The c-Fos and c-Jun from Litopenaeus vannamei play opposite roles in Vibrio parahaemolyticus and white spot syndrome virus infection

Developmental and Comparative Immunology 52 (2015) 26–36

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

The c-Fos and c-Jun from Litopenaeus vannamei play opposite roles in Vibrio parahaemolyticus and white spot syndrome virus infection Chaozheng Li a,b,c,*, Haoyang Li a,b,c, Sheng Wang a,b,c, Xuan Song a, Zijian Zhang a, Zhe Qian a, Hongliang Zuo a,b,c, Xiaopeng Xu a,b,c, Shaoping Weng a,b,c, Jianguo He a,b,c,d,** a

MOE Key Laboratory of Aquatic Product Safety/State Key Laboratory for Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, China Institute of Aquatic Economic Animals, Guangdong Province Key Laboratory for Aquatic Economic Animals, Sun Yat-sen University, Guangzhou, China c Guangdong Provincial Key Laboratory of Marine Resources and Coastal Engineering, Sun Yat-sen University, Guangzhou, China d School of Marine Sciences, Sun Yat-sen University, Guangzhou, China b

A R T I C L E

I N F O

Article history: Received 27 January 2015 Revised 17 April 2015 Accepted 19 April 2015 Available online 23 April 2015 Keywords: c-Fos c-Jun Activator protein-1 (AP-1) Litopenaeus vannamei WSSV Vibrio parahaemolyticus

A B S T R A C T

Growing evidence indicates that activator protein-1 (AP-1) plays a major role in stimulating the transcription of immune effector molecules in cellular response to an incredible array of stimuli, including growth factors, cytokines, cellular stresses and bacterial and viral infection. Here, we reported the isolation and characterization of a cDNA from Litopenaeus vannamei encoding the full-length c-Fos protein (named as Lvc-Fos). The predicted amino acid sequences of Lvc-Fos contained a basic-leucine zipper (bZIP) domain, which was characteristic of members of the AP-1 family. Immunoprecipitation and nativePAGE assays determined that Lvc-Fos could interact with the Lvc-Jun, a homolog of c-Jun family in L. vannamei, in a heterodimer manner. Further investigation demonstrated that Lvc-Fos and Lvc-Jun were expressed in all tested tissues and located in the nucleus. Real-time RT-PCR analysis showed both LvcFos and Lvc-Jun in gills were up-regulated during Vibrio parahaemolyticus and white spot syndrome virus (WSSV) challenges. In addition, reporter gene assays indicated Lvc-Fos and Lvc-Jun could activate the expression of antimicrobial peptides (AMPs) of Drosophila and shrimp, as well as WSSV immediate early (IE) genes wsv069 and wsv249, in a different manner. Knockdown of Lvc-Fos or Lvc-Jun by RNA interference (RNAi) resulted in higher mortalities of L. vannamei after infection with V. parahaemolyticus, suggesting that Lvc-Fos and Lvc-Jun might play protective roles in bacterial infection. However, silencing of Lvc-Fos or Lvc-Jun in shrimp caused lower mortalities and virus loads under WSSV infection, suggesting that LvcFos and Lvc-Jun could be engaged for WSSV replication and pathogenesis. In conclusion, our results provided experimental evidence and novel insight into the roles of L. vannamei AP-1 in bacterial and viral infection. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Pacific white shrimp (Litopenaeus vannamei) is one of the most important commercial marine species in the world. However, a multitude of pathogens, especially bacteria and viruses, have become the major constraints on production and trade during the past two decades (Wang and Wang, 2013; Xu et al., 2014). Vibrio parahaemolyticus is the common bacterial pathogen of shrimps, which is thought to cause a recent disease of farmed Penaeid shrimp, usually referred to as “early mortality syndrome” (EMS), also known as “acute hepatopancreatic necrosis disease” (AHPND) (De Schryver

* Corresponding author. School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, China. Tel.: +86 20 39332850; fax: +86 20 84113229. E-mail address: [email protected] (C. Li). ** Corresponding author. School of Life Sciences, School of Marine Sciences, Sun Yat-sen University, Guangzhou 510275, China. Tel.: +86 20 39332988; fax: +86 20 84113229. E-mail address: [email protected] (J. He). http://dx.doi.org/10.1016/j.dci.2015.04.009 0145-305X/© 2015 Elsevier Ltd. All rights reserved.

et al., 2014). On the other hand, white spot syndrome virus (WSSV) is the most serious viral pathogen of shrimps, which can cause a cumulative mortality up to 100% within 3–10 days (Leu et al., 2009). Shrimp diseases control and prevention have been principal research aspects in recent years. Therefore, understanding the immune regulation mechanism of shrimp against invading pathogens might contribute to establishment of available strategies for the prevention and treatment of these diseases. The AP-1 (activator protein 1) transcription factor refers to a dimeric complex formed between members of Jun, Fos, ATF (activating transcription factor) and MAF (musculoaponeurotic fibrosarcoma) protein families (Eferl and Wagner, 2003). AP-1 proteins commonly contain a characteristic and conserved basicleucine zipper (bZIP) domain, which consists of a leucine-zipper motif with capability of dimerization and a basic domain for interaction with the DNA backbone (Eferl and Wagner, 2003; Wisdom, 1999). The consensus sequence of the AP-1 binding sites has been defined as TGA(C/G)TCA, namely the 12-O-tetradecanoylphorbol-13acetate (TPA) response element (TRE) elements (Eferl and Wagner,

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

2003; Wisdom, 1999). It is demonstrated that AP-1 regulates gene expression in response to a wide variety of stimuli, including cellular stress, inflammatory cytokines, growth factors, and bacterial and viral infections and participates in a large number of cellular processes including differentiation, proliferation, survival, apoptosis and immune response (Eferl and Wagner, 2003; Wisdom, 1999). The innate immune response against infectious pathogens is required for involvement of activation of several transcription factors including NF-κB, AP-1, IRF and STAT (Akira, 2009). It was reported that the JNK pathway was activated upon microbial challenge and the AP-1 family proteins played a key role in the synthesis of immune effector molecules, such as antimicrobial peptides (AMPs) (Kallio et al., 2005). In Drosophila, it has been well demonstrated that the TAK1/JNK/AP-1 signaling pathway was involved in antimicrobial peptide gene expression, suggesting that AP-1 played crucial roles in immune response to bacterial infection (Delaney et al., 2006). It has also been documented that AP-1 proteins played important roles in viral infection. Some viruses have developed different strategies to manipulate AP-1, most likely destined to enhance viral gene transcription or virus replication. For example, human cytomegalovirus (HCMV) infection caused a rapid induction of c-Fos and c-Jun to activate the viral immediate-early genes (Isern et al., 2011). Human immunodeficiency virus type 1 (HIV-1) activated AP-1 to stimulate HIV-1 LTR promoter (Liu et al., 2014). AP-1 was also demonstrated to facilitate chronic hepatitis B virus (HBV) replication (Ren et al., 2014). Recently, a L. vannamei Jun family gene (termed Lvc-Jun, GenBank accession number: KM401573), a central component of AP-1 complex, has been cloned and functional identified during WSSV infection (Yao et al., 2014). Lvc-Jun was activated in response to WSSV challenge and engaged for virus gene (wsv069) transcription, suggesting that the activation of Lvc-Jun might be beneficial to WSSV infection (Yao et al., 2014). However, the mechanisms that Lvc-Jun mediated WSSV infection remain unknown. The main AP-1 proteins in mammalian cells are Fos and Jun (Eferl and Wagner, 2003). In mammals, there are four Fos proteins (cFos, FosB, Fra1 and Fra2) and three Jun proteins (c-Jun, JunB and JunD) (Eferl and Wagner, 2003). In contrast to vertebrates, only one Jun and one Fos protein appear to be present in Drosophila (Kockel et al., 2001). In the present study, we isolated a c-Fos homolog (designated as Lvc-Fos), another main component of AP-1 complex, from L. vannamei for the first time. Lvc-Fos interacted with Lvc-Jun, and they could function as transcription factors to activate antimicrobial peptides (AMPs) of Drosophila and shrimps. RNA interference was used to explore the function of Lvc-Fos and Lvc-Jun and the results suggested that they could play opposite roles in bacterial and viral infection.

