobacterium bovis BCG intradermal vaccination and shuttle live bacilli to the draining lymph nodes. Blood 2005;106:1843–50. [42] Darrah PA, Patel DT, De Luca PM, Lindsay RW, Davey DF, Flynn BJ, et al. Multifunctional TH1 cells define a correlate of vaccine-mediated protection against Leishmania major. Nat Med 2007;13:843–50. [43] Seder RA, Darrah PA, Roederer M. T-cell quality in memory and protection: implications for vaccine design. Nat Rev Immunol 2008;8:247–58. [44] Yuk JM, Jo EK. Host immune responses to mycobacterial antigens and their implications for the development of a vaccine to control tuberculosis. Clin Exp Vaccine Res 2014;3:155–67. [45] Copenhaver RH, Sepulveda E, Armitige LY, Actor JK, Wanger A, Norris SJ, et al. A mutant of Mycobacterium tuberculosis H37Rv that lacks expression of antigen 85A is attenuated in mice but retains vaccinogenic potential. Infect Immun 2004;72:7084–95. [46] Armitige LY, Jagannath C, Wanger AR, Norris SJ. Disruption of the genes encoding antigen 85A and antigen 85B of Mycobacterium tuberculosis H37Rv: effect on growth in culture and in macrophages. Infect Immun 2000;68:767–78. [47] Roche CM, Smith A, Lindsey DR, Meher A, Schluns K, Arora A, et al. The DeltafbpA attenuated candidate vaccine from Mycobacterium tuberculosis, H37Rv primes for a stronger T-bet dependent Th1 immunity in mice. Tuberculosis 2011;91(Suppl. 1):S96–104. [48] Palendira U, Spratt JM, Britton WJ, Triccas JA. Expanding the antigenic repertoire of BCG improves protective efficacy against aerosol Mycobacterium tuberculosis infection. Vaccine 2005;23:1680–5. [49] Rogerson BJ, Jung YJ, LaCourse R, Ryan L, Enright N, North RJ. Expression levels of Mycobacterium tuberculosis antigen-encoding genes versus production levels of antigen-specific T cells during stationary level lung infection in mice. Immunology 2006;118:195–201. [50] Sterne JA, Rodrigues LC, Guedes IN. Does the efficacy of BCG decline with time since vaccination. Int J Tuberc Lung Dis 1998;2:200–7. [51] Abubakar I, Pimpin L, Ariti C, Beynon R, Mangtani P, Sterne JA, et al. Systemic review and meta-analysis of the current evidence on the duration of protection by bacillus Calmette-Guerin vaccination against tuberculosis. Health Technol Assess 2013;17:1–372. [52] Nandakumar S, Kannanganat S, Posey JE, Amara RR, Sable SB. Attrition of Tcell functions and simultaneous upregulation of inhibitory markers correspond with the waning of BCG-induced protection against tuberculosis in mice. PLoS One 2014;9:e113951.

Please cite this article in press as: Prendergast KA, et al. The Ag85B protein of the BCG vaccine facilitates macrophage uptake but is dispensable for protection against aerosol Mycobacterium tuberculosis infection. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.03.089