2. Materials and methods 2.1. Cloning of full length of Lvc-Fos cDNA A partial EST sequence, coding for a putative Fos family protein, was retrieved from the L. vannamei transcriptome data (Li et al., 2012), and was used to design specific primers for cloning the full length of Lvc-Fos gene (Table 1). The cDNA library for rapid amplification cDNA ends (RACE) was obtained from previous research (Li et al., 2014). The first round 5′ and 3′-RACE PCR amplifications were performed with Universal Primer A Mix (UPM)/Lvc-Fos-5RACE1 or UPM/Lvc-Fos-3RACE1, respectively. The first round PCR products were diluted 50-fold as templates for the second round PCRs. The second round 5′ and 3′-RACE PCR amplifications were performed with Nested Universal Primer A (NUP) and Lvc-Fos-5RACE2 or 3RACE2 primers, respectively. The second round PCR amplified products were cloned into pEASY-T1 Cloning Vector (TransGen Biotech, China) and 12 positive clones were selected for sequencing.

27

Table 1 Summary of primers in this study. Name

Sequence (5′–3′)

RACE Lvc-Fos-3RACE1 CTCTGGCCCCAAGCTTCGCTCTCAC Lvc-Fos-3RACE2 CTCCTCTAACATCGGCCTCTTCGTG Lvc-Fos-5RACE1 GTCACCTGTTCGGACTCGCTGACTAAC Lvc-Fos-5RACE2 TGGCGTCACTTGAAACGTTACAGGC Real-time RT-PCR LvEF-1α-F TATGCTCCTTTTGGACGTTTTGC LvEF-1α-R CCTTTTCTGCGGCCTTGGTAG Lvc-Fos-F CCATTACAGCTGTGGCTACGAGT Lvc-Fos-R GGTCTGTTCGATGTTCCTCAAG Lvc-Jun-F GACGCCCTCCCAGTTCTTCTT Lvc-Jun-R CTGGTGGAGATGGCATCCTG LvPEN2-F TTCTCAGATGTCCGCATTTGC LvPEN2-R ACGTTGTCAAGCCAGGTTTCC LvPEN3-F TACAACGGTTGCCCTGTCTCA LvPEN3-R ACCGGAATATCCCTTTCCCAC LvPEN4-F GGTGCGATGTATGCTACGGAA LvPEN4-R CATCGTCTTCTCCATCAGCCA Absolute real-time quantitative PCR WSSV32678-F TGTTTTCTGTATGTAATGCGTGTAGGT WSSV32753-R CCCACTCCATGGCCTTCA TaqMan probe WSSV32706 CAAGTACCCAGGCCCAGTGTCATACGTT Protein expression Lvc-Fos-Fa GGGAATTCATCAAAATGTTAGTCAGCGAGTCCGAAC Lvc-Fos-R GGTCTAGAAAGGGACACCAGCTTGGGC Lvc-Fos-R (TAA) GGTCTAGATAAAAGGGACACCAGCTTGGGC Lvc-Jun-Fa GGGGTACCATCAAAATGGAGGCAACCATGTACGAGG Lvc-Jun-R TTGGGCCCCTGGTGCGTTACGAAGGGGATC dsRNA templates amplification DsRNA-Lvc-Fos-T7-F GGATCCTAATACGACTCACTATAGGCCCACTTCGTCC qlTCGTCTTCG DsRNA-Lvc-Fos-R AGGTCCTCCTCGTGCTCCAT DsRNA-Lvc-Fos-F CCCACTTCGTCCTCGTCTTCG DsRNA-Lvc-Fos-T7-R GGATCCTAATACGACTCACTATAGGAGGTCCTCCTCG TGCTCCAT DsRNA-Lvc-Jun-T7-F GGATCCTAATACGACTCACTATAGGACCATCCTCAAC AGCAACACG DsRNA-Lvc-Jun -R CGCTCCTGGCACTCCATATC DsRNA-Lvc-Jun -F ACCATCCTCAACAGCAACACG DsRNA-Lvc-Jun -T7-R GGATCCTAATACGACTCACTATAGGCGCTCCTGGCAC TCCATATC DsRNA-GFP-T7-F GGATCCTAATACGACTCACTATAGGCGACGTAAACGG CCACAAGTT DsRNA-GFP-R ATGGGGGTGTTCTGCTGGTAG DsRNA-GFP-F CGACGTAAACGGCCACAAGTT DsRNA-GFP-T7-R GGATCCTAATACGACTCACTATAGGATGGGGGTGTTC TGCTGGTAG a

The D. melanogaster Kozak translation initiation sequence was underlined.

2.2. Sequence and phylogenetic analysis of Lvc-Fos Protein domains of Lvc-Fos were predicted using the SMART program (Simple Modular Architecture Research Tool) (Letunic et al., 2014). Protein sequences of c-Fos homologs from other species were retrieved from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/ebinet.htm) databases. Sequences of c-Fos proteins in this study were aligned by Clustal X v2.0 program (Larkin et al., 2007) and then visualization using GeneDoc software (http://www.nrbsc.org/gfx/genedoc/ebinet.htm) where the identities between Lvc-Fos and c-Fos homologs were labeled. The phylogenetic tree was constructed based on the fulllength amino acid sequences of c-Fos proteins by utilizing MEGA 5.0 software (Tamura et al., 2011) with the neighbor-joining (NJ) method, applying the Poisson distribution substitution model and bootstrapping procedure with 1000 bootstraps. 2.3. Plasmid constructions The open reading frame (ORF) of Lvc-Fos was cloned into pAc5.1/ V5-His A (Invitrogen) and pAc5.1-GFP (Li et al., 2012) vectors with

28

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

primers of Lvc-Fos-F/Lvc-Fos-R to generate pAc-Lvc-Fos-V5 and pAcLvc-Fos-GFP plasmids for expressing V5-tagged and GFP-tagged LvcFos protein, respectively. As the same way, the pAc-Lvc-Jun-V5 and pAc-Lvc-Jun-GFP plasmids were also constructed with primers of Lvc-Jun-F/Lvc-Jun-R to express V5-tagged or GFP-tagged Lvc-Jun protein. In addition, pAc-Lvc-Fos-TAA was also generated with primers of Lvc-Fos-F/Lvc-Fos-R (TAA), which included a stop codon of TAA and expressed the Lvc-Fos protein without C-terminal V5His tag. The Lvc-Fos and Lvc-Jun expression plasmids were inserted with a Drosophila Kozak consensus sequence (ATCAAA) before the ATG initiation codon for better initiation of translation (Cavener, 1987). The promoters of Drosophila antimicrobial peptide genes including Attacin A (AttA), Cecropin A (CecA), Drosomycin (Drs), Defensin (Def) and Metchnikowin (Mtk), L. vannamei antimicrobial peptide genes including Penaeidin2 (LvPEN2), Penaeidin3 (LvPEN3) and Penaeidin4 (LvPEN4) and Penaeus monodon antimicrobial peptide genes including Penaeidin411 (PmPEN411) and Penaeidin536 (PmPEN536) were obtained from the previous construction (Ho and Song, 2009; Huang et al., 2010a, 2010b; O’Leary and Gross, 2006; Wang et al., 2009). WSSV luciferase reporter plasmids wsv069 (WSSV069) and wsv249 (WSSV249) were also obtained from our lab in a previous study (Wang et al., 2013). 2.4. Co-immunoprecipitation, native-PAGE and western blot For co-immunoprecipitation assay, pAc-Lvc-Fos-V5 was cotransfected with pAc-Lvc-Jun-GFP or pAc5.1-GFP (as a control) into Drosophila Schneider 2 (S2) cells. For reciprocal coimmunoprecipitation assay, S2 cells was transfected with pAc5.1Lvc-Jun-V5/pAc5.1-Lvc-Fos-GFP or pAc5.1-GFP (as a control). Fortyeight hours post transfection, cells were harvested and washed with ice-cold PBS three times, and then lysed in IP Lysis Buffer (Pierce) with a Halt Protease Inhibitor Cocktail (Thermo Scientific). Both coimmunoprecipitation and reciprocal co-immunoprecipitation were performed using anti-V5 agarose affinity gel (Sigma) and samples were subjected to SDS–PAGE assay. Western blotting was performed with rabbit anti-GFP antibody (Sigma) and alkaline phosphatase-conjugated goat anti-rabbit secondary antibody (Sigma). A standardized aliquot (5%) of each total input cell lysates was also examined as control. For dimmer protein analysis, pAc-Lvc-Jun-V5 co-transfected with pAc-Lvc-Fos-TAA (expressing the Lvc-Fos protein without C-terminal His/V5 tag) or pAc5.1-Basic (as a control) into S2 cells. Samples were analyzed using 5% acrylamide gel (without SDS). Briefly, the gel were prerun with 25 mM Tris and 192 mM glycine, pH 8.4, with and without 1% deoxycholate (DOC) in the cathode and anode chamber, respectively, for 30 min, at 50 mA. Samples in the native sample buffer (62.5 mm Tris–Cl, pH 6.8, 15% glycerol and 1% DOC) were applied to the gel and electrophoresed for 60 min at 50 mA, and further detected by western-blot. 2.5. Dual-luciferase reporter assays Drosophila S2 cells were cultured at 28 °C in Schneider’s Insect Medium (Sigma) supplemented with 10% fetal bovine serum (Gibco). Plasmids were transfected using the FuGENE Transfection Reagent (Promega) according to the manufacturer’s illustration. For dualluciferase reporter assays, S2 cells with 60–80% confluent in each well of a 96-well plate were transfected with 0.05 μg reporter gene plasmids (firefly luciferase), 0.005 μg pRL-TK renilla luciferase plasmid (Promega), and 0.05 μg expression plasmids or empty pAc5.1/V5-His A plasmid (as a control). The pRL-TK renilla luciferase plasmid was used here as an internal control. At 48 h post transfection, dual-luciferase reporter assays were performed to calculate the relative ratios of firefly and renilla luciferase activities

according to the manufacturer’s instructions with each experiment was repeated six times. 2.6. Confocal laser scanning microscopy Drosophila S2 cells were plated onto poly-L-lysine-treated glass cover slips in a 24-well plate with approximate 40% confluent. S2 cells were transfected with pAc5.1-Lvc-Fos-GFP or pAc5.1-Lvc-JunGFP vectors using the FuGENE HD Transfection Reagent (Promega). At 36 h post transfection, subcellular localizations of Lvc-Fos and Lvc-Jun were analyzed using the Hoechst Staining Kit (Beyotime, China) and visualized with confocal laser scanning microscope (Leica TCS-SP5, Germany). 2.7. The real-time RT-PCR analysis of Lvc-Fos and Lvc-Jun expression Healthy shrimps (specific pathogens free L. vannamei, ~5 g weight each) were obtained from the local shrimp farm in Zhuhai, Guangdong Province, China. For tissue distribution assay, the twelve tissues including hemocyte, gill, hepatopancreases, intestine, stomach, epithelium, muscle, eyestalk, scape (the first segment of antennae), heart, nerve and pyloric ceca were isolated and each tissue was pooled from 15 shrimps. For challenge experiments, shrimps were divided into four experimental groups, in which each L. vannamei received an injection of 50 μl Poly (I:C) (5 μg, Sigma), 50 μl Staphylococcus aureus (1 × 105 CFU), 50 μl V. parahaemolyticus (1 × 105 CFU) or 50 μl WSSV particles suspension (1 × 105 copies), respectively. The negative control group received an injection of 50 μl PBS. Gills of challenged shrimps were collected at 0, 4, 8, 12, 24, 36, 48, 72 h post injection, and the samples at each time point were pooled from 15 shrimps. Total RNA extraction, reverse transcription and realtime RT-PCR analysis were performed in detail as previous research (Li et al., 2014). Expression levels of Lvc-Fos and Lvc-Jun were calculated using the Livak (2−△△CT) method (Livak and Schmittgen, 2001) after normalization to L. vannamei EF-1α. All samples were tested in triplicate. Primer sequences were listed in Table 1. 2.8. Knockdown of Lvc-Fos or Lvc-Jun expression by dsRNAmediated RNA interference The dsRNAs corresponding to the Lvc-Fos and Lvc-Jun genes, as well as green fluorescent protein (GFP, as a control) gene, were synthesized by in vitro transcription with T7 RiboMAX™ Express RNAi System (Promega). The lengths of Lvc-Fos, Lvc-Jun and GFP dsRNAs are 631 bp, 487 bp and 554 bp, respectively. The experimental groups received intramuscular injections of Lvc-Fos dsRNA or Lvc-Jun dsRNA (2 μg/g shrimp in 50 μl PBS), while the control groups were injected with equivalent GFP dsRNA and PBS, respectively. Realtime RT-PCR was performed to measure the RNA interference efficiency. Briefly, at 48 h after the dsRNA injection, gills of each group (9 shrimps) were collected for total RNA extraction and subsequently total RNA was reversely transcribed into cDNA as the template for real-time RT-PCR. On the other hand, expression levels of L. vannamei AMP genes including penaeidin2 (LvPEN2, GenBank No. DQ206401), penaeidin3 (LvPEN3, GenBank No. DQ206403) and penaeidin4 (LvPEN4, GenBank No. DQ206402) at 48 h after the dsRNA injection were also detected by real-time RT-PCR. L. vannamei EF-1α was used as an internal control. Primer sequences were listed in Table 1. 2.9. V. parahaemolyticus, WSSV and PBS challenge experiments in Lvc-Fos- or Lvc-Jun-knockdown shrimp Healthy L. vannamei (average 5 g) received an intramuscular injection of 50 μl (2 μg/g shrimp in PBS) dsRNA (Lvc-Fos dsRNA, LvcJun dsRNA or GFP dsRNA) or PBS. Forty-eight hours later, shrimps

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

29

Fig. 1. Sequence features, multiple sequence alignment and phylogenetic analysis of Lvc-Fos. (A) The full-length cDNA sequence and deduced amino acid sequences of LvcFos. Nucleotides and amino acids were numbered on the left of the sequences. The ORF of the nucleotide sequence was shown in upper-case letters, while the 5′ and 3′UTR sequences were shown in lowercase. Amino acid sequence was represented with one-letter codes above the nucleotide sequence. The basic-leucine zipper (bZIP) domain was shadowed. (B) Multiple sequence alignment of the c-Fos proteins. The identical amino acid residues shaded in black and the similar residues in gray. Amino acid identities of the Lvc-Fos with other c-Fos proteins were shown on the right. The conserved bZIP domains were underlined. (C) Phylogenetic tree analysis of the full-length amino acid sequences of c-Fos proteins from various species (Lvc-Fos was marked with a triangle) using MEGA 5.0 software. Proteins analyzed listed below: Lvc-Fos, Litopenaeus vannamei c-Fos (accession No. KP676567); Dmc-Fos, Drosophila melanogaster c-Fos (NP_001027579.1); Hsc-Fos, Homo sapiens c-Fos (NP_005243.1); Mmc-Fos, Mus musculus c-Fos (CAA24105.1); Acromyrmex echinatior c-Fos (EGI69977.1); Apis mellifera c-Fos (XP_006564216.1); Bos Taurus c-Fos (NP_877587.1); Culex quinquefasciatus c-Fos (XP_001845340.1); Danio rerio c-Fos (NP_991132.1); Daphnia pulex c-Fos (EFX67112.1); Danaus plexippus c-Fos (EHJ73792.1); Gallus gallus c-Fos (NP_990839.1); Ovis aries c-Fos (NP_001159654.1); Pan troglodytes c-Fos (NP_001091891.1); Sus scrofa c-Fos (NP_001116585.1); Tribolium castaneum c-Fos (NP_001164292.1).

30

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

Fig. 2. Tissue distributions of Lvc-Fos and Lvc-Jun in healthy L. vannamei. Transcription levels of Lvc-Fos (A) and Lvc-Jun (B) in different tissues were analyzed by realtime RT-PCR. L. vannamei EF-1α expression was used as an internal control and the data were shown as mean ± SD of triplicate assays. Expression levels in the pyloric ceca (for Lvc-Fos) and muscle (for Lvc-Jun) were used as control and set to 1.0.

Fig. 3. Expression profiles of Lvc-Fos and Lvc-Jun in gills from pathogens or stimulants challenged L. vannamei. Expression profiles of Lvc-Fos (A) and Lvc-Jun (B) in gills from WSSV, Poly (I:C), S. aureus and V. parahemolyticus challenged shrimps. Realtime RT-PCR was performed in triplicate for each sample. Expression values were normalized to those of EF-1α using the Livak (2−△△CT) method and the data were provided as the means ± SD of triplicate assays. Expression level detected at 0 h post injection of the WSSV challenged group was set as 1.0.

3. Results 3.1. Sequence features and phylogenetic analysis of Lvc-Fos

were challenged again with 1 × 105 copies of WSSV particles or 1 × 105 CFU V. parahaemolyticus, and mock-challenged with PBS as a control, respectively. Shrimps were cultured in tanks with air-pumped circulating seawater for about 5 days following infection. Cumulative mortality of each group was recorded every 4 h. Differences were analyzed by using the Kaplan–Meier plot (log-rank χ2 test) method with the GraphPad Prism software. For the WSSV challenge test, a parallel experiment was performed to monitor the effects of Lvc-Fos or Lvc-Jun-knockdown on WSSV replication. Briefly, muscle tissues (pleopod) were sampled from 9 surviving shrimps (3 shrimps pooled together) at 48, 72 and 120 h post infection. DNA extraction from the collected samples were performed with TIANamp Marine Animals DNA Kit (Tiangen, China) according to the user’s manual. Absolute real-time quantitative PCR was used to measure the quantities of WSSV genome copies with primers WSSV32678-F/WSSV32753-R and a Taq Man fluorogenic probe (Table 1) as the previous report (Qiu et al., 2014). The WSSV genome copy numbers in 1 μg of shrimp muscle DNA were then calculated.

The full-length cDNA sequence of Lvc-Fos was cloned by 5′ and 3′-RACE PCR amplification. The Lvc-Fos transcript was 2130 bp in length and comprised of a 218 bp 5′-untranslated region (UTR), a 406 bp 3′-untranslated region containing a poly (A) tail, and a 1506 bp open reading frame (ORF) that encoded a protein of 501 amino acids with a calculated molecular weight of ~53.1 kDa (GenBank accession number: KP676567) (Fig. 1A). Domain prediction analysis displayed that Lvc-Fos protein contained a basicleucine zipper (bZIP) domain of 65 amino acids, located at 252– 316 region (Fig. 1A). Multiple sequence alignment indicated that the bZIP domains of c-Fos proteins were conserved between vertebrates and invertebrates (Fig. 1B). However, in addition to the bZIP domains, the amino acids of c-Fos proteins shared low identity between vertebrates and invertebrates, and the full length of LvcFos showed 18% identity to the Drosophila melanogaster c-Fos protein (Dmc-Fos), 20% identity to the Mus musculus c-Fos protein (MmcFos) and 20% identity to the Homo sapiens c-Fos protein (Hsc-Fos) (Fig. 1B). A neighbor-joining (NJ) phylogenetic tree was constructed to measure the relationship of Lvc-Fos protein and its

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

31

Fig. 4. Subcellular localization of Lvc-Fos and Lvc-Jun. Drosophila S2 cells were transfected with plasmids pAc-Lvc-Fos-GFP or pAc-Lvc-Jun-GFP. At 36 h post-transfection, the cells were observed using a Leica laser scanning confocal microscope.

homologs from Drosophila, Human and other species. As shown in Fig. 1C, all the c-Fos proteins used in this study were separated into the vertebrate and invertebrate groups. In invertebrate group, L. vannamei c-Fos (Lvc-Fos), Tribolium castaneum c-Fos, Danaus plexippus c-Fos, Daphnia pulex c-Fos and D. melanogaster c-Fos were clustered together. 3.2. Lvc-Fos and Lvc-Jun were constitutively transcribed in various tissues Transcripts of both Lvc-Fos and Lvc-Jun could be detected in all examined tissues (Fig. 2). In healthy shrimp, the expression of LvcFos was high in nerve and muscle, moderate in most tested tissues including intestine, eyestalk, scape, hemocyte, heart and gill and low in stomach, epithelium, hepatopancreas and pyloric caecum (Fig. 2A). Lvc-Jun was highly expressed in gill, heart, intestine and pyloric caecum, moderately expressed in scape, nerve and eyestalk and lowly expressed in hepatopancreas, stomach, epithelium, hemocyte and muscle (Fig. 2B). 3.3. Lvc-Fos and Lvc-Jun showed different expression profiles in response to immune stimuli The time-course expression changes of Lvc-Fos and Lvc-Jun in gill tissue after various stimuli challenges were further investigated by real-time RT-PCR. Upon WSSV challenge, the expression of Lvc-Fos was dramatically up-regulated at 8 h with a peak value of ~22.42-fold, and maintained a high level during 36–72 h with ~4.15-fold, ~12.31-fold and ~7.27-fold at 36, 48 and 72 h, respectively (Fig. 3A). During Poly (I:C) challenge, the Lvc-Fos expression was slightly up-regulated at 4, 48 and 72 h (Fig. 3A). In response to S. aureus challenge, Lvc-Fos expression showed no obvious changes (Fig. 3A). After V. parahaemolyticus challenge, the expression of LvcFos was slightly up-regulated from 4 h to 24 h with a peak value at 12 h (~2.57-fold), and then down-regulated at 36 h, and finally increased at 48 h (Fig. 3A). As distinguished from Lvc-Fos, Lvc-Jun showed significantly up-regulated expression profiles in response to various stimuli. During WSSV infection, the expression of LvcJun was dramatically up-regulated and maintained a very high level in the whole stage (Fig. 3B). After Poly (I:C) challenge, Lvc-Jun ex-

pression remarkably increased during 4–72 h, and finally reached a peak of ~48.53-fold at 72 h (Fig. 3B). Similar to Poly (I:C) challenge, during S. aureus infection, the expression of Lvc-Jun was continually up-regulated during 4–72 h with a peak at 72 h (~58.18fold) (Fig. 3B). In response to V. parahaemolyticus, the expression of Lvc-Jun was remarkably up-regulated at 4–12 h, and then fell back at 24 h and 48 h, and finally increased at 72 h (Fig. 3B). In the control group injected by PBS, the expression of both Lvc-Fos and Lvc-Jun did not change obviously (not shown here). 3.4. Lvc-Fos and Lvc-Jun localized in nucleus Subcellular localization is a key functional characteristic of proteins. The pAc-Lvc-Fos-GFP and pAc-Lvc-Jun-GFP plasmids were transfected into Drosophila S2 cells separately, and the recombinant proteins were visualized using confocal laser scanning microscope. As shown in Fig. 4, both GFP-tagged Lvc-Fos and GFPfused Lvc-Jun were dispersedly presented in the nucleus, suggesting that Lvc-Fos and Lvc-Jun were nucleus localized. 3.5. Interaction between Lvc-Fos and Lvc-Jun c-Fos and c-Jun are the central component of activator protein 1 (AP-1), which function as transcription factor by a dimeric complex. In this study, the c-Fos homolog from L. vannamei (Lvc-Fos) was identified, and the interaction between Lvc-Fos and Lvc-Jun was investigated by Co-IP assays. Co-IP and reciprocal Co-IP assays demonstrated that the two proteins were co-precipitated with each other during immunoprecipitation, suggesting Lvc-Fos was a binding partner of Lvc-Jun (Fig. 5A and B). Moreover, native-PAGE determined that Lvc-Jun formed a heterodimer with Lvc-Fos (lane 1 of Fig. 5C). Furthermore, Lvc-Jun could form a homodimer with itself (lane 2 of Fig. 5C), which was consistent with previous report of selfinteraction of Lvc-Jun (Yao et al., 2014). 3.6. Lvc-Fos and Lvc-Jun were involved in regulation of antimicrobial peptide genes Drosophila activator protein 1 (AP-1), including c-Fos and c-Jun proteins, played an important role in the synthesis of

32

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

Fig. 5. Lvc-Fos and Lvc-Jun interacted with each other. (A). Co-immunoprecipitation assays showed that the GFP-tagged Lvc-Jun but not the control GFP protein can be coprecipitated by V5-tagged Lvc-Fos. (B). Reciprocal co-immunoprecipitation showed that GFP-tagged Lvc-Fos but not GFP can be co-precipitated with V5-tagged Lvc-Jun. Immunoprecipitation (IP) and western-blotting were performed using anti-V5 and anti-GFP antibodies, respectively. Input: western-blotting analysis of the input cell lysates (5%) before immunoprecipitation. Approximate molecular sizes: Lvc-Fos-V5, ~54 kDa; Lvc-Fos-GFP, ~82 kDa; Lvc-Jun-V5, ~33 kDa; Lvc-Jun-GFP, ~61 kDa; GFP, ~28 kDa. (C). Lvc-Fos formed a heterodimer with Lvc-Jun. pAc-Lvc-Jun-V5 co-transfected with pAc-Lvc-Fos-TAA or pAc5.1-Basic (as a control) into Drosophila S2 cells, and then samples were subjected to native-PAGE, and further detected by western blot.

antimicrobial peptide genes. In this study, dual-luciferase reporter assays were performed in S2 cells to measure the function of LvcFos and Lvc-Jun in the regulation of AMP genes. As shown in Fig. 6, over-expression of Lvc-Fos could up-regulate promoter activities of AMP genes including the L. vannamei AMPs LvPEN2 (~1.73-fold), LvPEN3 (~4.63-fold) and LvPEN4 (~2.74-fold), the P. monodon AMP PmPEN536 (~1.44-fold) and the Drosophila AMP DmDrs (~1.48fold). Similar to Lvc-Fos, Lvc-Jun over-expression could dramatically up-regulate the promoter activities of LvPEN2, LvPEN3, LvPEN4, PmPEN536 and DmDrs by ~5.55-, ~40.46-, ~19.14-, ~1.70- and ~1.39fold, respectively. Interestingly, in contrast to Lvc-Fos with no obvious effect on Drosophila AMPs, over-expression of Lvc-Jun could remarkably down-regulate Drosophila AMPs DmCecA, DmMtk, DmDef and DmAttA with ~3.38-, ~5.95-, ~2.82- and ~8.77-fold decrease, respectively. These results suggested that Lvc-Fos and Lvc-Jun could play different roles in the activation of shrimp AMPs and Drosophila AMPs.

3.7. Both Lvc-Fos and Lvc-Jun played key roles in antibacterial defense against V. parahaemolyticus To explore the function of Lvc-Jun and Lvc-Fos in response to bacterial invaders, we knocked down Lvc-Jun or Lvc-Fos in L. vannamei by sequence-specific, dsRNA-mediated RNAi, and at 48 h post dsRNAs injection, the shrimps were challenged with V. parahaemolyticus. The silencing efficiencies of Lvc-Jun and Lvc-Fos were checked by using real-time RT-PCR. At 48 h after injection of the Lvc-Jun or Lvc-Fos dsRNAs, the expression levels of Lvc-Jun or Lvc-Fos were significantly down-regulated to ~0.32-fold (Fig. 7A) and ~0.18-fold (Fig. 7B) of the GFP dsRNA injection groups (positive control), respectively, while there was no suppressive effect on Lvc-Jun or Lvc-Fos in the PBS injection groups (negative control) (Fig. 7A and B). Using luciferase assays, we demonstrated that overexpressed LvcJun and Lvc-Fos increased the promoter activities of LvPEN2, LvPEN3 and LvPEN4 in Drosophila S2 cells (Fig. 6). Next, we investigated the

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

33

PBS + WSSV group were much higher compared to that of the dsRNAGFP + WSSV control group (Fig. 8A and B). Previous study indicated that shrimp JNK-c-Jun signaling pathway is important for WSSV gene expression such as wsv069 (Shi et al., 2012; Yao et al., 2014). Based on the Lvc-Fos- and Lvc-Jun-silenced shrimps were resistant to WSSV infection, we hypothesized that the activation of Lvc-Fos or Lvc-Jun could facilitate viral gene expression. By screening Drosophila S2 cells co-transfected with Lvc-Fos or (and) Lvc-Jun, the promoter activities of wsv069 and wsv249 can be significantly induced (Fig. 8C). 4. Discussion

Fig. 6. The effects of Lvc-Fos or Lvc-Jun on the promoter activities of AMP genes. Drosophila S2 cells were transfected with the protein expression vectors (Lvc-Fos or Lvc-Jun and the pAc5.1 empty vector as a control), the reporter gene plasmid (AMPs promoters), and the pRL-TK Renilla luciferase plasmid (as an internal control). After 48 h, the cells were harvested for measurement of luciferase activity using the dualluciferase reporter assay system (Promega). The bars indicated the mean ± SD of the luciferase activity (n = 6). The statistical significance was calculated using Student’s t-test (** p < 0.01).

effects of Lvc-Jun and Lvc-Fos on the expression of LvPEN2, LvPEN3 and LvPEN4 in vivo. In the gills of Lvc-Fos-silenced or Lvc-Junsilenced L. vannamei, the levels of LvPEN2, LvPEN3 and LvPEN4 were significantly downregulated (Fig. 7C). As shown in Fig. 7D, during V. parahemolyticus infection, the cumulative mortality of the Lvc-Fos dsRNA group increased rapidly from 4 h post V. parahemolyticus challenge until 48 h, and it was significantly higher than that in the GFP dsRNA group (Kaplan–Meier log-rank χ2: 9.751, P = 0.0018). Final mortality rates were ~70.00%, ~32.14% and ~40.54% for the Lvc-Fos dsRNA, GFP dsRNA and PBS groups, respectively. On the other hand, there was sharp increase in the cumulative mortality (final mortality rate: ~94.74%) attributable to Lvc-Jun knockdown (log-rank χ2: 31.34, P < 0.0001) (Fig. 7D). These results suggested that Lvc-Jun and Lvc-Fos might play an important antibacterial role, at least against V. parahemolyticus. 3.8. Suppression of Lvc-Fos or Lvc-Jun expressions caused lower mortality rates and reduced virus loads in WSSV infection RNAi was also performed to investigate the role of Lvc-Fos or LvcJun during WSSV infection. In both Lvc-Fos and Lvc-Jun dsRNA groups, the cumulative mortalities were obviously lower than that of the GFP dsRNA group during the period of 24–120 h (Fig. 8A). The final mortality rates were ~33.33%, ~44.12%, ~52.63% and ~71.05% for the Lvc-Fos dsRNA, Lvc-Jun dsRNA, GFP dsRNA and PBS groups, respectively (Fig. 8A). In Lvc-Fos- or Lvc-Jun-knockdown shrimps, the WSSV copies of muscle tissue were further detected by utilizing absolute quantitative real-time PCR. As shown in Fig. 8B, the virus loads of dsRNALvc-Fos + WSSV group were much lower than that of the dsRNAGFP + WSSV control group with ~2.50-fold, ~ 24.00-fold and ~9.70fold decrease at 48, 72 and 120 h, respectively. In Lvc-Jun knockdown group, the virus loads showed much lower levels compared to the dsRNA-GFP + WSSV control group at 72 and 120 h with ~22.00fold and ~89.20-fold decrease, respectively, but there was no obvious change at 48 h. These results suggested that Lvc-Fos or Lvc-Jun could play important roles in WSSV replication. Moreover, in PBS + WSSV group, both the WSSV genome copies and cumulative mortality of

To date, members of the AP-1 family have been isolated from yeast (Moye-Rowley et al., 1989), insects (Perkins et al., 1990), and humans (Eferl and Wagner, 2003; Neuberg et al., 1989). Recently, a Jun family protein Lvc-Jun, a central member of AP-1 from L. vannamei in crustacea, has also been cloned and functionally identified (Yao et al., 2014). However, studies on AP-1, especially another member c-Fos, in the immune response of L. vannamei including bacterial and viral infections are not yet elucidated. In this study, a c-Fos homolog Lvc-Fos was isolated successfully and characterized from L. vannamei. The L. vannamei c-Fos and c-Jun mRNA expression profiles in different tissues and functions in response to V. parahemolyticus or WSSV stimulations were also investigated. Other than the bZIP domain, AP-1 family members bear few similar amino acid sequences. For example, D. melanogaster c-Fos contained amino acids that were highly conserved in the leucine repeat and basic domains but bore low similarity elsewhere in the molecule (Perkins et al., 1990). L. vannamei c-Fos exhibited the clear features of a Fos family member in the bZIP domain, which were conserved both in invertebrates and vertebrates. Similar to the case of Lvc-Jun sharing low similarity with other c-Jun members (Yao et al., 2014), sequence analysis showed that Lvc-Fos also displayed low similarity at the primary sequence level outside this conserved bZIP domain. Interestingly, both D. melanogaster c-Fos (595 aa) and L. vananmei c-Fos (501 aa) were significantly larger than the H. sapiens (380 aa) and M. musculus c-Fos (380 aa) proteins, suggesting that there might be additional functional features in these proteins. These data demonstrated that Lvc-Fos was a novel homolog of c-Fos family. Several lines of evidences indicate a critical role of AP-1 proteins in the cellular immune response to a wide variety of signals (Eferl and Wagner, 2003; Kockel et al., 2001; Wisdom, 1999). In this report, the expression of L. vannamei AP-1 was investigated in gills after challenged with S. aurcus, V. parahemolyticus, WSSV and Poly (I:C). Lvc-Jun was significantly up-regulated during these challenges, in which WSSV infection rapidly increased the expression of Lvc-Jun, correlating well with the previous report (Yao et al., 2014). In addition, Lvc-Fos exhibited obvious up-regulation expression but a weaker effect compared to Lvc-Jun after WSSV and V. parahemolyticus infection. These findings suggested that both LvcJun and Lvc-Fos might have some different functions against bacterial and viral infection in L. vannamei. Understanding the subcellular location of proteins is critical for displaying their functions, such as signal transduction and interaction. It has been noted in mammals and Drosophila that the AP-1 is a collective term known as dimeric transcription factors composed of Jun and Fos, which are located in the nucleus to bind a AP-1-binding site to activate transcription of a bulk of targeted genes (Eferl and Wagner, 2003; Kockel et al., 2001; Wisdom, 1999). Our subcellular location, co-immunoprecipitation and native-PAGE assays showed that both Lvc-Fos and Lvc-Jun were located in the nucleus and could interact with each other in a heterodimer manner in Drosophila S2 cell. Previous study demonstrated that Lvc-Jun was distributed in the nucleus and could bind with itself in High Five

34

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

Fig. 7. Functional analysis of Lvc-Jun and Lvc-Fos in V. parahemolyticus infection by dsRNA-mediated RNAi. (A–C) Real-time RT-PCR analysis of the silencing efficiencies of Lvc-Jun (A) and Lvc-Fos (B), as well as the AMPs expression (C) in Lvc-Jun- and Lvc-Fos-silenced L. vananmei, the internal control was EF-1α. Samples were taken at 48 hours after injection with indicated dsRNA or PBS; (D) shrimps were injected intramuscularly with PBS, dsRNA-Lvc-Jun, dsRNA-Lvc-Fos or dsRNA-GFP. At 48 h after the initial injection, shrimps were infected with V. parahemolyticus and the PBS as the negative control. Cumulative mortality was recorded every 4 h. Differences in cumulative mortality levels between treatments were analyzed by Kaplan–Meier log-rank χ2 tests (**p < 0.01); experiments were performed two times with identical results.

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

Fig. 8. Function of Lvc-Fos and Lvc-Jun during WSSV infection. (A) Shrimps were injected with PBS, dsRNA-Lvc-Jun, dsRNA-Lvc-Fos or dsRNA-GFP. At 48 h after the first injection, shrimps were infected with WSSV. Cumulative mortality was recorded every 4 h. Differences in cumulative mortality levels between treatments were analyzed by Kaplan–Meier log-rank χ2 tests; (B) WSSV genome copies in muscle tissue (1 μg DNA) of Lvc-Fos dsRNA, Lvc-Jun dsRNA and the control PBS and GFP dsRNA treated shrimps at 48, 72 and 96 h post infection. Bars indicate the mean ± SD of three samples and statistical significances were calculated by Student’s t-test (**p < 0.01 and *p < 0.05). Experiments were performed twice with similar results; (C) promoter activities of wsv069 and wsv249 were induced by Lvc-Jun or (and) Lvc-Fos in Drosophila S2 cell. The bars indicated the mean ± SD of the luciferase activity (n = 6). The statistical significance was calculated using Student’s t-test (**p < 0.01).

cells (Yao et al., 2014), which was in good agreement with the case of Lvc-Jun in our results. Interestingly, when both Lvc-Fos and LvcJun were co-expressed in Drosophila S2 cell, heterodimer was the most abundant form than monomer and homodimer of Lvc-Jun. In

35

Drosophila, heterodimer of c-Fos and c-Jun was the most stable form (Perkins et al., 1990), the similar situation may also exist for c-Fos and c-Jun of L. vannamei. These observations indicated Lvc-Fos and Lvc-Jun could function as transcription factor in the nucleus, which was consistent with the putative function of c-Fos and c-Jun proteins as dimeric transcription factors. A number of investigators have reported that the AP-1 is involved in regulation of antimicrobial peptide genes (Delaney et al., 2006; Kallio et al., 2005; Kim et al., 2007). Ramet et al. used oligonucleotide microarrays to identify genes in response to Gramnegative bacteria, suggesting that the JNK/AP-1 pathway was essential for normal antimicrobial peptide release in Drosophila (Kallio et al., 2005). A study by Mlodzik et al. provided evidences that Drosophila TAK1/JNK/AP-1 signaling pathway was required for antimicrobial peptide gene expression (Delaney et al., 2006). In addition, it has been well demonstrated that the AP-1 played a key role in participating in the down-regulation of NF-κB target genes such as the antimicrobial peptide genes (Kim et al., 2007). In the present study, dual-luciferase report assays were performed to investigate the effect of shrimp AP-1 on activation of antimicrobial peptide genes. Our results showed that both Lvc-Fos and Lvc-Jun activated the promoters of shrimp AMP genes (LvPEN2, LvPEN3, LvPEN4 and PmPEN536) and Drosophila AMP gene (DmDrs). Interestingly, Lvc-Jun conspicuously down-regulated the expression of Drosophila Relish signaling controlled AMP genes (DmCeaA, DmMtk, DmDef and DmAttA). It has been noted that Drosophila c-Jun could interact with Stat92E and Dsp1 to form a repressosome complex to down-regulate the Relish-driven gene transcription (Kim et al., 2007), such a schema could be adequate for Lvc-Jun. Moreover, considering that DmDrs was activated mainly by Dif rather than Relish, this result suggested that there might be difference in involvement of c-Jun to regulate the types of AMPs. As discussed earlier, Lvc-Fos and Lvc-Jun could activate the expression of shrimp AMPs such as penaeidins, which could imply their important roles in bacterial infection. However, the actual functions of Lvc-Fos and Lvc-Jun in immune response against bacterial infection remain unknown. In this study, either Lvc-Fos- or LvcJun-knockdown L. vannamei exhibited the higher cumulative mortalities compared to their controls, suggesting that both LvcFos and Lvc-Jun played a protective role in bacterial infection, at least against V. parahemolyticus. On the other hand, the cumulative mortality of Lvc-Jun-silenced shrimp during V. parahemolyticus infection was much higher than that of Lvc-Fos-silenced shrimp, which could derive from the greater regulation of Lvc-Jun on AMPs, and it needs for further investigation. A growing body of researches have shown that WSSV can hijack the host transcription factors, such as Relish, STAT, ATF4, Kruppellike factor and XBP1, to promote viral pathogenesis (Chang et al., 2012; Huang et al., 2010b; Li et al., 2013; Liu et al., 2007). In addition, a very recent study demonstrated that the shrimp JNK-cJun signaling pathway could be helpful for WSSV gene transcription (Shi et al., 2012; Yao et al., 2014). In this study, RNAi was used to measure the function of AP-1 during WSSV infection. Our results revealed that either Lvc-Fos- or Lvc-Jun-silenced L. vannamei caused the lower cumulative mortalities compared to the GFP dsRNA control group, which was in accord with the virus loads in the corresponding groups. In addition, several WSSV immediate early (IE) genes, such as wsv069 and wsv249, contain the AP-1 binding sites in their promoters. And, both Lvc-Fos and Lvc-Jun can significantly upregulate the promoter activities of wsv069 and wsv249. These results suggested that the activation of Lvc-Fos and Lvc-Jun could be implicated in WSSV replication and viral gene expression. As has been noted in shrimp with nucleic acid induced antiviral immunity (Wang et al., 2013), our experiments provided a similar result that the higher cumulative mortality and WSSV copies presented in the PBS injected shrimps compared to the GFP dsRNA injected shrimps.

36

C. Li et al./Developmental and Comparative Immunology 52 (2015) 26–36

In brief, a novel c-Fos homolog from L. vannamei was cloned and characterized. Our results demonstrated that Lvc-Fos and Lvc-Jun, like their Drosophila counterparts, can bind to each other in a heterodimer manner. In addition, the functions of Lvc-Fos and LvcJun during bacterial and viral infection were also explored, which indicated they could play opposite roles in V. parahemolyticus and WSSV infection.

Acknowledgement This research was supported by National Natural Science Foundation of China (31402321 and U1131002); China Postdoctoral Science Foundation (2014M552266); Chinese Agriculture Research system (CARS-47); National High Technology Research and Development Program of China (973 Program) (2012CB114401); Special Fund for Agro-scientific Research in the Public Interest (201103034); Foundation from Science and Technology Bureau of Guangdong Province (2011A020102002 and 2009A020102002); Foundation from Administration of Ocean and Fisheries of Guangdong Province (A201101B02); and the Open Project of the State Key Laboratory of Biocontrol (SKLBC09K06). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References Akira, S., 2009. Pathogen recognition by innate immunity and its signaling. Proc. Jpn. Acad. Ser. B, Phys. Biol. Sci. 85, 143–156. Cavener, D.R., 1987. Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15, 1353–1361. Chang, L.K., Huang, P.H., Shen, W.T., Yang, S.H., Liu, W.J., Lo, C.F., 2012. Role of Penaeus monodon Kruppel-like factor (PmKLF) in infection by white spot syndrome virus. Dev. Comp. Immunol. 36, 121–129. De Schryver, P., Defoirdt, T., Sorgeloos, P., 2014. Early mortality syndrome outbreaks: a microbial management issue in shrimp farming? PLoS Pathog. 10, e1003919. Delaney, J.R., Stoven, S., Uvell, H., Anderson, K.V., Engstrom, Y., Mlodzik, M., 2006. Cooperative control of Drosophila immune responses by the JNK and NF-kappaB signaling pathways. EMBO J. 25, 3068–3077. Eferl, R., Wagner, E.F., 2003. AP-1: a double-edged sword in tumorigenesis. Nat. Rev. Cancer 3, 859–868. Ho, S.H., Song, Y.L., 2009. Cloning of penaeidin gene promoter in tiger shrimp (Penaeus monodon). Fish Shellfish Immunol. 27, 73–77. Huang, X.D., Yin, Z.X., Jia, X.T., Liang, J.P., Ai, H.S., Yang, L.S., et al., 2010a. Identification and functional study of a shrimp Dorsal homologue. Dev. Comp. Immunol. 34, 107–113. Huang, X.D., Zhao, L., Zhang, H.Q., Xu, X.P., Jia, X.T., Chen, Y.H., et al., 2010b. Shrimp NF-kappaB binds to the immediate-early gene ie1 promoter of white spot syndrome virus and upregulates its activity. Virology 406, 176–180. Isern, E., Gustems, M., Messerle, M., Borst, E., Ghazal, P., Angulo, A., 2011. The activator protein 1 binding motifs within the human cytomegalovirus major immediateearly enhancer are functionally redundant and act in a cooperative manner with the NF-{kappa}B sites during acute infection. J. Virol. 85, 1732–1746. Kallio, J., Leinonen, A., Ulvila, J., Valanne, S., Ezekowitz, R.A., Ramet, M., 2005. Functional analysis of immune response genes in Drosophila identifies JNK pathway as a regulator of antimicrobial peptide gene expression in S2 cells. Microbes Infect. 7, 811–819. Kim, L.K., Choi, U.Y., Cho, H.S., Lee, J.S., Lee, W.B., Kim, J., et al., 2007. Down-regulation of NF-kappaB target genes by the AP-1 and STAT complex during the innate immune response in Drosophila. PLoS Biol. 5, e238.

Kockel, L., Homsy, J.G., Bohmann, D., 2001. Drosophila AP-1: lessons from an invertebrate. Oncogene 20, 2347–2364. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., et al., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948. Letunic, I., Doerks, T., Bork, P., 2014. SMART: recent updates, new developments and status in 2015. Nucleic Acids Res. Leu, J.H., Yang, F., Zhang, X., Xu, X., Kou, G.H., Lo, C.F., 2009. Whispovirus. Curr. Top. Microbiol. Immunol. 328, 197–227. Li, C., Chen, Y.X., Zhang, S., Lu, L., Chen, Y.H., Chai, J., et al., 2012. Identification, characterization, and function analysis of the Cactus gene from Litopenaeus vannamei. PLoS ONE 7, e49711. Li, C., Weng, S., Chen, Y., Yu, X., Lu, L., Zhang, H., et al., 2012. Analysis of Litopenaeus vannamei transcriptome using the next-generation DNA sequencing technique. PLoS ONE 7, e47442. Li, C., Chen, Y., Weng, S., Li, S., Zuo, H., Yu, X., et al., 2014. Presence of Tube isoforms in Litopenaeus vannamei suggests various regulatory patterns of signal transduction in invertebrate NF-kappaB pathway. Dev. Comp. Immunol. 42, 174–185. Li, X.Y., Pang, L.R., Chen, Y.G., Weng, S.P., Yue, H.T., Zhang, Z.Z., et al., 2013. Activating transcription factor 4 and X box binding protein 1 of Litopenaeus vannamei transcriptional regulated white spot syndrome virus genes Wsv023 and Wsv083. PLoS ONE 8, e62603. Liu, R., Lin, Y., Jia, R., Geng, Y., Liang, C., Tan, J., et al., 2014. HIV-1 Vpr stimulates NF-kappaB and AP-1 signaling by activating TAK1. Retrovirology 11, 45. Liu, W.J., Chang, Y.S., Wang, A.H., Kou, G.H., Lo, C.F., 2007. White spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1. J. Virol. 81, 1461–1471. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T) method. Methods 25, 402–408. Moye-Rowley, W.S., Harshman, K.D., Parker, C.S., 1989. Yeast YAP1 encodes a novel form of the jun family of transcriptional activator proteins. Genes Dev. 3, 283–292. Neuberg, M., Adamkiewicz, J., Hunter, J.B., Muller, R., 1989. A Fos protein containing the Jun leucine zipper forms a homodimer which binds to the AP1 binding site. Nature 341, 243–245. O’Leary, N.A., Gross, P.S., 2006. Genomic structure and transcriptional regulation of the penaeidin gene family from Litopenaeus vannamei. Gene 371, 75–83. Perkins, K.K., Admon, A., Patel, N., Tjian, R., 1990. The Drosophila Fos-related AP-1 protein is a developmentally regulated transcription factor. Genes Dev. 4, 822–834. Qiu, W., Zhang, S., Chen, Y.G., Wang, P.H., Xu, X.P., Li, C.Z., et al., 2014. Litopenaeus vannamei NF-kappaB is required for WSSV replication. Dev. Comp. Immunol. 45, 156–162. Ren, J.H., Tao, Y., Zhang, Z.Z., Chen, W.X., Cai, X.F., Chen, K., et al., 2014. Sirtuin 1 regulates hepatitis B virus transcription and replication by targeting transcription factor AP-1. J. Virol. 88, 2442–2451. Shi, H., Yan, X., Ruan, L., Xu, X., 2012. A novel JNK from Litopenaeus vannamei involved in white spot syndrome virus infection. Dev. Comp. Immunol. 37, 421–428. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Wang, P.H., Gu, Z.H., Huang, X.D., Liu, B.D., Deng, X.X., Ai, H.S., et al., 2009. An immune deficiency homolog from the white shrimp, Litopenaeus vannamei, activates antimicrobial peptide genes. Mol. Immunol. 46, 1897–1904. Wang, P.H., Yang, L.S., Gu, Z.H., Weng, S.P., Yu, X.Q., He, J.G., 2013. Nucleic acid-induced antiviral immunity in shrimp. Antiviral Res. 99, 270–280. Wang, P.H., Gu, Z.H., Wan, D.H., Liu, B.D., Huang, X.D., Weng, S.P., et al., 2013. The shrimp IKK-NF-kappaB signaling pathway regulates antimicrobial peptide expression and may be subverted by white spot syndrome virus to facilitate viral gene expression. Cell. Mol. Immunol. 10, 423–436. Wang, X.W., Wang, J.X., 2013. Pattern recognition receptors acting in innate immune system of shrimp against pathogen infections. Fish Shellfish Immunol. 34, 981–989. Wisdom, R., 1999. AP-1: one switch for many signals. Exp. Cell Res. 253, 180–185. Xu, D., Liu, W., Alvarez, A., Huang, T., 2014. Cellular immune responses against viral pathogens in shrimp. Dev. Comp. Immunol. 47, 287–297. Yao, D., Ruan, L., Xu, X., Shi, H., 2014. Identification of a c-Jun homolog from Litopenaeus vannamei as a downstream substrate of JNK in response to WSSV infection. Dev. Comp. Immunol. 49, 282–289.